Oleosins may have a structural role to stabilize the lipid body during desiccation of the seed by preventing coalescence of the oil. Probably interacts with both lipid and phospholipid moieties of lipid bodies. May also provide recognition signals for specific lipase anchorage in lipolysis during seedling growth. Oleosins also increase the viability of over-wintering oilseeds by preventing abnormal fusion of oil bodies during imbibition in the spring. Cellular localisation: surface of oil bodies.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Camelina sativa, Capsella rubella, utrema salsugineum. Raphanus sativus Species of your interest not listed? Contact us
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
21 | 19 kDa
Not reactive in:
Glycine max
Selected references:
Shimada et al. (2008). A novel role for oleosins in freezing tolerance of oilseeds in Arabidopsis thaliana. Plant J. 2008 Sep;55(5):798-809. doi: 10.1111/j.1365-313X.2008.03553.x.
PYK10 is the main component of ER bodies. It has hydrolase activity, hydrolyzing O-glycosyl compounds It may produce defense compounds when plants are damaged by insects or wounding. Cellular localisation: ER bodies.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Conjugated peptide, derived from Arabidopsis thaliana C-terminal of PYK10, UniProt: A0A178VCN3, TAIR: At3g08880.
N-terminal signal peptide including 24 amino acis and ER retention signal is removed from the mature protein
Application Details:
1:500-1:1000 (IHC), 1: 5000- 1: 20 000 (WB)
Purity:
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
59,7 | 56 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Matsushima et al. (2003). A novel ER-derived compartment, the ER body, selectively accumulates a beta-glucosidase with an ER-retention signal in Arabidopsis. Plant J. 2003 Feb;33(3):493-502. doi: 10.1046/j.1365-313x.2003.01636.x.
PYK10 is the main component of ER bodies. It has hydrolase activity, hydrolyzing O-glycosyl compounds It may produce defense compounds when plants are damaged by insects or wounding.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Conjugated peptide, derived from Arabidopsis thaliana internal part of PYK10, UniProt: A0A178VCN3, TAIR: At3g08880.
Applications:
Immunofluorescence (IF), Immunohistochemistry (IHC), Immunoprecipitation (IP), Western blot (WB)
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
59,7 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Yamada et al. (2013). Identification of Two Novel Endoplasmic Reticulum Body-Specific Integral Membrane Proteins. Plant Physiol. 2013 Jan;161(1):108-20. doi: 10.1104/pp.112.207654. (Western blot, Arabidopsis thaliana) Nagano et al. (2005). Activation of an ER-body-localized -Glucosidase via a Cytosolic Binding Partner in Damaged Tissues of Arabidopsis thaliana. Plant Cell Physiol. 2005 Jul;46(7):1140-8. doi: 10.1093/pcp/pci126. (Immunoprecipiation, Western blot, Arabidopsis thaliana)Matshushima et al. (2003). A novel ER-derived compartment, the ER body, selectively accumulates a beta-glucosidase with an ER-retention signal in Arabidopsis. Plant J . 2003 Feb;33(3):493-502. doi: 10.1046/j.1365-313x.2003.01636.x. Immunofluorescence, Immunohistochemistry, Western blot, Arabidopsis thaliana)
Delta VPE (Vacuplar-Processing Enzyme delta-isozyme) is Asparagine specific endopeptidase that may be involved in processing of proteins targeted to vacuoles (By similarity). The enzyme is probably involved in post-translational proteolysis of seed storage proteins in the protein storage vacuole of developing seeds (PubMed:12417707, PubMed:14688293). Exhibits a caspase-1-like activity in extracellular granules. At the early stage of seed development, required for the formation of the seed coat, by regulating cell death of specific cell layers in inner integument (Nakaune et al. 2005).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Camelina sativa, Capsella rubella, Eutrema salsugineum, Raphanus sativus Species of your interest not listed? Contact us
Immunogen:
Recombinant, His6-tagged, delta-VPE from Arabidopsis thaliana, UniProt: Q9LJX8, TAIR: At3g20210
Applications:
Immunofluorescence (IF), Immunolocalisation (IL), Western blot (WB)
Subcellular localisation is seed specific and restricted to developing seeds at 7 days after anthesis, Delta-VPE is detected at lower levels in flowers siliques, specifically in seed coats
Application Details:
1: 500 (IF), 1: 5000 (IL), 1: 5000 (WB)
Purity:
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
52 kDa (inactive precursor) | 37-38 kDa (mature, active form)
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Kunieda et al. (2013). Spatiotemporal secretion of PEROXIDASE36 is required for seed coat mucilage extrusion in Arabidopsis. Plant Cell . 2013 Apr;25(4):1355-67.doi: 10.1105/tpc.113.110072. (Western blot, Arabidopsis thaliana)Kunieda et al. (2008). NAC family proteins NARS1/NAC2 and NARS2/NAM in the outer integument regulate embryogenesis in Arabidopsis. Plant Cell. 2008 Oct;20(10):2631-42.doi: 10.1105/tpc.108.060160. (Western blot, Arabidopsis thaliana)Nakaune et al. (2005). A vacuolar processing enzyme, deltaVPE, is involved in seed coat formation at the early stage of seed development. Plant Cell. 2005 Mar;17(3):876-87. doi: 10.1105/tpc.104.026872. (Immunofluorescence, Immunolocalisation by electron microscopy, Western blot, Arabidopsis thaliana)
Vacuolar-sorting receptor (VSR) involved in clathrin-coated vesicles sorting from Golgi apparatus to vacuoles. Required for the sorting of 12S globulin, 2S albumin and maybe other seed storage proteins to protein storage vacuoles (PSVs) in seeds. May also be implicated in targeting N-terminal propeptide containing proteins to lytic vacuoles. Subcellular localisation: Golgi apparatus membrane.Alternative names: BP80-like protein b, Epidermal growth factor receptor-like protein 1, AtELP, AtELP1, Spot 3 protein
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Nicotiana tabacum
Expected Species:
Brassica rapa, Capsella rubella, Camelina sativa, Eutrema salsugineum, Raphanus sativus, Tarenaya hassleriana Species of your interest not listed? Contact us
Immunogen:
Recombinant, His6-tagged, VSR1 from Arabidopsis thaliana, UniProt: P93026, TAIR: At3g52850
Higher apparent molecular weight of VSR1 is due to three determined glycosylations and several more predicted
Application Details:
1: 500 (IF), 1: 1000-1: 5000 (WB)
Purity:
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
68 | 80 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Fuji et al. (2016). The Adaptor Complex AP-4 Regulates Vacuolar Protein Sorting at the trans-Golgi Network by Interacting with VACUOLAR SORTING RECEPTOR1. Plant Physiol. 2016 Jan;170(1):211-9. doi: 10.1104/pp.15.00869. (Western blot, Arabidopsis thaliana) Kunieda et al. (2013). Spatiotemporal secretion of PEROXIDASE36 is required for seed coat mucilage extrusion in Arabidopsis. Plant Cell. 2013 Apr;25(4):1355-67. doi: 10.1105/tpc.113.110072. (Western blot, Arabidopsis thaliana)Yamada et al. (2005). Endosomal proteases facilitate the fusion of endosomes with vacuoles at the final step of the endocytotic pathway. Plant J. 2005 Mar;41(6):888-98. doi: 10.1111/j.1365-313X.2005.02349.x. (Immunofluorescence, Nicotiana tabacum)
Aleu protein may play a role in proteolysis leading to mobilization of nitrogen during senescence and starvation. Catalytic activity : Hydrolysis of proteins, acting as an aminopeptidase (notably, cleaving Arg-|-Xaa bonds) as well as an endopeptidase. Cellular localisation: vacuole. Alternative names: Senescence-associated gene product 2
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica oleracea, Camelina sativa, Capsella rubella, Eutrema salsugineum, Raphanus sativus Species of your interest not listed? Contact us
Immunogen:
Recombinant, His6-tagged, ALEU protein from Arabidopsis thaliana, UniProt: Q8H166, TAIR: At5g60360
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
38,9 | 24 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Takagi et al. et al. (2013). MAIGO5 functions in protein export from Golgi-associated endoplasmic reticulum exit sites in Arabidopsis. Plant Cell. 2013 Nov;25(11):4658-75. doi: 10.1105/tpc.113.118158. (Western blot, Arabidopsis thaliana)Ueda et al. (2006). AtVAM3 is required for normal specification of idioblasts, myrosin cells. Plant Cell Physiol. 2006 Jan;47(1):164-75. doi: 10.1093/pcp/pci232. (Western blot, Arabidopsis thaliana)
2S seed storage protein 3, one of major seed storage proteins is synthesized on the endoplasmic reticulum as precursor and then transported to storage vacuoles, where it is processed by an asparaginyl endopeptidase to produce two mature polypeptides referred to as large and small subunits which are linked by disulfide bonds. Subcellular localisation: vacuole.Alternative names: 2S albumin storage protein, NWMU2-2S albumin 3
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Conjugated peptide, derived from N-propeptide of Arabidopsis thaliana 2S3P, UniProt: P15459, TAIR: At4g27160
Applications:
ELISA (ELISA), Immunolocalization (IL) using electron microscopy, Western blot (WB)
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
18,7 | 17-20 kDa (2S albumin precursors)
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Shirakawa et al. (2014). CONTINUOUS VASCULAR RING (COV1) is a trans-Golgi network-localized membrane protein required for Golgi morphology and vacuolar protein sorting. Plant Cell Physiol. 2014 Apr;55(4):764-72. doi: 10.1093/pcp/pct195. (Western blot, Arabidopsis thaliana) Li et al. (2006). MAIGO2 is involved in exit of seed storage proteins from the endoplasmic reticulum in Arabidopsis thaliana. Plant Cell. 2006 Dec;18(12):3535-47. doi: 10.1105/tpc.106.046151.( Immunolocalisation by electron microscopy, Western blot, Arabidopsis thaliana)
2S seed storage protein 3, one of major seed storage proteins is synthesized on the endoplasmic reticulum as precursor and then transported to storage vacuoles, where it is processed by an asparaginyl endopeptidase to produce two mature polypeptides referred to as large and small subunits which are linked by disulfide bonds. Subcellular localisation: vacuole.Alternative names: 2S albumin storage protein, NWMU2-2S albumin 3
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Capsella rubella Species of your interest not listed? Contact us
Immunogen:
Conjugated peptide, derived of Arabidopsis thaliana 2S3 large subunit, UniProt: P15459, TAIR: At4g27160
Applications:
ELISA (ELISA), Immunolocalization (IL) using electron microscopy, Western blot (WB)
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
18, 7 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Takagi et al. (2013). MAIGO5 functions in protein export from Golgi-associated endoplasmic reticulum exit sites in Arabidopsis. Plant Cell . 2013 Nov;25(11):4658-75. doi: 10.1105/tpc.113.118158. (Immunolocalisation by electron microscopy, Western blot, Arabidopsis thaliana)
Major 12S seed storage protein CRC (globulin) is synthesized on the endoplasmic reticulum as precursor and then transported to storage vacuoles, where it is processed at a conserved Asn-Gly peptide bond by an asparaginyl endopeptidase to produce two mature polypeptides referred to as alpha and beta subunits that are joined together by a disulfide bond. Phosphorylated in seeds on some Tyr residues in response to abscisic acid (ABA). 12S CRC protein is cleaved to alpha and beta chains. Cellular localisation: vacuole.Alternative protein names: Cruciferin 3, Cruciferin C Legumin-type globulin Cruciferin1, Legumin-type globulin storage protein CRU1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Native, 12S globulin alpaha subunit purified from Arabidopsis thaliana and excised from SDS-PAGE gel. UniProt: Q96318, TAIR: At4g28520
Applications:
ELISA (ELISA), Immunolocalization (IL) using electron microscopy, Immunohistochemistry (IHC), Western blot (WB)
Assay dependent (ELISA), 1: 50 (IL by electron microscopy), 1: 100 (IHC), 1: 3000 - 1: 10 000 (WB)
Purity:
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
58 | 30 kDa (alpha subunit)
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Shirakawa et al. (2014). CONTINUOUS VASCULAR RING (COV1) is a trans-Golgi network-localized membrane protein required for Golgi morphology and vacuolar protein sorting. Plant Cell Physiol. 2014 Apr;55(4):764-72.doi: 10.1093/pcp/pct195. (Immunohistochemistry, Western blot)Li et al. MAG2 and three MAG2-INTERACTING PROTEINs form an ER-localized complex to facilitate storage protein transport in Arabidopsis thaliana. Plant J. 2013 Dec;76(5):781-91.doi: 10.1111/tpj.12347. (Immunolocalisation by electron microscopy, Western blot)
VPS35 (Vacuolar Protein Sorting-associated protein 35) plays a role in vesicular protein sorting. Component of the membrane-associated retromer complex which is essential in endosome-to-Golgi retrograde transport. Also involved in the efficient sorting of seed storage proteins globulin 12S and albumin 2S. The VPS29-VPS26-VPS35 subcomplex may be involved in recycling of specific cargos from endosome to the plasma membrane. Arabidopsis thaliana has three VPS35 homologs designated VPS35a, VPS35b and VPS35c, and among them,VPS35b plays most important role in these processes. Localised to pre-vacuolar compartments (PVC).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
89 | 98 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Yamazaki et al. (2008). Arabidopsis VPS35, a retromer component, is required for vacuolar protein sorting and involved in plant growth and leaf senescence. Plant Cell Physiol. 2008 Feb;49(2):142-56. doi: 10.1093/pcp/pcn006. (Immunofluorescence, Immunoprecipitation, Western blot)
VSP29 (Vacuolar protein sorting-associated protein 29) plays a role in vesicular protein sorting. Component of the membrane-associated retromer complex which is essential in endosome-to-Golgi retrograde transport. Required for the auxin-carrier protein PIN2 sorting to the lytic vacuolar pathway and the PIN1 recycling to the plasma membrane. Also involved in the efficient sorting of seed storage proteins globulin 12S and albumin 2S. The VPS29-VPS26-VPS35 subcomplex may be involved in recycling of specific cargos from endosome to the plasma membrane. Cellular localisation: endosome and Golgi apparatus.Alternative names: MAIGO1, Vesicle protein sorting 29
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
21 | 25 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Yamazaki et al. (2008). Arabidopsis VPS35, a retromer component, is required for vacuolar protein sorting and involved in plant growth and leaf senescence. Plant Cell Physiol. 2008 Feb;49(2):142-56. doi: 10.1093/pcp/pcn006. (Immunoprecipitation, Western blot, Arabidopsis thaliana)Shimada et al. (2006). et al. (2006). AtVPS29, a putative component of a retromer complex, is required for the efficient sorting of seed storage proteins. Plant Cell Physiol. 2006 Sep;47(9):1187-94. doi: 10.1093/pcp/pcj103. (Western blot, Arabidopsis thaliana)
COP1 (E3 ubiquitin-protein ligase COP1) is onvolved in proteasome-mediated ubiquitin-dependent protein catabolic process and protein ubiquitination. The protein contains a ring finger zinc-binding motif, a coiled-coil domain, and several WD-40 repeats, similar to G-beta proteins. Acts as a repressor of photomorphogenesis and as an activator of etiolation in darkness. Represses photomorphogenesis in darkness by mediating ubiquitination and subsequent proteasomal degradation of light-induced transcription factors such as HY5, HYH and LAF1. Localized in the nucleus in darkness but is gradually relocated to the cytoplasm upon illumination. Alternative names: Constitutive photomorphogenesis protein 1, RING-type E3 ubiquitin transferase COP1
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica napus, Brassica rapa, Camelina sativa, Capsella rubella, Eutrema salsugineum, Hirschfeldia incana, Raphanus sativusSpecies of your interest not listed? Contact us
Immunogen:
His-tagged recombinant part of COP1 protein from Arabidopsis thaliana, overexpressed in E.coli, UniProt: P43254, TAIR: AT2G32950
PGDH3 | Phosphoglycerate dehydrogenase 3 (chloroplastic) is an enzyme ((EC:1.1.1.95) involved in the plastidial phosphorylated pathway of serine biosynthesis (PPSB), step 1 of the subpathway that synthesizes L-serine from 3-phospho-D-glycerate. Expressed in aerial parts. Not detected in roots and meristematic tissue. Expressed in cotyledons, adult leaves, stigma and anther filaments.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Beside PGDH3 the antibody is recognizing in Arabidopsis thaliana PGDH1, UniProt: O49485-1 and PGDH2, UniProt: O04130-2
Application Details:
1 : 3000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
62,1 | 55-60 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
H hner et al. (2021) Stromal NADH supplied by PHOSPHOGLYCERATE DEHYDROGENASE3 is crucial for photosynthetic performance. Plant Physiology. 2021. kiaa117, https://doi.org/10.1093/plphys/kiaa117
Goat anti-human IgG Fcγ is a secondary antibody conjugated to HRP which binds to human IgG Fcγ (gamma chain) in immunological assays.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80°C. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Nucleaoprotein (N) of Novel Coronavirus SARS-CoV-2/ 2019-nCoV (human) plays a fundamental role during virion assembly through packaging of the positive strand viral genome RNA into a helical ribonucleocapsid (RNP).Alternative names: NC, Protein N, Nucleocapsid protein
Product Type:
Antibody
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C/-80°C. Reconstitute in deionized sterile water to a concentration from 0.1-1.0 mg/ml and add 5-50% of glycerol (final concentration). 50 % glycerol is a default final recommended concentration. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube. Working aliquotes can be stored at 4℃ for up to one week.Shelf life of liquid form is 6 monthss at -20 °C/-80°C. The shelf life of lyophilized form is 12 months at -20 °C/-80°C.
N-terminal His tagged Nucleoprotein (N) (6xHis) was overexpressed in E.coli in the region 1-419 amino acids UniProt P0DTC9: MSDNGPQNQRNAPRITFGGPSDSTGSNQNGERSGARSKQRRPQGLPNNTASWFTALTQHGKEDLKFPRGQGVPINTNSSPDDQIGYYRRATRRIRGGDGKMKDLSPRWYFYYLGTGPEAGLPYGANKDGIIWVATEGALNTPKDHIGTRNPANNAAIVLQLPQGTTLPKGFYAEGSRGGSQASSRSSSRSRNSSRNSTPGSSRGTSPARMAGNGGDAALALLLLDRLNQLESKMSGKGQQQQGQTVTKKSAAEASKKPRQKRTATKAYNVTQAFGRRGPEQTQGNFGDQELIRQGTDYKHWPQIAQFAPSASAFFGMSRIGMEVTPSGTWLTYTAAIKLDDKDPNFKDQVILLNKHIDAYKTFPPTEPKKDKKKKADETQALPQRQKKQQTVTLLPAADLDDFSKQLQQSMSSADSTQA Purity: >90 % as confirmed by SDS-PAGEBuffer: 0.2 μm filtered 20 mM Tris-HCl, 0.5 M NaCl, 6% Trehalose, pH 8.0
Nucleaoprotein (N) of Novel Coronavirus SARS-CoV-2/ 2019-nCoV (human) plays a fundamental role during virion assembly through packaging of the positive strand viral genome RNA into a helical ribonucleocapsid (RNP).Alternative names: NC, Protein N, Nucleocapsid protein
Product Type:
Antibody
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C/-80°C. Reconstitute in deionized sterile water to a concentration from 0.1-1.0 mg/ml and add 5-50% of glycerol (final concentration). 50 % glycerol is a default final recommended concentration. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube. Working aliquotes can be stored at 4℃ for up to one week.Shelf life of liquid form is 6 monthss at -20 °C/-80°C. The shelf life of lyophilized form is 12 months at -20 °C/-80°C.
N-terminal His tagged Nucleoprotein (N) (6xHis) was overexpressed in E.coli in the region 1-419 amino acids UniProt P0DTC9: MSDNGPQNQRNAPRITFGGPSDSTGSNQNGERSGARSKQRRPQGLPNNTASWFTALTQHGKEDLKFPRGQGVPINTNSSPDDQIGYYRRATRRIRGGDGKMKDLSPRWYFYYLGTGPEAGLPYGANKDGIIWVATEGALNTPKDHIGTRNPANNAAIVLQLPQGTTLPKGFYAEGSRGGSQASSRSSSRSRNSSRNSTPGSSRGTSPARMAGNGGDAALALLLLDRLNQLESKMSGKGQQQQGQTVTKKSAAEASKKPRQKRTATKAYNVTQAFGRRGPEQTQGNFGDQELIRQGTDYKHWPQIAQFAPSASAFFGMSRIGMEVTPSGTWLTYTAAIKLDDKDPNFKDQVILLNKHIDAYKTFPPTEPKKDKKKKADETQALPQRQKKQQTVTLLPAADLDDFSKQLQQSMSSADSTQA Purity: >90 % as confirmed by SDS-PAGEBuffer: 0.2 μm filtered 20 mM Tris-HCl, 0.5 M NaCl, 6% Trehalose, pH 8.0
Nucleaoprotein (N) of Novel Coronavirus SARS-CoV-2/ 2019-nCoV (human) plays a fundamental role during virion assembly through packaging of the positive strand viral genome RNA into a helical ribonucleocapsid (RNP).Alternative names: NC, Protein N, Nucleocapsid protein
Product Type:
Antibody
Antibody Type:
Monoclonal recombinant (clone 1A6)
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Human Nucleoprotein (N) of Novel Coronavirus SARS-CoV-2/ 2019-nCoV
Immunogen:
Recombinant Human Novel Coronavirus Nucleoprotein (N) (1-419aa), UniProt: P0DTC9
Recombinant anti-SARS-CoV-2 Nucleoprotein Mouse ScFv were expressed in 293 cells (HEK293) with a human IgG1 Fc tag on C-terminal. Therefore, anti-human IgG1 Fc, secondary antibody has to be used: AS10 791 | Anti-Human IgG Fc, HRP conjugated, goat antibodiesAS10 797 | Anti-Human IgG Fc, HRP conjugated, min. cross-reactivity bovine/mouse/rabbit serum, goat antibodiesAS10 787 | Anti-Human IgG Fc, ALP conjugated, goat antibodies AS10 793 | Anti-Human IgG Fc, ALP conjugated, min. cross-reactivity to bovine/mouse/rabbit serum, goat antibodies
SARS-CoV-2/ 2019-nCoV S protein of Novel Coronavirus (human) its role is to attache the virion to the cell membrane by interacting with host receptor (ACE2) and initiating the infection. Alternative names: S, S1, S1-RBD, Spike glycoprotein.
Product Type:
Antibody
Antibody Type:
Monoclonal recombinant
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Human Novel SARS-CoV-2/ 2019-nCoV S protein
Immunogen:
Recombinant Human Novel Coronavirus Spike glycoprotein (S) (16-685aa), UniProt: P0DTC2 Antigen sequence has highest homology to Spike protein S1.
Recombinant anti-SARS-CoV-2 spike Mouse ScFv is expressed in 293 cells (HEK293) with a human IgG1 Fc tag on C-terminal. Therefore, anti-human IgG1 Fcγ (gamma chain), secondary antibody has to be used: AS20 4390
Beta-tubulin is a conserved protein involved in cell motility, structure and integrity, tissue development and the development of organism. Tubulin is expressed at high levels in almost all tissues and cell lines. This makes it ideal to use as a loading control in Western blot.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store at -20 °C for 3 years or more, Reconstitute with distilled water to desired concentration before use, Aliquot to avoid repeated freeze-thaw cycles, Store aliquots at 4°Cfor several days to weeks
Host Animal:
Mouse
Species Reactivity:
Chicken, human, monkey, mouse, rat, rabbit
Immunogen:
Synthetic peptide derived from the N-terminal of the human beta-tubulin
Applications:
Dot blot (Dot), ELISA (ELISA), Immunohistochemistry (IHC), Western blot (WB)
Beta-Actin is a conserved protein involved in cell motility, structure and integrity, tissue development and the development of organism. Actin is expressed at high levels in almost all tissues and cell lines. This makes it ideal to use as a loading control in Western blot.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store at -20 °C for 3 years or more, Reconstitute with distilled water to desired concentration before use, Aliquot to avoid repeated freeze-thaw cycles, Store aliquots at 4°Cfor several days to weeks
Host Animal:
Mouse
Species Reactivity:
Chicken, human, mouse, rabbit, rat
Immunogen:
Synthetic peptide derived from the N-terminal of the human beta-actin
Applications:
Dot blot (Dot), ELISA (ELISA), Immunohistochemistry (IHC), Western blot (WB)
Chicken anti-DYKDDDDK is a primary antibody which binds to DYKDDDDK (Sigma FLAG ).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
DYKDDDDK epitope tag (Sigma FLAG )
Immunogen:
KLH-conjugated synthetic peptide: DYKDDDDK (Sigma FLAG ).
Applications:
ELISA (ELISA), Immunofluorsescence (IF), Western blot (WB)
Antibody was analyzed using amino-terminal Met-Flag-BAP, amino- terminal FLAG-BAP and carboxy-terminal FLAG-BAP fusion proteins and Invitrogen Positope R900-40
Phosphorylation of specific tyrosine residues has been shown to be a primary mechanism of signal transduction during normal mitogenesis, cell cycle progression and oncogenic transformation. Antibodies that specifically recognize phosphorylated tyrosine residues have proved to be invaluable to the study of tyrosine -phosphorylated proteins and the biochemical pathways in which they function.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Phosphotyrosine - not species dependent
Immunogen:
balbC mice immunized with phosphotyrosine coupled to carrier protein
Applications:
ELISA (ELISA), Immunohistochemistry (IHC), Immunoprecipitation (IP), Western blot (WB)
Multi-subunit complex of cytb6/f is a crucial component for the photosynthetic electron transport chain of higher plants, green algae and cyanobacteria. This complex is catalyzing oxidation of quinols and the reduction the reduction of plastocyanin. This reaction allows to establish the proton force required for the ATP synthesis. Four major subunits build the complex: the petA gene product corresponding to a c-type cytochrome (cytf), the petB gene product corresponding to a b-type/c’-type cytochrome with three haems (cyt b6), the petD gene product (subunit IV, or suIV), and the petC gene product, corresponding to the Rieske/Iron/sulfur protein.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Lempiainen et al. (2022) Plants acclimate to Photosystem I photoinhibition by readjusting the photosynthetic machinery. Plant Cell Environ. 2022 Oct;45(10):2954-2971. doi: 10.1111/pce.14400. Epub 2022 Aug 16. PMID: 35916195.
RPB2 (DNA-directed RNA polymerase II subunit 2) is a unique second-largest subunit of DNA-dependent RNA polymerase II. Alternative names: DNA-directed RNA polymerase II 135 kDa polypeptide DNA-directed RNA polymerase II subunit RPB2 (EC:2.7.7.6), RNA polymerase II subunit B2, Protein EMBRYO DEFECTIVE 1989
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
SARS-CoV-2, use its Spike Glycoprotein to attach the viron to its receptor, human angiotensin-converting enzyme 2 (hACE2) and therby mediate membrane fusion and virus entry into the cell.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
SARS-CoV-2 Spike Glycoprotein
Immunogen:
KLH-conjugated peptide derived from UniProt:P0DTC2.
eIF2-alpha (Eukaryotic translation initiation factor 2 subunit alpha) functions in the early steps of protein synthesis by forming a ternary complex with GTP and initiator tRNA. eIF2 is a heterodimer composed of an alpha, beta and gamma chain.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica napus, Brassica oleracea, Camelina sativa, Capsella rubella, Medicago truncatula, Noccaea caerulescens, Papaver somniferum, Raphanus sativus, Tarenaya hasslerianaSpecies of your interest not listed? Contact us
GLDP (Glycine decarboxylase P protein) catalyzes the degradation of glycine. The P protein binds the alpha-amino group of glycine through its pyridoxal phosphate cofactor. Is involved in response to cadmium ion. Alternative names: AtGLDP1, AtGLDP2, Glycine dehydrogenase (aminomethyl-transferring) 1, Glycine dehydrogenase (aminomethyl-transferring) 2, Glycine cleavage system P protein 1, Glycine cleavage system P protein 2, Glycine decarboxylase 1, Glycine decarboxylase 2, Glycine decarboxylase P-protein 1, Glycine decarboxylase P-protein 2.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
So far only leaf tissue has been used for immunolocalization and western blot experiments
Application Details:
1:50 (IL), 1 : 5000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
113 kDa
Not reactive in:
Tecticornia spp., Salsola soda
Selected references:
Khoshravesh et al. (2020). The Evolutionary Origin of C4 Photosynthesis in the Grass Subtribe Neurachninae.Plant Physiol. 2020 Jan;182(1):566-583. doi: 10.1104/pp.19.00925.
V-ATPase subunit VHA-a3 The protein is essential component of the vacuolar proton pump (V-ATPase), a multimeric enzyme that catalyzes the translocation of protons across the membranes and required for assembly and activity of the V-ATPase. Involved in vacuolar nutrient storage (e.g. accumulation and storage of nitrate) and in tolerance to some toxic ions (e.g. zinc ions sequestration in vacuoles). Alternative names: V-type proton ATPase 95 kDa subunit a isoform 3, V-ATPase 95 kDa isoform a3, Vacuolar H(+)-ATPase subunit a isoform 3, Vacuolar proton pump subunit a3, Vacuolar proton translocating ATPase 95 kDa subunit a isoform 3.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica campestris, Brassica oleracea, Brassica rapa, Capsella rubella, Eutrema salsugineu, Noccaea caerulescens Species of your interest not listed? Contact us
PsaG (PSI-G subunit of photosystem I) is a 11-kDa membrane protein that plays an important role in electron transport between plastocyanin and PSI and is involved in the stability of the PSI complex. PSI-G subunit is bound to PSI-B and is in contact with Lhca1. The protein inserts into thylakoids by a direct or "spontaneous" pathway that does not involve the activities of any known chloroplast protein-targeting machinery. PSI-G appears to be directly or indirectly involved in the interaction between Photosystem I and plastocyanin.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Medicago truncatula, Spinacia oleracea, Vitis viniferaSpecies of your interest not listed? Contact us
P. tricornutum contains only four Lhcx proteins, which are are structurally similar, but are differentially expressed under varying environmental conditions.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Phaeodactylum tricornutum
Expected Species:
Cyclotella cryptica, Cytocella meneghiniana, Durinskia baltica, Fragilariopsis cyclindrus, Thalassioria pseudonana, Pseudo-nitzschia multistriata, Vitrella brassicaformis CCMP3155 Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from C-terminal sequence of Lhcx protein from Phaeodactylum tricornutum. 14 (Lhcx1, Lhcx3), 13 (Lhcx2), and 12 (Lhcx4) out of 15 amino acids long peptide used to elicit this antibody is contained specifically in the C-terminus of the respective Lhcx proteins in P. tricornutum
Lhcx1: 21,95 | 16 kDa Lhcx2: 24,73 | 22 kDa Lhcx3: 22,24 | 17-18 kDa Lhc4: 22,86 | 17-18 kDa However, based on other marker and gel systems, Lhcx1 and Lhcx3/4 may also appear at 18 and 19-20 kDa,
Selected references:
Buck et al. (2021) Identification of sequence motifs in Lhcx proteins that confer qE-based photoprotection in the diatom Phaeodactylum tricornutum. Plant J. 2021 Dec;108(6):1721-1734. doi: 10.1111/tpj.15539. Epub 2021 Nov 3. PMID: 34651379.Buck et al. (2019). Lhcx proteins provide photoprotection via thermal dissipation of absorbed light in the diatom Phaeodactylum tricornutum. Nat Commun. 2019 Sep 13;10(1):4167. doi: 10.1038/s41467-019-12043-6.
ACC synthase 8 belongs to a group fo enzymes which catalyze the conversion of S-adenosyl-L-methionine (SAM) into 1-aminocyclopropane-1-carboxylate (ACC), a direct precursor of ethylene. ACS8 is auxin inducible. Alternative names: 1-aminocyclopropane-1-carboxylate synthase 8, ACC synthase 8, S-adenosyl-L-methionine methylthioadenosine-lyase 8.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
OLE9 | Major pollen allergen Ole e 9 is an enzyme (EC 3.2.1.39), which is catalyzing Hydrolysis of (1->3)-beta-D-glucosidic linkages in (1->3)-beta-D-glucans.Alternative names: Glucan endo-1,3-beta-D-glucosidase (Major pollen allergen Ole e 9) (allergen Ole e 9), OLE9
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Gamma-glutamyl hydrolase is an enzyme (EC 3.4.19.9) displaying gamma-glutamyl-peptidase activity. Alternative names: conjugase) (GH) (Gamma-Glu-X carboxypeptidase)
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Glycine max
Expected Species:
Glycine soja (Gamma-glutamyl hydrolase isoform A and B) Species of your interest not listed? Contact us
Major pollen allergen Lol p 5a causes an allergic reaction in human - grass pollen ellergy. Alternative names: Allergen Lol p Ib, Allergen Lol p Va, allergen Lol p 5a.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles.Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Lolium perenne
Immunogen:
Recombinant Lolium perenne Major pollen allergen Lol p 5a protein amino acid: 26-307, UniProt: Q40240
Putative protease Do-like 12 is a mitochondrial enzyme with serine-type endopeptidase avtivity (EC 3.4.21.-) involved in proteolysis. Localized to mitochondrial matrix. Alternative names: Degradation of Periplasmic Proteins 12.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
Recombinant Putative protease Do-like 12 derived from the sequence of Arabidopsis thaliana, amino acids 25-499, UniProt: Q9LK70 TAIR: AT3G16550
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Preservative: 0.03% Proclin 300. Preparation contains: 50% Glycerol, 10 mM PBS, pH 7.4Reactivit of this antibody on endogenous material remains to be determined.
Polygalacturonase (PG) is an enzyme (EC 3.2.1.15) involved in cell wall biogenesis/degradation and food ripening. Belongs to glycoside hydrolase family 28. Alternative names: Pectinase, allergen Cha o 2.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Arachin Ahy-3 is a hexamer, composed of an acidic and a basic chain, derived from a single precursor and linked by a disulfied bond. Belongs to the 11S seed storage protein (globulins) family. Arachin Ahy-3 chain alpha; Arachin Ahy-3 chain beta.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Conglutin (allergen Ara h 6) causes allergic reaction in humans and binds to IgE.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Parvalbumin beta causes allergic reaction in humans. Alternative names: Allergen Gad c I, Allergen M
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Gadus morhua subsp. callarias (Baltic cod) (Gadus callarias)
Omega-gliadin is wheat allergen. It is a water-insoluble component of gluten. Omega-gliadin is one of the three main types of gliadin to which body in intolerant in celiac disease.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Triticum monococcum
Expected Species:
Aegilops tauschiiSpecies of your interest not listed? Contact us
Cyclin-B1-1 is a cyclin-dependent protein kinase involved in cell division. Functions as an effector of growth contol at G2/M. Alternative names: Cyc1-At, G2/mitotic-specific cyclin-B1-1, CycB1;1, CYCB1-1, CYC1
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica campestris, Capsella rubella, Eutrema salsugineum, Noccaea caerulescensSpecies of your interest not listed? Contact us
Immunogen:
Recombinant Cyclin-B1-1 protein derived from Arabidopsis thaliana sequence, amino acids: 1-428. UniProt: P30183 TAIR: AT4G37490
>95%, Protein G purified to a total immunoglobulin G fraction.
Molecular Weight:
48,4 | 49 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Preservative: 0.03% Proclin 300. Preparation contains: 50% Glycerol, 10 mM PBS, pH 7.4Reactivity of this antibody on endogenous extract remains to be confirmed.
Polygalacturonase (PG) is an enzyme (EC 3.2.1.15) involved in cell wall biogenesis and degradation and fruit ripening. Protein is cusing an allergic reaction in human. Alternative names: Allergen Cry j II, Major pollen allergen Cry j 2, Pectinase, allergen Cry j 2.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles.
L-ascorbate oxidase has oxidoreductase activity and belongs to multicopper oxidase family and is an apoplastic enzyme involved in metabolism of plant ascorbate (AA). Ascorbate (AA) plays a key role in defense against oxidative stress and is particularly abundant in photosynthetic tissues. Over 90% of the ascorbate is localized in the cytoplasm, but a substantial proportion is exported to the apoplast.Alternative names: (ASO) (Ascorbase) (EC 1.10.3.3), AAO
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Cucurbita maxima
Expected Species:
Cucumis melo, Cucumis sativus, Nelumbo nucifera, Theobroma cacao Species of your interest not listed? Contact us
Reactivity of this antibody on endogenous material remains to be determined
Application Details:
1 : 1000 - 1: 5000 (WB)
Purity:
>95%, Protein G purified to a total immunoglobulin G fraction.
Molecular Weight:
65 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Preservative: 0.03% Proclin 300. Preparation contains: 50% Glycerol, 10 mM PBS, pH 7.4Reactivity of this antibody on endogenous material remains to be determined.
Osmotin protein (from thaumatin protein family), coded by a gene AP24. Known to inhibit the germination and growth of the fungus Phytophthora infestans. Protein is induced by: salt stress, ABA viral infection and wounding. Localised to vacuole.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Nicotiana tabacum
Expected Species:
Capsicum annuum, Solanum lycopersicumSpecies of your interest not listed? Contact us
Immunogen:
Recombinant Osmotin derived from Nicotiana tabacum protein sequence, amino acids: 22-246. UniProt: P14170
>95%, Protein G purified to a total immunoglobulin G fraction.
Molecular Weight:
26 | 27 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Preservative: 0.03% Proclin 300. Preparation contains: 50% Glycerol, 10 mM PBS, pH 7.4Reactivity of this antibody on endogenous sample remains to be determined.
Major allergen Api g 1, isoallergen 2 (Allergen Api g 1.0201) (allergen Api g 1)
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Apium graveolens
Immunogen:
Recombinant Apium graveolens Major allergen Api g 1, isoallergen 2 protein, amino acids: 1-159, UniProt:P92918
Pollen allergen Dac g 3 with other names: Allergen Dac g III, allergen Dac g 3.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Major pollen allergen Dac g 4 (allergen Dac g 4) (Fragments) is a grass pollen allergen.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Major allergen Alt a 1 (allergen Alt a 1), ALTA1 is a unique beta-barrel protein dimer found in fungi, Alternaria, most common mold, associated with allergic diseses like asthma.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Wheat gliadin is a class of proteins being a main component of gluten fraction and present in wheat and other cereals.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
PsbE (Cytochrome b559 subunit alpha) is tightly associated with the reaction center of photosystem II (PSII). Alternative name: PSII reaction center subunit V
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Synechocystis PCC 6803
Expected Species:
Bathycoccus prasinos, Capsosiphon fulvescens, Chlamydomonas sp., Gonium pectorale,Mesostigma viride, Microglena monadina, Nannochloropsis granulata,Neglectella solitaria, Ostreococcus tauri, Pandorina morum, Planctonema lauterbornii, Thermosynechococcus vulcanus, Tupiella akineta, Ulva lactuca, Volvulina compacta, Volvox africanus, Yamagishiella unicoccaSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from algal PsbE sequences, including Chlamydomonas reinhardtii PsbE UniProt: P48268
Guanine nucleotide-binding proteins (G proteins) are involved as modulators or transducers in various transmembrane signalling systems.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Oryza sativa
Expected Species:
Arabidopsis thaliana
Immunogen:
recombinat protein of Oryza sativa expressed in E.coli
FNRL | Ferredoxin-NADP+ oxidoreductase-like (FNRs; EC:1.18.1.2) is a member of the plant-type FNR family. It contains a two-domain scaffold that forms the basis of an extended superfamily of flavin adenine dinucleotide (FAD) dependent oxidoreductases. FNRL is soluble protein in chloroplast stroma.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica cretica, Capsella rubella, Eutrema salsugineum, Noccaea caerulescens Species of your interest not listed? Contact us
CAH6 (Carbonic anhydrase 6) is a zinc-containing metalloenzymes that catalyze the reversible hydration of CO2. There are three evolutionary not related families of carbonic anhydrases: alpha, beta and gamma. CAH6 belonds to the beta family and initially was localized to chloroplasts Mitra et al. (2004).However, lately localization to flagella has been confirmed Mackinder et al. 2017.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii
Expected Species:
Gonium pectorale, Volvox carteriSpecies of your interest not listed? Contact us
Immunogen:
Recombinant, full length CAH6 of Chlamydomonas reinhardtii, excised from the gel, UniProt: Q6S7R9
Lately localization to flagella has been confirmed for CAH6 Mackinder et al. 2017.Extraction method – harvest the cells and add SDS sample buffer.
Mackinder et al. 2017. A Spatial Interactome Reveals the Protein Organization of the Algal CO2-Concentrating Mechanism. Cell. 2017 Sep 21;171(1):133-147.e14. doi: 10.1016/j.cell.2017.08.044.Mitra et al. (2004). Identification of a new chloroplast carbonic anhydrase in Chlamydomonas reinhardtii. Plant Physiol. 2004 May;135(1):173-82.
BetaCA1 (Beta carbonic anhydrase 1) (chloroplastic) - is a zinc metalloenzyme that interconvert CO2 and HCO3 (-). Alternative names: ARABIDOPSIS THALIANA SALICYLIC ACID-BINDING PROTEIN 3, ATBCA1, ATSABP3, BETA CARBONIC ANHYDRASE 1, CA1, CARBONIC ANHYDRASE 1, SABP3, SALICYLIC ACID-BINDING PROTEIN 3.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Solanum lycopersicum Q5NE20 Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide, derived in the part C-terminus of BetaCA1 of Arabidopsis thaliana, UniProt: P27140, TAIR: At3g01500
Extraction method – Grind 50 mg of leaf tissue in a sterile microcentrifuge tube using a sterile plastic pestle. Add 132μL of Protein Extraction Buffer (1x TE, 1.2 %SDS, 2.7% sucrose, 7.5 μg mL-1 bromophenol blue) to the ground leaf tissue. Vortex the sample and keep on ice for 15 mins. Centrifuge at 14,000 rpm for five minutes using a benchtop centrifuge. Collect the supernatant and in a new sterile 0.5 ml microcentrifuge tube and discard the pellet.This antibody does not recognize betaCA2.
Application Details:
1 : 20 000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
37,5 | 25,3 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
DiMario et al. (2016). The Cytoplasmic Carbonic Anhydrases βCA2 and βCA4 Are Required for Optimal Plant Growth at Low CO2. Plant Physiol. 2016 May;171(1):280-93. doi: 10.1104/pp.15.01990.
FBPase1 (Fructose-1,6-bisphosphatase 1, chloroplastic (chloroplastic marker in photosynthetic tissues) involved in carbohydrate biosynthesis. Alternative names: D-fructose-1,6-bisphosphate 1-phosphohydrolase, HCEF1 (High Cyclic Electron Flow 1).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Abrus precatorius, Actinidia chinensis, Arabis nemorensis, Beta vulgaris, Brassica napus, Capsella rubella, Cephalotus follicularis, Eucalyptus grandis, Gossypium tomentosum, Hibiscus syriacus, Manihot esculenta, Morella rubra, Mucuna pruriens, Nelumbo nucifera, Parasponia andersonii, Populus sp., Prunus dulcis, Prunus persica, Salvia splendens, Syzygium oleaosum, Vitis vinifera Species of your interest not listed? Contact us
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Penzler et al. (2022) Commonalities and specialties in photosynthetic functions of PROTON GRADIENT REGULATION5 variants in Arabidopsis. Plant Physiol. 2022;190(3):1866-1882. doi:10.1093/plphys/kiac362Wang et al. (2022), Arabidopsis Ubiquitin-Conjugating Enzymes UBC4, UBC5, and UBC6 Have Major Functions in Sugar Metabolism and Leaf Senescence, Int. J. Mol. Sci. 2022, 23(19), 11143; https://doi.org/10.3390/ijms231911143Lim et al (2022). Arabidopsis guard cell chloroplasts import cytosolic ATP for starch turnover and stomatal opening. Nat Commun. 2022 Feb 3;13(1):652. doi: 10.1038/s41467-022-28263-2. PMID: 35115512; PMCID: PMC8814037.
MC4 (Metacaspase-4) is a cysteine protease that cleaves specifically after arginine or lysine residues. Does not cleave caspase-specific substrates. Plays a positive regulatory role in biotic and abiotic stress-induced programmed cell death. Alternative names: AtMCP2d,Metacaspase 2d
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube. Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Raphanus sativus, Noccaea caerulescensSpecies of your interest not listed? Contact us
Full length MC4 (zMC4) disappears upon wounding, Accumulation of specific lower weight bands of active MC4 subunits, p20) is not detected with this antibody
Application Details:
1 : 1000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
45,5 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
To be added when available, antibody released in November 2020.
ERD7 (Early Response to Dehydration ) and its homologs are important for plant stress responses and development and associated with modification of membrane lipid composition.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
To induce detectable levels of ERD7, plants need to be exposed to low temperature of 4 C for 24 h.The protein is detected in the microsomal fraction. (Barajas-Lopez et al, 2021)
Application Details:
1 : 2000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
49 | 58 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Barajas-Lopez et al. (2021) EARLY RESPONSE TO DEHYDRATION 7 Remodels Cell Membrane Lipid Composition during Cold Stress in Arabidopsis. Plant Cell Physiol. 2021 Mar 25;62(1):80-91. doi: 10.1093/pcp/pcaa139. PMID: 33165601.
CPK1 (CALCIUM-DEPENDENT PROTEIN KINASE1) is a calcium-dependent protein kinase that can phosphorylate phenylalanine ammonia lyase (PAL), a key enzyme in pathogen defense. Alternative names: AtCDPK 1, CDPK 1, Calcium-dependent protein kinase isoform AK1,
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Noccaea caerulescen, Triticum sp. Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana CPK1 protein sequence, UniProt: Q06850-1, TAIR AT5G04870
EPYC1 (Essential Pyrenoid Component 1), also known as Lci5, is localizing in the pyrenoid matrix, is of similar abundance as Rubisco and its function is scaffolding for the assembly of Rubisco in the pyrenoid.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardti
Expected Species:
Chlamydomonas reinhardtii
Immunogen:
KLH-conjugated peptide derived from Chlamydomonas reinhardtii EPYC1, C-terminal part UniProt: A0A2K3DA85
PGRL1 is a transmembrane protein present in thylakoids of higher plants and algae. Arabidopsis plants lacking PGRL1 show perturbation of cyclic electron transport (CEF) around photosystem I (PSI), similar to PGR5-deficient plants. PGRL1 has been shown to interact physically with PGR5 and associate with PSI (DalCorso et al., 2008). In Chlamydomonas reinhardtii, PGRL1 is part of a protein supercomplex, composed of PSI with its own light-harvesting complex (LHCI), the photosystem II light-harvesting complex (LHCII), the cytochrome b6/f complex (Cyt b6f), ferredoxin (Fd)-NADPH oxidoreductase (FNR), responsible of the energy balance of the two photosystems and of the switch between thylakoid linear and cyclic electron transport (Iwai et al., 2010). Synonymes: Ferredoxin-plastoquinone reductase 1
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Dichanthelium oligosanthes, Glycine soja, Gossypium arboreum, Klebsormidium nitens, Nelumbo nucifera, Noccaea caerulescens, Physcomitrium patens, Prunus dulcis, Prunus yedoensis, Rhizophora mucronatamm, Solanum chacoense, Trifolium medium, Zea mays, Vitis viniferaSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana PGRL1A UniProt: Q8H112, TAIR: At4g22890Peptide used to elicit this antibody is conserved in both isoforms PGRL1A and 1B of Zea mays
McKinnon et al. (2020). Membrane Chaperoning of a Thylakoid Protease Whose Structural Stability Is Modified by the Protonmotive Force. Plant Cell DOI: 10.1105/tpc.19.00797
Alzheimer's disease (AD) is the most prevalent neurodegenerative disease in the growing population of elderly people. A hallmark of AD is the accumulation of plaques in the brain of AD patients. The plaques predominantly consist of aggregates of amyloid-beta (Abeta), a peptide of 39-42 amino acids generated in vivo by specific, proteolytic cleavage of the amyloid precursor protein.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Human
Expected Species:
Bovine, Chicken, Dog, Porcine, Rabbit
Immunogen:
Synthetic peptide chosen from human Abeta (1-11) peptide DAEFRHDSGYE
Alzheimer's disease (AD) is the most prevalent neurodegenerative disease in the growing population of elderly people. A hallmark of AD is the accumulation of plaques in the brain of AD patients. The plaques predominantly consist of aggregates of amyloid-beta (Abeta), a peptide of 39-42 amino acids generated in vivo by specific, proteolytic cleavage of the amyloid precursor protein.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Human
Expected Species:
Bovine, Chicken, Dog, Porcine, Rabbit
Immunogen:
Synthetic peptide chosen from human Abeta (1-11) peptide DAEFRHDSGYE
Alzheimer's disease (AD) is the most prevalent neurodegenerative disease in the growing population of elderly people. A hallmark of AD is the accumulation of plaques in the brain of AD patients. The plaques predominantly consist of aggregates of amyloid-beta (Abeta), a peptide of 39-42 amino acids generated in vivo by specific, proteolytic cleavage of the amyloid precursor protein.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Human
Expected Species:
Bovine, Chicken, Dog, Porcine, Rabbit
Immunogen:
Synthetic peptide chosen from human Abeta (18-30) peptide VFFAEDVGSNKGA
RPSA or 30S ribosomal protein S1 (bacterial) is required for translation of most natural mRNAs.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
bacteria
Immunogen:
KLH-conjugated peptide derived from RPSA of E.coli, UniProt: P0AG67
LHCR4 (Protein fucoxanthin chlorophyll a/c protein) is a PSI supercomplex peripheral antenna protein, identified by proteome analysis as type‐R light‐harvesting complexes (LHCr4).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Phaeodactylum tricornutum
Expected Species:
Gambierdiscus australes, Madurella mycetomatisSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Phaeodactylum tricornutum LHCR4, UniProt: B7FQE1
RPS6A (40S ribosomal protein S6-1) is the major substrate of protein kinases in eukaryote ribosomes. Essential during gametogenesis.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Actinidia rufa, Ananas comosus, Beta vulgaris, Cajanus cajan, Capsicum chinense, Citrus clementina, Gossypium australe, Olea europaea subsp. europaea, Oryza sativa, Panicum miliaceum, Populus alba, Sesamum indicum, Senna tora, Solanum lycopersicum, Vigna unguiculataSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana RPS6A, UniProt: O48549, TAIR: At4g31700 phosphorylated at Ser240
NdbA (Thylakoid Localized Type 2 NAD(P)H Dehydrogenase) is localized to the thylakoid membrane and expressed at a very low level in the widl type under photoautotrophic growth. NdbA is induced substantially under light-activated heterotophic growth conditions.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Synechocystis sp. PCC 68
Expected Species:
Bacillus subtilis Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from NdbA protein sequence of Synechocystis sp. PCC 6803, UniProt:P73739 Chosen peptide is not conserved in NdbB and NdbC.
Protein extraction: harvested cells were suspended in a buffer containing 50 mM Hepes-NaOH, pH 7,5, 30 mM CaCl2, 800 mM sorbitol, 1 mM ε-amino-n-caproic acid, and the cells were broken by vortexing 6 1 min at 4 C in the presence of glass beads, Protein samples were solubilized in Laemmli buffer containing 6 M urea and separated on a gel in presence of 6M urea
Application Details:
1 : 2000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
49 | 46 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Huokko et al. (2019). Thylakoid Localized Type 2 NAD(P)H Dehydrogenase NdbA Optimizes Light-Activated Heterotrophic Growth of Synechocystis sp. PCC 6803. Plant Cell Physiol. 2019 Mar 7. pii: pcz044. doi: 10.1093/pcp/pcz044.
Malate synthase is involved in the synthesis of (S)-malate from isocitrate, where it catalyses the reaction: acetyl-CoA + glyoxylate + H(2)O = (S)-malate + CoA + H(+). This is part of the glyoxylate cycle, which is itself part of carbohydrate metabolism.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Nicotiana tabacum
Expected Species:
Arabidopsis thaliana, Cajanus cajan, Cinnamomum micranthum f. kanehirae, Cucumis sativus, Cucurbita maxima, Fagus sylvatica, Glycine max, Jatropha curcas, Morus notabilis, Mucuna pruriens, Parasponia andersonii, Populus alba x tremula, Theobroma cacao, Trema orientale Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Cucurbita maxima UniProt: P24571
Experimental contitions: 5 g of total protein extracted freshly from 3-4 weeks old plant leaves with a blender at 4 C in 300 mM Sorbitol, 50 mM HEPES, 5mM MgCl2. Separated on 10 % SDS-PAGE and blotted 1h to PVDF, semi-dry. Blot was blocked with 6 % milk for 1h 4 C with agitation. Blot was incubated in the primary antibody at a dilution of 1: 1 000 ON at 4 C with agitation. According to South et. al (2019).
Application Details:
1 : 1000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
65 kDa
Not reactive in:
Sorghum bicolor
Selected references:
South et. al (2019). Synthetic glycolate metabolism pathways stimulate crop growth and productivity in the field. Science 2019 Jan 4;363(6422), DOI: 10.1126/science.aat9077
PLGG1 (Plastidal glycolate/glycerate translocator) is a glycolate/glycerate transporter protein required for photorespiration Alternative names of protein: AtLrgB, LrgB, PLGG
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Nicotiana tabacum
Expected Species:
Arabidopsis thaliana, Noccaea caerulescensSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana UniProt: Q9FVQ4
Experimental contitions: 5 g of total protein extracted freshly from 3-4 weeks old plant leaves with a blender at 4 C in 300 mM Sorbitol, 50 mM HEPES, 5mM MgCl2. Separated on 10 % SDS-PAGE and blotted 1h to PVDF, semi-dry. Blot was blocked with 6 % milk for 1h 4 C with agitation. Blot was incubated in the primary antibody at a dilution of 1: 1 000 ON at 4 C with agitation. According to South et. al (2019).
RPS6A (40S ribosomal protein S6-1) is the major substrate of protein kinases in eukaryote ribosomes. Essential during gametogenesis.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Actinidia rufa, Ananas comosus, Beta vulgaris, Cajanus cajan, Capsicum chinense, Citrus clementina, Gossypium australe, Olea europaea subsp. europaea, Oryza sativa, Panicum miliaceum, Populus alba, Sesamum indicum, Senna tora, Solanum lycopersicum, Zea mays, Vigna unguiculataSpecies of your interest not listed? Contact us
RPS6A (40S ribosomal protein S6-1) is the major substrate of protein kinases in eukaryote ribosomes. Essential during gametogenesis.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Actinidia rufa, Ananas comosus, Beta vulgaris, Cajanus cajan, Capsicum chinense, Citrus clementina, Gossypium australe, Olea europaea subsp. europaea, Oryza sativa, Panicum miliaceum, Populus alba, Sesamum indicum, Senna tora, Solanum lycopersicum, Vigna unguiculataSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana RPS6A with phosphorylated Ser237, UniProt: O48549, TAIR: At4g31700
Curvature thylakoid 1B (CURT1B) belongs to a protein family, conserved in plants and cyanobaceria. There are four Arabidopsis thaliana CURT1 proteins: CURT1A,B,C and D. It is proposed that CURT1 proteins modify thylakoid architecture by inducing membrane curvature at grana margins.Alternative names: Photosystem I protein P, Thylakoid membrane phosphoprotein 14 kDa, PSAP
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Nicotiana tabacum, Zea mays Species of your interest not listed? Contact us
Curvature thylakoid 1D (CURT1D) belongs to a protein family, conserved in plants and cyanobaceria. There are four Arabidopsis thaliana CURT1 proteins: CURT1A,B,C and D. It is proposed that CURT1 proteins modify thylakoid architecture by inducing membrane curvature at grana margins.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Nicotiana tabacum, Zea maysSpecies of your interest not listed? Contact us
Curvature thylakoid 1C (CURT1C) belongs to a protein family, conserved in plants and cyanobaceria. There are four Arabidopsis thaliana CURT1 proteins: CURT1A,B,C and D. It is proposed that CURT1 proteins modify thylakoid architecture by inducing membrane curvature at grana margins.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Nicotiana tabacum, Zea maysSpecies of your interest not listed? Contact us
SCE1 (SUMO-conjugating enzyme SCE1) is a SUMO-conjugating enzyme which acts by accepting the SUMO proteins from the E1 SUMO-activating heterodimer SAE1/SAE2 and catalyzes its covalent attachment to other proteins with the E3 SUMO ligases SIZ1 and MMS21. Alternative names: Protein EMBRYO DEFECTIVE 1637, Protein hus5 homolog SUMO-conjugating enzyme 1, AtSCE1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Zea mays
Expected Species:
Cajanus cajan, Cicer arietinum , Corchorus capsularis, Gossypium hirsutum, Litchi chinensis, Medicago truncatula, Morus notabilis, Nelumbo nucifera, Nicotiana benthamiana, Nicotiana tabacum, Nicotiana sylvestris, Noccaea caerulescens, Phoenix dactylifera, Populus canadensis, Prunus yedoensis , Theobroma cacao, Triticum urartu , Zea mays, Zostera marina, Vigna radiataSpecies of your interest not listed? Contact us
Immunogen:
Full length, recombinant SCE1 of Arabidopsis thaliana, UniProt: Q42551-1, TAIR: At3g57870 overexpressed in E.coli
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Saracco et al. (2007). Genetic analysis of SUMOylation in Arabidopsis: conjugation of SUMO1 and SUMO2 to nuclear proteins is essential. Plant Physiol. 2007 Sep;145(1):119-34.
SAE1a (SUMO-activating enzyme subunit 1A) is the dimeric enzyme acts as an E1 ligase for SUMO1 and SUMO2. It mediates ATP-dependent activation of SUMO proteins and formation of a thioester with a conserved cysteine residue on SAE2. Functionally redundant with its paralog SAE1B. Alternative names: SUMO-activating enzyme subunit 1-1, Ubiquitin-like 1-activating enzyme E1A.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Zea mays
Expected Species:
Cajanus cajan, Cicer arietinum, Noccaea caerulescens, Parasponia andersonii, Trema orientale Species of your interest not listed? Contact us
Immunogen:
Recombinant, full length SAE1a of Arabidopsis thaliana, UniProt:Q8VY78-1, TAIR: At4g24940, overexpressed in E.coli
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Saracco et al. (2007). Genetic analysis of SUMOylation in Arabidopsis: conjugation of SUMO1 and SUMO2 to nuclear proteins is essential. Plant Physiol. 2007 Sep;145(1):119-34.
SUMO3 (Small ubiquitin-related modifier 3) is a small polypeptide that becomes covalently attached to various intracellular proteins leading to their post-translational modification.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
Full length SUMO3 of Arabidopsis thaliana, UniProt: Q9FLP5, TAIR: At5g55170
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Kurepa et al. (2003). The small ubiquitin-like modifier (SUMO) protein modification system in Arabidopsis. Accumulation of SUMO1 and -2 conjugates is increased by stress. J Biol Chem. 2003 Feb 28;278(9):6862-72.
NBR1 (Protein NBR1 homolog) is involved in selective autophagy process of damaged organelles, intracellular microbes, protein aggregates, cellular structures and specific soluble proteins. NBR1 mediates the process as an autophagic adapter. The protein has two UBA domains but only the C-terminal UBA domain bound ubiquitin.Alternative names: AtNBR1
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
ATG16 (Autophagy-related protein 16) may play a role in autophagy process.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
N-terminal part of of ATG16 of Arabidopsis thaliana UniProt: Q6NNP0, TAIR: At5g50230
ATG13a (Autophagy-related protein 13a) is involved in autophagy in a nutritional condition dependent manner. The ATG1-ATG13 protein kinase complex regulates downstream events required for autophagosome enclosure and/or vacuolar delivery. Alternative names: AtAPG13a.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Noccaea caerulescensSpecies of your interest not listed? Contact us
Immunogen:
Full length, recombinant ATG13a of Arabidopsis thaliana protein sequence UniProt: F4IXZ6, TAIR: At3g49590 with N-terminal HIS-tag.
Antibody may also recognise ATG13b; multiple bands observed due to phosphorylation
Application Details:
1 : 1000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
68,4 | 70-80 kDa
Not reactive in:
Oryza sativa
Selected references:
Suttangkakul et al. (2011). The ATG1/ATG13 protein kinase complex is both a regulator and a target of autophagic recycling in Arabidopsis. Plant Cell. 2011 Oct;23(10):3761-79. doi: 10.1105/tpc.111.090993.
ATG12b (Autophagy-related protein 12b) is an Ubiquitin-like protein involved in cytoplasm to vacuole transport (Cvt) and autophagy vesicles formation. Alternative names: Ubiquitin-like protein ATG12B, APG12-like protein b, AtAPG12b.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
Recombinant, full length ATG12b ofArabidopsis thaliana protein sequence UniProt: Q9LVK3-1, TAIR: At3g13970
This antibody may also recognise ATG12a; in wild-type, ATG12 is also conjugated to ATG5
Application Details:
1 : 3000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
10,4 | 12 and 50 kDa in wilde type plants and 12 kDa in some autophagy deficient mutants
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Chung et al. (2010). ATG8 lipidation and ATG8-mediated autophagy in Arabidopsis require ATG12 expressed from the differentially controlled ATG12A AND ATG12B loci. Plant J. 2010 May;62(3):483-93. doi: 10.1111/j.1365-313X.2010.04166.x.
ATG7 (Autophagy-related protein 7) is an E1-like activating enzyme involved in the 2 ubiquitin-like systems required for cytoplasm to vacuole transport (Cvt) and autophagy. Activates ATG12 for its conjugation with ATG5 and ATG8 for its conjugation with phosphatidylethanolamine. Acts in the senescence process, degradation of damaged peroxisomes and non-selective degradation of chlorophylls and photosynthetic proteins during stress-induced leaf yellowing.Alternative names: Ubiquitin-like modifier-activating enzyme atg7, ATG12-activating enzyme E1 atg7, AtAPG7, Protein PEROXISOME UNUSUAL POSITIONING 4.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica rapa, Capsella rubella , Citrus clementina, Noccaea caerulescens Species of your interest not listed? Contact us
Immunogen:
Recombinant ATG7 of Arabidopsis thaliana, UniProt: Q94CD5-1, TAIR: At5g45900, overexpressed in E.coli, collected in inclusion bodies, which were solubilized before immunization
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Doelling et al. (2002). The APG8/12-activating enzyme APG7 is required for proper nutrient recycling and senescence in Arabidopsis thaliana. J Biol Chem. 2002 Sep 6;277(36):33105-14.
Special application note:
Protein name was changed from APG7 to ATG7 after Doelling paper was published.
ATG5 (Autophagy protein 5) is a protein required for autophagy. Involved in a negative feedback loop that modulates NPR1-dependent salicylic acid (SA) signaling and limits senescence and immunity-related programmed cell death (PCD) in plants and a complete proteolysis of chloroplast stroma proteins in senescent leaves, in the degradation of damaged peroxisomes. Alternative names: Protein autophagy 5, AtAPG5.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Solanum lycopersicum, Solanum tuberosum
Immunogen:
Full length, recombinant ATG5 of Arabidopsis thaliana protein sequence UniProt: Q9FFI2-1, TAIR: At5g17290, overexpressed in E.coli
In wild-type plants almost all ATG5 is conjugated to ATG12.This item can be sold containing ProClin
Application Details:
1 : 3000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
38,5 | 50 kDa (in wilde type plants) and ca, 38 kDa in autophagy defective mutants
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Thompson et al. (2005). Autophagic nutrient recycling in Arabidopsis directed by the ATG8 and ATG12 conjugation pathways. Plant Physiol. 2005 Aug;138(4):2097-110.
ATG3 (Autophagy-related protein 3) is a E2 conjugating enzyme responsible for the E2-like covalent binding of phosphatidylethanolamine to the C-terminal Gly of ATG8. This step is required for the membrane association of ATG8. Alternative names: Autophagy-related E2-like conjugation enzyme ATG3, AtAPG3, Protein autophagy 3.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica campestris, Eutrema salsugineum, Helianthus annuus, Nicotiana tabacum, Noccaea caerulescens, Populus trichocarpa, Salvia splendens, Sisymbrium irio, Solanum tuberosum Species of your interest not listed? Contact us
Immunogen:
Full length recombinant ATG3 of Arabidopsis thaliana protein sequence UniProt: Q0WWQ1-1, TAIR: At5g61500, overexpressed in E.coli
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Phillips et al. (2008). The ATG12-conjugating enzyme ATG10 Is essential for autophagic vesicle formation in Arabidopsis thaliana. Genetics. 2008 Mar;178(3):1339-53. doi: 10.1534/genetics.107.086199.
ATG1a (Serine/threonine-protein kinase ATG1a) is a serine/threonine protein kinase involved in autophagy in a nutritional condition-dependent manner. The ATG1-ATG13 protein kinase complex regulates downstream events required for autophagosome enclosure and/or vacuolar delivery. Becomes a target of autophagy under nutrient starvation and connects autophagy to plant nutritional status. Alternative names: Autophagy-related protein 1a, AtAPG1a.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Noccaea caerulescensSpecies of your interest not listed? Contact us
Immunogen:
Full length, N-terminally HIS-tagged ATG1a of Arabidopsis thaliana protein sequence UniProt: Q94C95, TAIR: At3g61960, overexpressed in E.coli and injected as a gel piece
Antibody may also recognise ATG1b and ATG1c; does not recognise ATG1t, Suttangkakul et al. (2011).
Application Details:
1 : 1000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
69,6 | 70 kDa
Not reactive in:
Oryza sativa
Selected references:
Suttangkakul et al. (2011). The ATG1/ATG13 protein kinase complex is both a regulator and a target of autophagic recycling in Arabidopsis. Plant Cell. 2011 Oct;23(10):3761-79. doi: 10.1105/tpc.111.090993.
EIN3 (Ethylene insensitive 3) acts as a positive regulator in the ethylene response pathway and is required for ethylene responsiveness in adult plant tissues. Activated by phosphorylation by MPK3 and MPK6 (PubMed:18273012). Down-regulated by KIN10 that controls its protein stability under a phosphorylation-dependent manner. Alternative names: Protein ethylene insensitive 3.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Populus trichocarpa
Immunogen:
Recombinant EIN3 of Arabidopsis thaliana , UniProt: O24606, TAIR: At3g20770
Western blot condtions for anti-EIN3 antibodies are described in Smalle et al. 2002.Recommended membrane for blocking: nitrocellulose, blocking reagent: 10 % non-fat milk, antibody incubation buffer: PBS-T.
Application Details:
1 : 1000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
71,4 | 78 kDa
Not reactive in:
Medicago truncatula
Selected references:
Park et al. (2023) Ethylene-triggered subcellular trafficking of CTR1 enhances the response to ethylene gas. Nat Commun. 2023;14(1):365. Published 2023 Jan 23. doi:10.1038/s41467-023-35975-6Gagne et al. (2004). Arabidopsis EIN3-binding F-box 1 and 2 form ubiquitin-protein ligases that repress ethylene action and promote growth by directing EIN3 degradation. Proc Natl Acad Sci U S A. 2004 Apr 27;101(17):6803-8.
ABI5 (abscisic acid insensitive 5) is involved in ABA-regulated gene expression during seed development and subsequent vegetative stage and acts as the major mediator of ABA repression of growth. Binds to the embryo specification element and the ABA-responsive element (ABRE) of the Dc3 gene promoter and to the ABRE of the Em1 and Em6 genes promoters. Alternative names: ABI5, ABA INSENSITIVE 5, GIA1, GROWTH-INSENSITIVITY TO ABA 1, Dc3 promoter-binding factor 1, AtDPBF1, GROWTH-INSENSITIVITY TO ABA 1, bZIP transcription factor 39, AtbZIP39.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica oleracea Species of your interest not listed? Contact us
Immunogen:
Recombinant HIS-tagged, full length ABI5 in gel slice, of Arabidopsis thaliana UniProt: Q9SJN0-1, TAIR: At2g36270, overexpressed in E.coli
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Stone et al. (2006). KEEP ON GOING, a RING E3 ligase essential for Arabidopsis growth and development, is involved in abscisic acid signaling. Plant Cell. 2006 Dec;18(12):3415-28.
RAD23c (Ubiquitin receptor RAD23c) binds and presumably selects ubiquitin-conjugates for destruction. Prefers multiubiquitin chains rather than single ubiquitins, with a binding affinity for 'Lys-48'-linked ubiquitin chains. Acts as a ubiquitin receptor that associates with the 26S proteasomal docking subunit RPN10 for the indirect recognition of ubiquitinated substrates of ubiquitin/26S proteasome-mediated proteolysis (UPP). RAD23 proteins play an essential role in the cell cycle, morphology, and fertility of plants through their delivery of UPS (ubiquitin/26S proteasome system) substrates to the 26S proteasome.Alternative names: AtRAD23c, Putative DNA repair protein RAD23-3, RAD23-like protein 3, AtRAD23-3.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
Full length, His-tagged recombinant RAD23c of Arabidopsis thaliana protein sequence, UniProt:Q84L31-1, TAIR: At3g02540, overexpressed in E.coli
Antibodies recognize recombinant RAD23b and RAD23c proteins equally well but do not recognize DSK2a/b orDDI1 based on immunoblot analyses of corresponding mutants Farmer et al. (2010).
Application Details:
1 : 3000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
44,2 | ca, 61 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Farmer et al. (2010). The RAD23 family provides an essential connection between the 26S proteasome and ubiquitylated proteins in Arabidopsis. Plant Cell. 2010 Jan;22(1):124-42. doi: 10.1105/tpc.109.072660.
RAD23b (Rad23 UV excision repair protein family) belongs to radiation Sensitive23 (RAD23) family. Other isoforms are coded by: AT1G16190(RAD23A), AT1G79650(RAD23B), AT3G02540(RAD23C), AT5G38470(RAD23D). RAD23 proteins play an essential role in the cell cycle, morphology, and fertility of plants through their delivery of UPS (ubiquitin/26S proteasome system) substrates to the 26S proteasome. Alternative names: Rad23 UV excision repair protein family, RAD23B.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
Full length, HIS-tagged recombinant Rad23b of Arabidopsis thaliana protein sequence UniProt: F4IF85-1, TAIR: At1g79650, expressed in E.coli and purified under native conditions
This antibody is also recognizing other RAD23 isoforms
Application Details:
1 : 3000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
42,4 | 55 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Farmer et al. (2010). The RAD23 family provides an essential connection between the 26S proteasome and ubiquitylated proteins in Arabidopsis. Plant Cell. 2010 Jan;22(1):124-42. doi: 10.1105/tpc.109.072660.
PA200 (Proteasome activator PA200) is an associated component of the proteasome that specifically recognizes acetylated histones and promotes ATP- and ubiquitin-independent degradation of core histones during DNA damage response. It also recognizes and binds acetylated histones via its bromodomain-like (BRDL) region and activates the proteasome by opening the gated channel for substrate entry. Binds to the core proteasome via its C-terminus, which occupies the same binding sites as the proteasomal ATPases, opening the closed structure of the proteasome via an active gating mechanism. involved in DNA damage response: binds to acetylated histones and promotes degradation of histones. Protein levels increase upon exposure of seedlings to MG132, a specific, potent, reversible, and cell-permeable proteasome inhibitor. Alternative names: Proteasome activator subunit 4, Proteasome activating protein 200.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
PA200 antibodies were generated against a partial fragment encompassing residues 840 –1140 Arabidopsis thaliana protein sequence UniProt:F4JC97-1, TAIR: At3g13330
Recommended protein load is 20 g/well, primary antibody dilution: 1: 1000 ON/4 C and optimisation based on obtained result regarding signal/noise ratio,
Application Details:
1 : 500 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
202,9 | ca, 200 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Book et al. (2010). Affinity purification of the Arabidopsis 26 S proteasome reveals a diverse array of plant proteolytic complexes. J Biol Chem. 2010 Aug 13;285(33):25554-69. doi: 10.1074/jbc.M110.136622.
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
Recombinant, full length RPN12a of Arabidopsis thaliana protein sequence UniProt: Q9SGW3-1, TAIR: At1g64520, overexpressed in E.coli
Certain proportion of both wild-type transcript and protein is still produced in the rpn12a -1 mutant, see Figures 2B and 2C Smalle et al. (2002), PVDF membrane instead of nitrocellulose, and use the primary antibody at a 1:3000 dilution in 1% non-fat dry milk in PBS, performing just a 1 hour incubation at room temperature, so those adjustments to the protocol may also help reduce the background and increase signal intensity. Recommended Western blot conditions: protein load: 10-20 g/well, membrane: PVDF membrane, blocking with 10% nonfat milk 1h/RT, antibody incubation buffer: PBS-T. Primary antibody dilution: 1: 3000 in PBS with non-fat dry milk incubation RT/1h, optimisation based on obtained result regarding signal/noise ratio.
Application Details:
1 : 3000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
30,7 | 30 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Smalle et al. (2002). Cytokinin growth responses in Arabidopsis involve the 26S proteasome subunit RPN12. Plant Cell 14, 17-32.
RPN11 (26S proteasome regulatory subunit RPN11) is a metalloprotease component of the 26S proteasome that specifically cleaves 'Lys-63'-linked polyubiquitin chains. The 26S proteasome is involved in the ATP-dependent degradation of ubiquitinated proteins.Aleternative names: 26S proteasome non-ATPase regulatory subunit 14 homolog, AtRPN11.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Cucumis melo, Medicago truncatula, Noccaea caerulescens Species of your interest not listed? Contact us
Immunogen:
Recomebinant RPN11 of Arabidopsis thaliana, protein sequence UniProt: Q9LT08-1, TAIR: At5g23540, overexpressed in E.coli
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Yang et al. (2004). Purification of the Arabidopsis 26 S proteasome: biochemical and molecular analyses revealed the presence of multiple isoforms. J Biol Chem. 2004 Feb 20;279(8):6401-13.
RPN10 (26S proteasome regulatory subunit RPN10) is playing a role in maintaining the structural integrity of the 19S regulatory particle (RP), subcomplex of the 26S proteasome by the direct and indirect recognition of ubiquitinated substrates of ubiquitin/26S proteasome-mediated proteolysis (UPP). Binds and presumably selects ubiquitin-conjugates for destruction. Plays a role in the growth and development via the proteasome-dependent degradation of the ABA-signaling protein ABI5/DPBF1 and in the balancing cell expansion with cell proliferation rates during shoot development.Alternative names: 26S proteasome non-ATPase regulatory subunit 4 homolog, AtRPN10, 26S proteasome regulatory subunit S5A homolog, Multiubiquitin chain-binding protein 1, AtMCB1, MBP1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Gossypium hirsutum, Noccaea caerulescens, Theobroma cacao Species of your interest not listed? Contact us
Immunogen:
HIS-tagged RPN10 of Arabidopsis thaliana UniProt: P55034-1, TAIR: At4g38630 expressed in E. coli and purified by metal-chelate affinity chromatography
For western blot detection image, please check van Nocker et al. (1996).
Application Details:
1 : 3000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
40,7 | 40 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Huang et al (2021). Parasitic modulation of host development by ubiquitin-independent protein degradation. Cell. 2021 Sep 30;184(20):5201-5214.e12. doi: 10.1016/j.cell.2021.08.029. Epub 2021 Sep 17. PMID: 34536345; PMCID: PMC8525514.van Nocker et al. (1996). Arabidopsis MBP1 gene encodes a conserved ubiquitin recognition component of the 26S proteasome. Proc Natl Acad Sci U S A. 1996 Jan 23;93(2):856-60.
RPN5a | 26S proteasome regulatory subunit, putative (RPN5) is one of two isoforms for the 26S proteasome regulatory protein (RN) subunit RPN5. For many functions it acts redundantly with the paralogous gene RPN5b but also appears to exert independent effects.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Glycine soja, Gossypium arboreum, Juglans regia, Morus notabilis, Noccaea caerulescens, Theobroma cacao Species of your interest not listed? Contact us
Immunogen:
Recombinant RPN5a of Arabidopsis thaliana UniProt:F4KFD7-1, TAIR: At5g09900, overexpressed in E.coli, purified from a gel piece
This antibody is also recognizing RPN5b.Recommended protein load is 20 g/well, primary antibody dilution: 1: 1000 ON/4 C and optimisation based on obtained result regarding signal/noise ratio.
Application Details:
1 : 5000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
52,7 | 50 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Smalle et al. (2002). Cytokinin growth responses in Arabidopsis involve the 26S proteasome subunit RPN12. Plant Cell 14, 17-32.
RPN1a (26S proteasome regulatory subunit RPN1a) Acts as a regulatory subunit of the 26 proteasome which is involved in the ATP-dependent degradation of ubiquitinated proteins (By similarity). Required during embryogenesis and involved in innate immune response, proteasome-mediated ubiquitin-dependent protein catabolic process, protein catabolic process, regulation of cell cycle, regulation of protein catabolic process, response to salicylic acid, ubiquitin-dependent protein catabolic process. Alternative names: 26S proteasome non-ATPase regulatory subunit 2 homolog A, AtRPN1a, 26S proteasome regulatory subunit S2 homolog A.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Recombinant, full length Arabidopsis thaliana RPN1a protein sequence UniProt: Q9SIV2-1, TAIR: At2g20580 overexpressed in E.coli, purified from a gel piece
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Meng, Wang, Hao, et al. (2023) RNA-binding protein MAC5A interacts with the 26S proteasome to regulate DNA damage response in Arabidopsis. Plant Physiol. 2023;191(1):446-462. doi:10.1093/plphys/kiac510Yang et al. (2004). Purification of the Arabidopsis 26 S proteasome: biochemical and molecular analyses revealed the presence of multiple isoforms. J Biol Chem. 2004 Feb 20;279(8):6401-13.
RPT4a (26S proteasome AAA-ATPase subunit RPT4a) is involved in positive regulation of RNA polymerase II transcriptional preinitiation complex assembly, ubiquitin-dependent ERAD pathway, ubiquitin-dependent protein catabolic process. Alternative names: 26S proteasome subunit 10B homolog A, Regulatory particle triple-A ATPase subunit 4a, 26S proteasome regulatory subunit 10B homolog A.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Zea mays
Expected Species:
Actinidia chinensis, Artemisia annua, Capsicum chinense, Cicer arietinum, Helianthus annuus, Medicago truncatula, Nicotiana sylvestris, Noccaea tabacum, Solanum tuberosum, Trifolium pratense, Ricinus communis, Vigna radiata Species of your interest not listed? Contact us
Immunogen:
Full length recombinant RPT4a of Arabidopsis thaliana, UniProt: Q9SEI3-1, TAIR: At5g43010, overexpressed in E.coli
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Marshall et al. (2015). Autophagic Degradation of the 26S Proteasome Is Mediated by the Dual ATG8/Ubiquitin Receptor RPN10 in Arabidopsis. Mol Cell. 2015 Jun 18;58(6):1053-66. doi: 10.1016/j.molcel.2015.04.023.
RPT2a (Regulatory particle triple-A ATPase subunit 2a) is the 26S proteasome subunit. It is required for root meristem maintenance, and regulates gametogenesis. RPT2a is also shown to regulate gene silencing via DNA methylation. Alternative names: 26S proteasome regulatory subunit 4 homolog A Alternative name(s): 26S proteasome AAA-ATPase subunit, RPT2a 26S proteasome subunit 4 homolog A, Protein HALTED ROOT, 26S proteasome regulatory subunit 4 homolog A.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica napus, Cajanus cajan, Gossypium hirsutum, Mucuna pruriens, Noccaea caerulescens, Vigna radiata var. radiata Species of your interest not listed? Contact us
Immunogen:
Recombinant, full lenght RPT2a of Arabidopsis thaliana RPT2a protein sequence UniProt: Q9SZD4-1, TAIR: At4g29040 overexpressed in E.coli, purified from a gel piece
This antibody is also recognizing RPT2b protein. Recommended western blot conditions: SDS-PAGE, transfer to nitrocellulose, blocking 10% non-fat milk. Diluent for both primary and secondary antibodies PBS containing 0.2% Tween 20 and 1% BSA.For an image of western blot detection, refer to: Smalle et al. (2002).
Application Details:
1 : 3000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
49,4 | 50 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Meng, Wang, Hao, et al. (2023) RNA-binding protein MAC5A interacts with the 26S proteasome to regulate DNA damage response in Arabidopsis. Plant Physiol. 2023;191(1):446-462. doi:10.1093/plphys/kiac511Smalle et al. (2002). Cytokinin growth responses in Arabidopsis involve the 26S proteasome subunit RPN12. Plant Cell 14, 17-32.
PBF1 (20S proteasome beta subunit F-1) is a subunit of proteasome, multicatalytic proteinase complex which is characterized by its ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH. Alternative names: Proteasome subunit beta type-1, Proteasome component 5 Proteasome subunit beta type-6, TAS-F22/FAFP98, TAS-G39.20.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
PBA1 (20S proteasome beta subunit A1) is a subunit of proteasome, multicatalytic proteinase complex which is characterized by its ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH. Alternative name: Proteasome subunit beta.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Boussardon, Bag, Juvany, et al. (2022) The RPN12a proteasome subunit is essential for the multiple hormonal homeostasis controlling the progression of leaf senescence. Commun Biol. 2022;5(1):1043. Published 2022 Sep 30. doi:10.1038/s42003-022-03998-2Smalle et al. (2002). Cytokinin growth responses in Arabidopsis involve the 26S proteasome subunit RPN12. Plant Cell 14, 17-32.
PAG1 (20S Proteasome alpha subunit G1) is a component of the 20S core complex of the 26S proteasome. The 26S proteasome is composed of a core protease (CP), known as the 20S proteasome, capped at one or both ends by the 19S regulatory particle (RP/PA700). The 20S proteasome core is composed of 28 subunits that are arranged in four stacked rings, resulting in a barrel-shaped structure. The two end rings are each formed by seven alpha subunits, and the two central rings are each formed by seven beta subunits. Alternative name: 20S proteasome alpha subunit G-1, DiDi 17A-2a, Proteasome component 8, Proteasome subunit alpha type-7.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
Recombinant, full length PAG1 of Arabidopsis thaliana, UniProt: O23715-1, TAIR: At2g27020 overexpressed in E.coli, purified from a gel piece
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Book et al. (2010). Affinity purification of the Arabidopsis 26 S proteasome reveals a diverse array of plant proteolytic complexes. J Biol Chem. 2010 Aug 13;285(33):25554-69. doi: 10.1074/jbc.M110.136622.
PAC1 (20S Proteasome alpha subunit C1) is a component of proteasome complex which has ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH. The process is ATP-dependent. Alternative names: Proteasome subunit alpha type-4-A, 20S proteasome alpha subunit C-1, Proteasome 27 kDa subunit, Proteasome component 9, Proteasome subunit alpha type-3
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
Recombinant PAC1 of Arabidopsis thaliana, UniProt: O81148-1, TAIR: At3g22110 , overexpressed in E.coli, purified from a gel piece
Recommended western blot conditions: SDS-PAGE, transfer to nitrocellulose, blocking 10% non-fat milk. Diluent for both primary and secondary antibodies PBS containing 0.2% Tween 20 and 1% BSA.For an image of western blot detection, refer to: Smalle et al. (2002).
Application Details:
1 : 3000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
27,4 | 26 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Smalle et al. (2002). Cytokinin growth responses in Arabidopsis involve the 26S proteasome subunit RPN12. Plant Cell 14, 17-32.
TROL (thylakoid rhodanase-like protein) is an integral membrane component associated to the photosynthetic apparatus of higher plants. TROL is involved in the final step of photosynthetic electron transport by binding a key energy-conversion enzyme ferredoxin: NADP+ oxidoreductase (FNR). This interaction enables direct transfer of photosynthetic electrons from iron-sulphur protein ferredoxin at the stromal site of photosystem I to FNR, which then hands over electrons to NADP+. TROL is located in two distinct chloroplast compartments – in the inner envelope of chloroplasts, in its precursor form; and in the thylakoid membranes, where it is processed completely. Alternative names: Protein THYLAKOID RHODANESE-LIKE1, Sulfurtransferase 4, AtStr4
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
TROL protein can be used as a chloroplast dual-localization marker: for the thylakoids (the major portion of the protein) and the chloroplastic inner envelope. Since the envelopes make a very small portion of the total membranes, the envelope form of TROL is detectable only when isolated envelopes are applied. For AgriseraECLBright and Agrisera matching secondary antibodies goat anti-rabbit HRP conjugated, dilution 1: 25 000 1h/RT incubation (AS09 602), anti-TROL antibodies can be used in dilution of 1:3000.Recommendation: 2 g chlorophyll/well. With increased protein or chlorophyll load/well background bands may be detected. Check here.
Application Details:
1: 1000 - 1 : 3000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
55-60 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Vojta and Fulgosi (2019). Topology of TROL protein in thylakoid membranes of Arabidopsis thaliana. Physiologia Plantarum, Special Issue on: “Photosynthesis”. DOI: 10.1111/ppl.12927
His-Tag is a polyhistidine tag which consists of 6 histidine residues introduced on N- or C-terminus of the protein. The polyhistidine-tag can be used for recombinant protein detection using specific antibodies and it is not conjugated to any dye or enzyme.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
eIF1 (Eukaryotic initiation factor eIF1) is involved in protein biosynthesis.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
eIF5 (Eukaryotic initiation factor eIF5) is involved in protein biosynthesis.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
eIF4A (Eukaryotic initiation factor eIF4A) is involved in protein biosynthesis.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Li et al. (2021) Efficient and high-throughput pseudorecombinant-chimeric Cucumber mosaic virus-based VIGS in maize. Plant Physiol. 2021 Dec 4;187(4):2865-2876. doi: 10.1093/plphys/kiab443. PMID: 34606612; PMCID: PMC8644855.
The optimum working dilution should be established by titration before being used
Purity:
Purified by salt precipitation, followed by a ion-exchange chromatography with DEAE Sepharose, in PBS pH 7.2.
Reconstitution:
For reconstitution add 1 ml of sterile destilled water, Spin down to remove insoluble particles
Special application note:
Does not react with IgG, IgG/Fab fragments and IgM or any non-Ig protein in rat serum.It does not discriminate between serum IgA (monomeric and dimeric) and higher molecular forms such as secretory IgA.
The optimum working dilution should be established by titration before being used
Purity:
Purified by salt precipitation, followed by a ion-exchange chromatography with DEAE Sepharose, in PBS pH 7.2.
Reconstitution:
For reconstitution add 1 ml of sterile destilled water, Spin down to remove insoluble particles
Special application note:
Does not react with any non-Ig protein in rat serum.It does not discriminate between serum IgA (monomeric and dimeric) and higher molecular forms such as secretory IgA.
Has to be determined for each specific application
Purity:
Purified by salt precipitation, followed by a ion-exchange chromatography with DEAE Sepharose, in PBS pH 7.2.
Reconstitution:
For reconstitution add 1 ml of sterile destilled water, Spin down to remove insoluble particles
Special application note:
Does not react with IgG, IgG/Fab fragments and IgM or any non-Ig protein in rat serum.It does not discriminate between serum IgA (monomeric and dimeric) and higher molecular forms such as secretory IgA.
Antioxidant system works as a defense against oxidative stress. SOD (superoxide dismutase) catalyzes the dismutation of superoxide into oxygen and H202,. SODs are classified, according to their metal cofactor, as FeSOD, MnSOD, or Cu / ZnSOD. Chloroplasts generally contain Cu/ZnSOD and, in a number of plant species, FeSOD
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Olea europaea (pollen)
Expected Species:
Ananas ananas, Betula pendula, Camellia sinensis, Citrus sp., Codonis lanceolata, Cucurbita ficifolia, Gossypium sp., Helianthus sp., Hordeum vulgare, Lycopersicum esculentum, Plantago major, Populus trichocarpa, Solanum nigrum, Solanum tuberosum, Solidago sp., Vitis viniferaSpecies of your interest not listed? Contact us
Immunogen:
Full length, recombinant OeCSD1,1,B protein, accession no, EU250769,1
Note: Antibody recognizes two to three isoforms of Cu/Zn SOD in olive pollen depending on the olive cultivar
Application Details:
1 : 1500 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
15.3 | 16 kDa (Olea europaea L.)
Not reactive in:
Marchantia polymorpha
Selected references:
Zafra et al. (2018). Identification of novel superoxide dismutase isoenzymes in the olive (Olea europaea L.) pollen. BMC Plant Biol. 2018 Jun 8;18(1):114. doi: 10.1186/s12870-018-1328-z.
Special application note:
Reaction of the antibody to chloroplastic SOD isoform has not been determined yet
ACO4 (1-aminocyclopropane-1-carboxylate oxidase 4) is an enzyme involved in the ethylene biosynthesis. Alternative names: ACC oxidase,Ethylene-forming enzyme,EFE.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
TIM9 (Mitochondrial import inner membrane translocase subunit TIM9) is a chaperone that participates in the import and insertion of multi-pass transmembrane proteins into the mitochondrial inner membrane. Alternative name: Protein EMBRYO DEFECTIVE 2474
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to 3 years. Re-constituted antibody can be stored at 4°Cfor several days to weeks. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Brassica oleracea
Expected Species:
Arabidopsis thaliana, Cucumis melo, Gossypium hirsutum, Mesembryanthemum crystallinum, Noccaea caerulescens, Oryza sativa, Ostreococcus lucimarinus, Zea mays Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from known protein sequences of higher plant TIM9, including Arabidopsis thaliana UniProt: Q9XGX9, TAIR: At3g46560
TIM8 (Mitochondrial import inner membrane translocase subunit TIM8) is an intermembrane chaperone that participates in the import and insertion of some multi-pass transmembrane proteins into the mitochondrial inner membrane. The TIM8-TIM13 complex mediates the import of some proteins while the predominant TIM9-TIM10 70 kDa complex mediates the import of much more proteins.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to 3 years. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Brassica oleracea
Expected Species:
Arabidopsis thaliana, Brassica rapa, Capsicum baccatum, Cinnamomum micranthum f. kanehirae, Gossypium hirsutum, Handroanthus impetiginosus, Helianthus annuus, Jatropha curcas, Juglans regia, Morus notabilis, Nelumbo nucifera, Nicotiana tabacum, Prunus yedoensis, Theobroma cacao, Solanum chacoense, Vitis vinifera Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from known sequences of higher plant TIM8, including Arabidopsis thaliana UniProt: Q9XGY4, TAIR: At5g50810
AHB1 (Non-symbiotic hemoglobin 1) is involved in a cellular response to hypoxia and displays oxygen carrier activity. Alternative names: ARAth, GLB1, Hb1AHB1, ARATH GLB1, ATGLB1, CLASS I HEMOGLOBIN, GLB1, HB1, HEMOGLOBIN 1, NSHB1, PGB1, PHYTOGLOBIN 1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to 3 years. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Green fluorescent protein (Venus) from Aequorea victoria (Jellyfish), can be mutated to emit at different wavelengths such as blue for BFP (when Tyr-66 is replaced by His), cyan for CFP (when Tyr-66 is replaced by Trp), and yellow for YFP (when THR-203 is replaced by Tyr). It is an energy-transfer acceptor. Its role is to transduce the blue chemiluminescence of the protein aequorin into green fluorescent light by energy transfer.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
VENUS
Immunogen:
Full length, recombinat VENUS protein, expressed in E.coli, UniProt: P42212
Green fluorescent protein (Venus) from Aequorea victoria (Jellyfish), can be mutated to emit at different wavelengths such as blue for BFP (when Tyr-66 is replaced by His), cyan for CFP (when Tyr-66 is replaced by Trp), and yellow for YFP (when THR-203 is replaced by Tyr). It is an energy-transfer acceptor. Its role is to transduce the blue chemiluminescence of the protein aequorin into green fluorescent light by energy transfer.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
VENUS
Immunogen:
Full length, recombinat VENUS protein, expressed in E.coli, UniProt: P42212
Green fluorescent protein (Venus) from Aequorea victoria (Jellyfish), can be mutated to emit at different wavelengths such as blue for BFP (when Tyr-66 is replaced by His), cyan for CFP (when Tyr-66 is replaced by Trp), and yellow for YFP (when THR-203 is replaced by Tyr), It is an energy-transfer acceptor, Its role is to transduce the blue chemiluminescence of the protein aequorin into green fluorescent light by energy transfer.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
VENUS
Immunogen:
Full length, recombinant VENUS protein, expressed in E.coli, UniProt: P42212
Green fluorescent protein (Venus) from Aequorea victoria (Jellyfish), can be mutated to emit at different wavelengths such as blue for BFP (when Tyr-66 is replaced by His), cyan for CFP (when Tyr-66 is replaced by Trp), and yellow for YFP (when THR-203 is replaced by Tyr), It is an energy-transfer acceptor, Its role is to transduce the blue chemiluminescence of the protein aequorin into green fluorescent light by energy transfer.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
VENUS
Immunogen:
Full length, recombinat VENUS protein, expressed in E.coli, UniProt: P42212
Green fluorescent protein (Venus) from Aequorea victoria (Jellyfish), can be mutated to emit at different wavelengths such as blue for BFP (when Tyr-66 is replaced by His), cyan for CFP (when Tyr-66 is replaced by Trp), and yellow for YFP (when THR-203 is replaced by Tyr), It is an energy-transfer acceptor, Its role is to transduce the blue chemiluminescence of the protein aequorin into green fluorescent light by energy transfer.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
VENUS
Immunogen:
Full length, recombinat VENUS protein, expressed in E.coli, UniProt: P42212
Green fluorescent protein (Venus) from Aequorea victoria (Jellyfish), can be mutated to emit at different wavelengths such as blue for BFP (when Tyr-66 is replaced by His), cyan for CFP (when Tyr-66 is replaced by Trp), and yellow for YFP (when THR-203 is replaced by Tyr). It is an energy-transfer acceptor. Its role is to transduce the blue chemiluminescence of the protein aequorin into green fluorescent light by energy transfer.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
VENUS
Immunogen:
Full length, recombinat VENUS protein, expressed in E.coli, UniProt: P42212
Green fluorescent protein (Venus) from Aequorea victoria (Jellyfish), can be mutated to emit at different wavelengths such as blue for BFP (when Tyr-66 is replaced by His), cyan for CFP (when Tyr-66 is replaced by Trp), and yellow for YFP (when THR-203 is replaced by Tyr). It is an energy-transfer acceptor. Its role is to transduce the blue chemiluminescence of the protein aequorin into green fluorescent light by energy transfer.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to 3 years. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
cell lysate overexoressing Venus protein fusion
Immunogen:
Full length, recombinat VENUS protein, expressed in E.coli, UniProt: P42212
TRITC is a bright orange-fluorescent dye. The sensitivity of the TRITC hapten-anti-hapten system makes it a valuable alternative to the biotin-avidin system. This antibody is used to enhance the specific signal obtained with a monoclonal antibody or a polyclonal second antibody conjugated to TRITC.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube. Stort time storage at +4°C.
Host Animal:
Mouse
Species Reactivity:
Tetramethylrhodamine isothiocyanate isomer R
Immunogen:
Highly purified tetramethylrhodamine isothiocyanate isomer R
Applications:
ELISA (ELISA), Immunocytochemistry (ICC), Immunohistochemistry (IHC) paraffin, Dot blot (Dot), Western blot (WB)
TRITC is a bright orange-fluorescent dye. The sensitivity of the TRITC hapten-anti-hapten system makes it a valuable alternative to the biotin-avidin system. This antibody is used to enhance the specific signal obtained with a monoclonal antibody or a polyclonal second antibody conjugated to TRITC.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube. Stort time storage at +4°C.
SUN1,2 (nuclear envelope protein) is a member of the Sad1/UNC-84 (SUN)-domain proteins.SUN domain proteins are part of the cytoskeletal-nucleoskeletal bridging complexes. These proteins are localized to the nuclear envelope and are present as homomers and heteromers in vivo. Involved in maintaining the elongated nuclear shape of epidermal cells.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to 3 years. Re-constituted antibody can be stored at 4°Cfor several days to weeks. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Arabis nemor, Eutrema salsugineum, Microthlaspi erraticum, Noccaea caerulescens Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from N-terminus of SUN1 of Arabidopsis thaliana UniProt: Q9FF75 , TAIR: AT5G04990and SUN2, UniProt: Q9SG79, TAIR: AT3G10730
PHR1 (Phosphate starvation response 1) is nuclear localized and involved in transcription regulation.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to 3 years. Re-constituted antibody can be stored at 4°Cfor several days to weeks. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Hordeum vulgare (recombinant PHR1)
Expected Species:
Aegilops tauschii, Brachypodium distachyon, Dichanthelium oligosanthes, Panicum hallii Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Hordeum vulgare PHR1, UniProt: F4Y5E9
CRY2 (Cryptochrome 2) is a photoreceptor that mediates primarily blue light inhibition of hypocotyl elongation and photoperiodic control of floral initiation, and regulates other light responses: circadian rhythms, tropic growth, stomata opening, guard cell development, root development, bacterial and viral pathogen responses, abiotic stress responses, cell cycles, programmed cell death, apical dominance, fruit and ovule development, seed dormancy, and magnetoreception. (PubMed:21841916).Alternative protein names: Blue light photoreceptor1, Protein PHR homolog 11 AtPHH1, Protein SUPPRESSOR OF elf3 20
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Camelina sativa, Capsella rubellaSpecies of your interest not listed? Contact us
Immunogen:
Part of Arabidopsis thaliana CRY2 protein sequence, UniProt:Q96524, TAIR: At1g04400Antigen used to elicit CR2 antibodies is not conserved in CRY1 protein.
FITC is a fluorochrome dye that absorbs ultraviolet or blue light causing molecules to become excited and emit a visible yellow-green light. This emission ceases upon removal of the light causing the excitation. FITC antibody is used to enhance the specific signal from a monoclonal antibody or a secondary antibody conjugated to FITC. The sensitivity of the FITC hapten-anti-hapten system makes it a useful alternative to other systems.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube. Stort time storage at +4°C.
FITC is a fluorochrome dye that absorbs ultraviolet or blue light causing molecules to become excited and emit a visible yellow-green light. This emission ceases upon removal of the light causing the excitation. FITC antibody is used to enhance the specific signal from a monoclonal antibody or a secondary antibody conjugated to FITC. The sensitivity of the FITC hapten-anti-hapten system makes it a useful alternative to other systems.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube. Stort time storage at +4°C.
FITC is a fluorochrome dye that absorbs ultraviolet or blue light causing molecules to become excited and emit a visible yellow-green light. This emission ceases upon removal of the light causing the excitation. FITC antibody is used to enhance the specific signal from a monoclonal antibody or a secondary antibody conjugated to FITC. The sensitivity of the FITC hapten-anti-hapten system makes it a useful alternative to other systems.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube. Stort time storage at +4°C.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
Host Animal:
Rat
Species Reactivity:
Higher plants, ferns and mosses,Higher plants, ferns and mosses
Pedersen et a. (2012). Versatile high resolution oligosaccharide microarrays for plant glycobiology and cell wall research. J Biol Chem. 2012 Nov 6;287(47):39429-38.doi: 10.1074/jbc.M112.396598.
Special application note:
Contains 0.05% Sodium AzideReacts with grasses, sugar beet and spinach feruloyated polysaccharides. No cross-reactivity with non-feruloylated polymers outside these taxonomic groups
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
Host Animal:
Rat
Species Reactivity:
Higher plants, ferns and mosses
Immunogen:
Polysaccharide Arabinogalactan-protein (AGP) from Oryza sativa
Antibody is recognizing carbohydrate epitope containing Β-linked glucuronic acid.
Application Details:
1:10 (ELISA, IF)
Conjugation:
IgM
Isotype:
IgM
Purity:
Cell culture supernatant.
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Stacey et al. (1990). Patterns of expression of the JIM4 arabinogalactan-protein epitope in cell cultures and during somatic embryogenesis in Daucus carota L Planta. 1990 Jan;180(2):285-92.doi: 10.1007/BF00194009. Knox et al.(1991). Developmentally regulated epitopes of cell surface arabinogalactan proteins and their relation to root tissue pattern formation. Plant J. 1991 ov;1(3):317-326.doi: 10.1046/j.1365-313X.1991.t01-9-00999.x.
Special application note:
Contains 0.05% Sodium Azide.This antibody is made to rice arabinogalactan-proteins (AGPs) and it recognizes a carbohydrate epitope containing B-linked glucuronic acid. In competitive inhibition ELISAs antibody binding to gum arabic was inhibited (50%) by 70 mg/ml 1-O-methyl-B-D-GlcA. The binding of the antibody to AGPs can be fully inhibited by 10 mM 1-O-methyl-B-D-GlcA.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Extensins are a family of flexuous, rodlike, hydroxyproline-rich glycoproteins (HRGPs) of the plant cell wall.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Davies et al. (2010). Induction of extracellular matrix glycoproteins in Brassica petioles by wounding and in response to Xanthomonas campestris. Mol Plant Microbe Interact. 1997 Sep;10(7):812-20.doi: 10.1094/MPMI.1997.10.7.812. Smallwood et al. (1995). An epitope of rice threonine- and hydroxyproline-rich glycoprotein is common to cell wall and hydrophobic plasma-membrane. Planta. 995;196(3):510-22.doi: 10.1007/BF00203651. glycoproteins
Special application note:
Contains 0.05% Sodium Azide.Generated to rice extensin hydroxyproline-rich glycoproteins (HRGPs). The antibody recognises an epitope that is carried by a range of HRGPs of the extensin class.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Marcus et al. (2010). Restricted access of proteins to mannan polysaccharides in intact plant cell walls. Plant J. 2010 Oct;64(2):191-203.doi:0.1111/j.1365-313X.2010.04319.x.
Special application note:
Contains 0.05% Sodium Azide.No cross-reactivity with other polymersThis antibody recognises B-linked mannan polysaccharides of plant cell walls. LM21 binds effectively to B-(1-4)-manno-oligosaccharides from DP2 to DP5.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Glucuronoxylans are hemicellulosic plant cell wall polysaccharides which contains glucuronic acid and xylose.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Cornault et al. (2015). Monoclonal antibodies indicate low-abundance links between heteroxylan and other glycans of plant cell walls. Planta. 2015 ec;242(6):1321-34.doi: 10.1007/s00425-015-2375-4.
Special application note:
Contains 0.05% Sodium Azide.This antibody is made using a complex pectic immunogen. It can recognise glucuronosyl substituted xylans and MeGlcA is not required for recognition.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Xylan is a group of hemicelluloses in plant cells walls and can also be found in some algae.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Xylan is a group of hemicelluloses in plant cells walls and can also be found in some algae.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Xyloglucan is a hemiceullose or polysaccharide that can be found in the primary cell wall.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Pedersen et a. (2012). Versatile high resolution oligosaccharide microarrays for plant glycobiology and cell wall research. J Biol Chem. 2012 Nov 6;287(47):39429-38.doi: 10.1074/jbc.M112.396598.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Xyloglucan is a hemiceullose or polysaccharide that can be found in the primary cell wall.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Pedersen et a. (2012). Versatile high resolution oligosaccharide microarrays for plant glycobiology and cell wall research. J Biol Chem. 2012 Nov 6;287(47):39429-38.doi: 10.1074/jbc.M112.396598.
Special application note:
Contains 0.05% Sodium Azide.Reacts with galactosylated XLLG oligosaccharide motif of plants xyloglucan.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Xyloglucan is a hemiceullose or polysaccharide that can be found in the primary cell wall.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Ruprecht et al. (2017). A Synthetic Glycan Microarray Enables Epitope Mapping of Plant Cell Wall Glycan-Directed Antibodies. Plant Physiol. 2017 Nov;175(3):1094-1104. doi: 10.1104/pp.17.00737.
Special application note:
Contains 0.05% Sodium AzideReacts with the XXXG motif of land plants xyloglucan. This antibody is directed toward the nonreducing end, with the requirement for the second to last Glc to be substituted with an a-1,6-linked Xyl Ruprecht et al. (2017).
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Pectins are the major polysaccharides that build pectic matrix of plant primary cell walls.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
Willam et al. (2004). A xylogalacturonan epitope is specifically associated with plant cell detachment. Planta. 2004 Feb;218(4):673-81.doi: 0.1007/s00425-003-1147-8.
Special application note:
Contains 0.05% Sodium Azide.No known cross-reactivity with other polymers.Does not bind to all xylogalacturonans
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Pectins are the major polysaccharides that build pectic matrix of plant primary cell walls.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Verhertbruggen et al. (2009). Developmental complexity of arabinan polysaccharides and their processing in plant cell walls. Plant J. 2009 Aug;59(3):413-25.doi: 0.1111/j.1365-313X.2009.03876.x.
Special application note:
Contains 0.05% Sodium Azide.Reacts with polysaccharide, rhamnogalacturonan-I (RG-I) The binding could be sensitive to galactosidase action and the epitope could involve galactosyl residue(s) on the rhamnogalacturonan backbones.Recognizes a epitope associated with arabinans and can be generated by arabinofuranosidase action and the loss of arabinosyl residues.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Pectins are the major polysaccharides that build pectic matrix of plant primary cell walls.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term). Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tube.
Host Animal:
Rat
Species Reactivity:
Higher plants, ferns and mosses
Immunogen:
Pectic polysaccharide, alpha-1,5-arabinan, This antibody was isolated from a high throughput screen of many antibodies generated by immunization with a pectic fraction,
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Verhertbruggen et al. (2009). Developmental complexity of arabinan polysaccharides and their processing in plant cell walls. Plant J. 2009 Aug;59(3):413-25.doi: 0.1111/j.1365-313X.2009.03876.x. Moller et al. (2008). High-throughput screening of monoclonal antibodies against plant cell wall glycans by hierarchical clustering of their carbohydrate microarray. inding profiles Glycoconj J. 2008 Jan;25(1):37-48. doi: 10.1007/s10719-007-9059-7.
Special application note:
Contains 0.05% Sodium Azide.Antibody recognition of arabinans increases with arabinofuranosidase action. Binds to a specific subset of pectic arabinans, and to longer stretches of 1,5-linked arabinosyl residues that are likely to be more abundant in unbranched arabinans.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Pectins are the major polysaccharides that build pectic matrix of plant primary cell walls.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term). Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tube.
Host Animal:
Rat
Species Reactivity:
Higher plants, ferns and mosses
Immunogen:
Pectic polysaccharide (alpha-1,5-arabinan). This antibody was isolated from a high throughput screen of many antibodies generated by immunization with a pectic fraction.
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Contains 0.05% Sodium Azide.This antibody is recognizing a (1-5)-alpha-L-arabinan in a similar manner as an antibody to Pectic polysaccharide, alpha-1,5-arabinan (monoclonal, clone LM6). This antibody is an IgM isotype.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Pectins are the major polysaccharides that build pectic matrix of plant primary cell walls.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term). Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tube.
Verhertbruggen et al. (2009). Developmental complexity of arabinan polysaccharides and their processing in plant cell walls. Plant J. 2009 Aug;59(3):413-25.doi: 0.1111/j.1365-313X.2009.03876.x.
Special application note:
Contains 0.05% Sodium AzideNo cross-reactivity with gum arabic. The antibody recognises a linear pentasaccharide in (1-5)-α-L-arabinans. I many species it can also recognise pectic polysaccharides.In some species this antibody could recognize arabinogalactan-proteins (AGPs).In competitive inhibition ELISAs, antibody is binding to: (1-5)-α-L-arabinan was inhibited (50%) by 40 ng/ml (1-5)-α-L-arabinopentaose and 19 ng/ml (1-5)-α-L-arabinohexaose.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Homogalacturonan is a pectic polysaccharide of alpha-1,4 linked galacturonic acid residues. Pectin contains a complex set of polysaccharides that can be found in many primary cell walls.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term). Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Andersen et al. (2016). Characterization of the LM5 pectic galactan epitope with synthetic analogues of -1,4-d-galactotetraose. Carbohydr Res. 2016 Dec ;436:36-40.doi: 10.1016/j.carres.2016.10.012. Jones et al. (1997). Development and validation of an in vitro model system to study peripheral sensory neuron development and injury. Sci Rep. 2018 Oct 29;8(1):15961. doi: 10.1038/s41598-018-34280-3.
Special application note:
Contains 0.05% Sodium Azide.No cross-reactivity with (1-3)-beta-D-galactans or (1-6)-beta-D-galactans.It recognizes a linear tetrasaccharide in (1-4)-beta-D-galactans.In ELISA (competitive inhibition), antibody is binding to: (1-4)-beta-D-galactan was inhibited (50%) by 58 g/ml (1-4)-beta-D-galactotetraose and by 0.7 g/ml lupin (1-4)-beta-D-galactan.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Homogalacturonan is a pectic polysaccharide of alpha-1,4 linked galacturonic acid residues. Pectin contains a complex set of polysaccharides that can be found in many primary cell walls
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term). Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Zhang et al. (2022) Mutation of CESA1 phosphorylation site influences pectin synthesis and methylesterification with a role in seed development, Journal of Plant Physiology, 2022, 153631, ISSN 0176-1617, https://doi.org/10.1016/j.jplph.2022.153631.
Special application note:
Contains 0.05% Sodium AzideThe antibody recognizes a partially methyl-estrified epitope of HG which results from non-blockwise de-estrification processes. The antibody does not bind to un-estrified homogalacuronan.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Homogalacturonan is a pectic polysaccharide of alpha-1,4 linked galacturonic acid residues. Pectin contains a complex set of polysaccharides that can be found in many primary cell walls.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term). Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Clausen et al. (2003). Synthetic methyl hexagalacturonate hapten inhibitors of anti-homogalacturonan monoclonal antibodies LM7, JIM5 and JIM7. Carbohydr Res. 003 Aug 12;338(17):1797-800.doi: 10.1016/s0008-6215(03)00272-6. Knox et al. (1990). Pectin esterification is spatially regulated both within cell walls and between developing tissues of root apices. Planta. 1990 Jul;181(4):512-21.doi: 0.1007/BF00193004.
Special application note:
Contains 0.05% Sodium AzideHas no known cross-reactivity with other polymers.Binds to methyl esterified homogalacturonan.Does not bind to un-esterified homogalacturonan.This antibody is a good marker for pectic homogalacturonan.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Homogalacturonan is a pectic polysaccharide of alpha-1,4 linked galacturonic acid residues. Pectin contains a complex set of polysaccharides that can be found in many primary cell walls.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term). Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Yu et al. (2023) Reduction of pectin may decrease the embryogenicity of grapevine (Vitis vinifera) pro-embryonic masses after 10 years of in vitro culture, Scientia Horticulturae,Volume 309,2023,111690,ISSN 0304-4238,https://doi.org/10.1016/j.scienta.2022.111690.
Special application note:
Contains 0.05% Sodium AzideHas no known cross-reactivity with other polymers.Binds to paritally methyl esterified homogalacturonan and can also bind to un-esterified homogalacturonan.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Homogalacturonan is a pectic polysaccharide of alpha-1,4 linked galacturonic acid residues. Pectin contains a complex set of polysaccharides that can be found in many primary cell walls.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Cell Culture Supernatant
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term). Make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tubes.
No confirmed exceptions from predicted reactivity known at the moment.
Selected references:
Pan, Li, Liu, Qi et al. (2023) Multi-microscopy techniques combined with FT-IR spectroscopy reveals the histological and biochemical causes leading to fruit texture difference in oriental melon (Cucumis melo var. Makuwa Makino), Food Chemistry,Volume 402, 2023,134229, ISSN 0308-8146, https://doi.org/10.1016/j.foodchem.2022.134229.(https://www.sciencedirect.com/science/article/pii/S0308814622021914)Verhertbruggen et al. (2009). An extended set of monoclonal antibodies to pectic homogalacturonan. Carbohydr Res. 2009 Sep 28;344(14):1858-62.doi: 10.1016/j.carres.2008.11.010.
Special application note:
Contains 0.05% Sodium AzideHas no known cross-reactivity with other polymers.Binds to methyl esterified homogalacturonan.Does not bind to un-esterified homogalacturonanl.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Homogalacturonan is a pectic polysaccharide of alpha-1,4 linked galacturonic acid residues. Pectin contains a complex set of polysaccharides that can be found in many primary cell walls.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term). Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Verhertbruggen et al. (2009). An extended set of monoclonal antibodies to pectic homogalacturonan. Carbohydr Res. 2009 Sep 28;344(14):1858-62.doi: 10.1016/j.carres.2008.11.010.
Special application note:
Contains 0.05% Sodium Azide.No known cross-reactivity with other polymers.Binds to partially methyl esterified homogalacturonan but can also bind to un-esterified homogalacturonan
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Homogalacturonan is a pectic polysaccharide of alpha-1,4 linked galacturonic acid residues. Pectin contains a complex set of polysaccharides that can be found in many primary cell walls.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term). Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Pan, Li, Liu, Qi et al. (2023) Multi-microscopy techniques combined with FT-IR spectroscopy reveals the histological and biochemical causes leading to fruit texture difference in oriental melon (Cucumis melo var. Makuwa Makino), Food Chemistry,Volume 402, 2023,134229, ISSN 0308-8146, https://doi.org/10.1016/j.foodchem.2022.134229.(https://www.sciencedirect.com/science/article/pii/S0308814622021914)Marcus et al. (2010). Restricted access of proteins to mannan polysaccharides in intact plant cell walls. Plant J. 2010 Oct;64(2):191-203.doi: 0.1111/j.1365-313X.2010.04319.x.Verhertbruggen et al. (2009). An extended set of monoclonal antibodies to pectic homogalacturonan. Carbohydr Res. 2009 Sep 28;344(14):1858-62.doi: 10.1016/j.carres.2008.11.010.
Special application note:
Contains 0.05% Sodium Azide.Has no known cross-reactivity with other polymers.Binds to unesterified homogalacturonan.The antibody recognizes a range of homogalacturonan samples but binds strongly to un-esterified homogalacturonan.
GST-tag (glutathione S-transferase) is a tag added to a protein of interest as a fusion protein to unable purification and detection. The tag is 220 amino acid long, ca. 26 kDa which makes it quite large compare to Myc or FLAG tags.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Avoid repeated freeze-thaw cycles.
GST-tag (glutathione S-transferase) is a tag added to a protein of interest as a fusion protein to unable purification and detection. The tag is 220 amino acid long, ca. 26 kDa which makes it quite large compare to Myc or FLAG tags.
GST-tag (glutathione S-transferase) is a tag added to a protein of interest as a fusion protein to unable purification and detection. The tag is 220 amino acid long, ca. 26 kDa which makes it quite large compare to Myc or FLAG tags.
GST-tag (glutathione S-transferase) is a tag added to a protein of interest as a fusion protein to unable purification and detection. The tag is 220 amino acid long, ca. 26 kDa which makes it quite large compare to Myc or FLAG tags.
FLAG -tag is a tag that can be added to a protein sequence. It can be used for affinity chromatography, to separate recombinant protein from wt proteins. It can also be used to isolate protein complexes with multiple subunits.
FLAG -tag is a tag that can be added to a protein sequence. It can be used for affinity chromatography, to separate recombinant protein from wt proteins. It can also be used to isolate protein complexes with multiple subunits.
FLAG -tag is a tag that can be added to a protein sequence. It can be used for affinity chromatography, to separate recombinant protein from wt proteins. It can also be used to isolate protein complexes with multiple subunits.
FLAG is a tag that can be added to a protein sequence. It can be used for affinity chromatography, to separate recombinant protein from wt proteins. It can also be used to isolate protein complexes with multiple subunits.
mCherry is derived from DsRed, a red fluorescent protein from so-called disc corals of the genus Discosoma. DsRed is a 223 amino acid ~28kDa protein similar in size and properties to GFP, hoever it produces a red rather than a green fluorochrome. mCherry in its monomeric form is useful for applications such as F rster Resonance Energy Transfer (FRET, also known as Fluorescence Resonance Energy Transfer). The protein is an engineered derivative of one of a family of proteins originally isolated from Cnidarians (jelly fish, sea anemones and corals).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
mCherry
Expected Species:
mScarlett
Immunogen:
Recombinant full length mCherry expressed and purified from E. coli.
In western blot ~28 kDa band is detected corresponding to intact full-length mCherry on HEK293 cells transfected with mCherry vector.Sequence identity between mCherry and original GFP protein is 27%. Antibody does not cross with GFP or eGFP and likely not any of the relatives in western blot.
Application Details:
1 : 250-1 : 500 (ICC), 1 : 500-1 : 1000 (WB)
Purity:
Immunogen affinity purified in PBS pH 7.4, with 3% trehalose.
mCherry is derived from DsRed, a red fluorescent protein from so-called disc corals of the genus Discosoma. DsRed is a 223 amino acid ~28kDa protein similar in size and properties to GFP, however it produces a red rather than a green fluorochrome. mCherry in its monomeric form is useful for applications such as F rster Resonance Energy Transfer (FRET, also known as Fluorescence Resonance Energy Transfer). The protein is an engineered derivative of one of a family of proteins originally isolated from Cnidarians (jelly fish, sea anemones and corals).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
mCherry
Expected Species:
mScarlett
Immunogen:
Recombinant full length mCherry expressed and purified from E. coli.
Applications:
Immunocytochemistry (ICC), Immunofluorescence (IF), Western blot (WB)
YFP (Yellow Fluorescent Protein) is a genetic mutant of green fluorescent protein (GFP). YFP has an excitation peak at 514 nm and emission peak at 527 nm.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Store in small aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Native and denatured forms of GFP and Enhanced Green Fluorescent Protein (EGFP), Yellow Fluorescent Protein (YFP), Enhanced Yellow Fluorescent Protein (EYFP) and Cyan Fluorescent Protein (CFP)
Immunogen:
KLH-conjugated synthetic peptide derived from N-terminal of YFP protein from the jellyfish Aequorea victoria, UniProt:A0A059PIR9
Applications:
ELISA (ELISA), Dot Blot, Immunoprecipitation (IP), Immunolocalization (IL), Western Blot (WB)
HA-tag is derived from a human influenza hemagglutinin HA-molecule corresponding to amino acids 96-106 and is used as a general epitope tag in expression vectors.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Store in small aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
HA-tagged proteins in transfected mammalian cells or expressed under native promoter
Immunogen:
KLH-conjugated synthetic peptide: YPYDVPDYA
Applications:
Immunoprecipitation (IP), Immunolocalization (IL), Western Blot (WB)
Phosphothreonine is a phosphoamino acid and phosphorylated ester of threonine.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C for one year in storage buffer: PBS, 50 % glycerol and 0,01 % sodium azide, Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Antibody detects proteins phosphorylated on threonine residues. Does not cross-react with phosphotyrosine.5 % BSA is recommened to use for blocking as milk contains casein which is a phospho protein.
Immunogen:
KLH-conjugated phosphothreonine
Applications:
ELISA (ELISA), Immunoprecipitation (IP), Immunofluorescence (IF), Immunocytochemistry (ICC), Western blot (WB)
2 g/ml of this antibody is sufficient for detection of phosphorylation signal in western blot using mouse spleen extract treated with Vanadium.Use freshly extracted samples. Precipitate target protein to purify it and avoid cross-reactions.
Application Details:
ELISA (1:2000), ICC/IF (1:60), IP (1:100), WB (1:500)
Purity:
Immunogen affinity purified in PBS, 50% glycerol, 0.01% sodium azide.
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Affinity purified in PBS, pH 7.4 with 0.09 % sodium azide and 50 % glycerol at concentration 0.25 mg/ml. This antibody is recognizing proteins and peptides phosphorylated on threonine residues. There are no cross reactions with phosphotyrosine.
Multi-subunit complex of cytb6/f is a crucial component for the photosynthetic electron transport chain of higher plants, green algae and cyanobacteria. This complex is catalyzing oxidation of quinols and the reduction the reduction of plastocyanin. This reaction allows to establish the proton force required for the ATP synthesis. Four major subunits build the complex: the petA gene product corresponding to a c-type cytochrome (cytf), the petB gene product corresponding to a b-type/c?-type cytochrome with three haems (cyt b6), the petD gene product (subunit IV, or suIV), and the petC gene product, corresponding to the Rieske/Iron/sulfur protein.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to 3 years. Re-constituted antibody can be stored at 4°Cfor several days to weeks. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Acacia prainii, Angelphytum bahiense, Aristolochia promissa, Chlamydomonas reinhardii, Daucus glochidiatus, Dimerostemma brasilianum, Elaphandra paucipunctata, Fraxinus chiisanensis, Gossypium populifolium, Hydrangea heteromalla, Nicotiana sylvestris, Oryza sativa, Salix tetrasperma, Solanum lycopersicum, Thottea siliquosa, Triticum turgidum, Ulva flexuosa, Wedelia biflora, Vanilla aphyllaSpecies of your interest is not listed? Species of your interest not listed? Contact us. Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide chosen from Arabidopsis thaliana PetB protein sequence, UniProt: P56773, TAIR: ATCG00720
Urban, Rogowski & Romanowska (2022), Crucial role of the PTOX and CET pathways in optimizing ATP synthesis in mesophyll chloroplasts of C3 and C4 plants, Environmental and Experimental Botany, Volume 202, October 2022, 105024, https://doi.org/10.1016/j.envexpbot.2022.105027Wada et al. (2021) Identification of a Novel Mutation Exacerbated the PSI Photoinhibition in pgr5/pgrl1 Mutants; Caution for Overestimation of the Phenotypes in Arabidopsis pgr5-1 Mutant. Cells. 2021 Oct 26;10(11):2884. doi: 10.3390/cells10112884. PMID: 34831107; PMCID: PMC8616342.Chen et al. (2021)Degradation of the photosystem II core complex is independent of chlorophyll degradation mediated by Stay-Green Mg2+ dechelatase in Arabidopsis,Plant Science,Volume 307,2021,110902,ISSN 0168-9452,https://doi.org/10.1016/j.plantsci.2021.110902. Lu et al. (2021). Role of an ancient light-harvesting protein of PSI in light absorption and photoprotection. Nat Commun. 2021 Jan 29;12(1):679. doi: 10.1038/s41467-021-20967-1. PMID: 33514722; PMCID: PMC7846763.Wang et al. (2020). Post-translational coordination of chlorophyll biosynthesis and breakdown by BCMs maintains chlorophyll homeostasis during leaf development. Nat Commun. 2020; 11: 1254.
ELF3 (Early Flowering 3) is a transcription factor, which acts within a 'zeitnehmer' feedback loop and is involved in its own circadian regulation and is a part of a corepressor complex consisting of ELF4, ELF3, and LUX involved in the transcriptional regulation of APRR9. The activity of the protein may be decreased in long day conditions due to its interaction with phytochrome B (phyB). ELF3 is also involved in responses to nematode parasitism.Alternative names: Nematode-responsive protein
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles.Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
ELF3 protein is extremely sensitive to light therefore extraction has to be done in green light and protein analysis has to be done using fresh extracts only. Even short light exposure cause degradation of ELF3. Extracted protein cannot be frozen but analysed directly following extraction.Antibody is confirmed to work in ChIP for Oryza sativa Nippon bare.Antibody is recognizing all three isoforms in tomato: Solyc08g065870.4.1: Theoretical pI/Mw: 8.71 / 70659.09 DaSolyc11g070100.2.1: Theoretical pI/Mw: 8.94 / 66714.77 DaSolyc12g095900.2.1: Theoretical pI/Mw: 8.80 / 79108.57 Da
Application Details:
3 l of antibody (ChIP), 3 l of antibody used for coating 2x20 l Dynabeads A+G (IP), 1 : 1000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
77 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Seo et al. (2023) ZTL regulates thermomorphogenesis through TOC1 and PRR5 [published online ahead of print, 2023 Jan 19]. Plant Cell Environ. 2023;10.1111/pce.14542. doi:10.1111/pce.14542Andrade, Lu, Cordeiro, et al. (2022) The evening complex integrates photoperiod signals to control flowering in rice. Proc Natl Acad Sci U S A. 2022;119(26):e2122582119. doi:10.1073/pnas.2122582119Andrade et al. (2022) The evening complex integrates photoperiod signals to control flowering in rice. Proc Natl Acad Sci U S A. 2022 Jun 28;119(26):e2122582119. doi: 10.1073/pnas.2122582119. Epub 2022 Jun 21. PMID: 35733265; PMCID: PMC9245669.
ANN-1 | Annexin-1 displays peroxidase activity and may counteract oxidative stress. Alternative names: ANNAT1, ANX23-ATH, ATOXY5, OXY5, Annexin D1, AnnAt1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana Annexin-1, UniProt Q9SYT0, TAIR AT1G35720
CNX (calnexin homolog) is a calcium-binding protein involved in protein folding. It interacts with newly synthesized glycoproteins in the endoplasmic reticulum.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Li et al. (1998). The molecular chaperone calnexin associates with the vacuolar H(+)-ATPase from oat seedlings. Plant Cell. 1998 Jan;10(1):119-30.Li et al. (1998). The molecular chaperone calnexin associates with the vacuolar H(+)-ATPase from oat seedlings. Plant Cell. 1998 Jan;10(1):119-30.
V-ATPase subunit A is a catalytic subunit of V1 complex of vacuolar ATPase. This enzyme (EC=3.6.3.14) is involved in acidification process of various compartements of eucaryotic cell. This protein is coded by VHA-A gene. Alternative names: Vacuolar proton pump subunit alpha, vacuolar H(+)-ATPase subunit A, V-ATPase 69 kDa subunit
Product Type:
Antibody
Antibody Type:
Monoclonal, clone 7A3
Format:
Liquid
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Avena sativa
Expected Species:
Avena sativa
Immunogen:
V-ATPase complex from Avena sativa purified by gel filtration Ward and Sze 1992
Li and Sze (1999). A 100 kDa polypeptide associates with the V0 membrane sector but not with the active oat vacuolar H(+)-ATPase, suggesting a role in assembly. Plant J. 1999 Jan;17(1):19-30.Li and Sze (1999). A 100 kDa polypeptide associates with the V0 membrane sector but not with the active oat vacuolar H(+)-ATPase, suggesting a role in assembly. Plant J. 1999 Jan;17(1):19-30.
Plant vacuole V-ATPase is responsible for energization of transport of ions and metabolites, and acts as well 'house-keeping' and as a stress response enzyme. V-ATPase is a multi-subunit enzyme composed of a membrane sector and a cytosolic catalytic sector. It is related to the FoF1 ATP synthase. Alternative protein names: Vacuolar proton pump subunit E, Protein EMBRYO DEFECTIVE 2448ER-TYPE CA2+-ATPASE 1, ATECA1, ECA1, ER-TYPE CA2+-ATPASE 1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Avena sativa
Expected Species:
higher plants
Immunogen:
V-ATPase complex from Avena sativa purified by gel filtration Ward and Sze 1992
Calcium-transporting ATPase 1, endoplasmic reticulum-type is a magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol to the endoplasmic reticulum lumen. Also regulate manganese ion homeostasis by pumping it into endomembrane compartments. The enzyme can also transport zinc. Alternative names: ACA3, ARABIDOPSIS THALIANA ER-TYPE CA2+-ATPASE 1, ATECA1, ECA1, ER-TYPE CA2+-ATPASE 1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to 3 years. Re-constituted antibody can be stored at 4°Cfor several days to weeks. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana ECA1 sequence, cytosolic loop, between TM4 and TM5, UniProt:P92939, TAIR: At1g07810
The protein shows tissue specific expression, shown on a blot included in Wu et al. (2000). Lowest amounts of ECA1 are found in siliques.
Application Details:
1 : 10 000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
116,3 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Wu et al. (2000). An endoplasmic reticulum-bound Ca(2+)/Mn(2+) pump, ECA1, supports plant growth and confers tolerance to Mn(2+) stress. Plant Physiol. 2002 Sep;130(1):128-37.Liang et al. (1997). ECA1 complements yeast mutants defective in Ca2+ pumps and encodes an endoplasmic reticulum-type Ca2+-ATPase in Arabidopsis thaliana. Proc Natl Acad Sci U S A. 1997 Aug 5;94(16):8579-84.
ACA2 (Calcium-transporting ATPase 2) is a magnesium-dependent enzyme ((EC:3.6.3.8), which catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol into the endoplasmic reticulum. Alternative name: Ca(2+)-ATPase isoform 2
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
GST-fusion of ACA2 peptide, purified by SDS-PAGE of Arabidopsis thaliana ACA2 protein sequence, UniProt: O81108, TAIR: AT4G37640
ACA2 can be found in a good levels in: roots and flowers while the levels in leaves and siliques are very low. Harper et al. 1998.This antibody is recognizing both full length and trunctated forms.
Application Details:
1 : 10 000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
110 | 110 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Hwang et al. (2000). Calmodulin activation of an endoplasmic reticulum-located calcium pump involves an interaction with the N-terminal autoinhibitory domain.Plant Physiol. 2000 Jan;122(1):157-68.Hwang et al. (2000). Calmodulin activation of an endoplasmic reticulum-located calcium pump involves an interaction with the N-terminal autoinhibitory domain.Plant Physiol. 2000 Jan;122(1):157-68.Harper et al. (1998). A novel calmodulin-regulated Ca2+-ATPase (ACA2) from Arabidopsis with an N-terminal autoinhibitory domain. J Biol Chem. 1998 Jan 9;273(2):1099-106. (this paper contains a blot of tissue specific expression of ACA2).Harper et al. (1998). A novel calmodulin-regulated Ca2+-ATPase (ACA2) from Arabidopsis with an N-terminal autoinhibitory domain. J Biol Chem. 1998 Jan 9;273(2):1099-106. (this paper contains a blot of tissue specific expression of ACA2)
KAT1 (Potassium channel protein) triggered by ABA triggers in epidermal cells as well as guard cells. Upon removal of ABA, KAT1 is recycled back to the plasma membrane. KAT1 belongs to the Shaker family K+ channel.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
STO1 (Stomatin-like protein 1) involved in mitochondrial respiratory chain supercomplex assembly.Protein is expressed in: cotyledon, guard cell, hypocotyl, plant callus, pollen, rosette leaf, vascular leaf. Alternative names: ATSLP1, SLP1, SPFH/Band 7/PHB domain-containing membrane-associated protein family.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to 3 years. Re-constituted antibody can be stored at 4°Cfor several days to weeks. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Noccaea caerulescens Species of your interest not listed? Contact us
GST-tag (glutathione S-transferase) is a tag added to a protein of interest as a fusion protein to unable purification and detection. The tag is 220 amino acid long, ca. 26 kDa which makes it quite large compare to Myc or FLAG tags.This antibody is directly conjugated to Biotin.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Expected Species:
native and denatured forms of purified GST or GST fusion proteins
GST-tag (glutathione S-transferase) is a tag added to a protein of interest as a fusion protein to unable purification and detection. The tag is 220 amino acid long, ca. 26 kDa which makes it quite large compare to Myc or FLAG tags.This antibody is directly conjugated to HRP.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
Native and denatured forms of purified GST or GST fusion proteins
GST-tag (glutathione S-transferase) is a tag added to a protein of interest as a fusion protein to unable purification and detection, The tag is 220 amino acid long, ca, 26 kDa which makes it quite large compare to Myc or FLAG tags.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
Native and denatured forms of purified GST or GST fusion proteins
GST-tag (glutathione S-transferase) is a tag added to a protein of interest as a fusion protein to unable purification and detection, The tag is 220 amino acid long, ca, 26 kDa which makes it quite large compare to Myc or FLAG tags.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
Native and denatured forms of purified GST or GST fusion proteins
GST-tag (glutathione S-transferase) is a tag added to a protein of interest as a fusion protein to unable purification and detection, The tag is 220 amino acid long, ca, 26 kDa which makes it quite large compare to Myc or FLAG tags.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
Native and denatured forms of purified GST or GST fusion proteins
GST-tag (glutathione S-transferase) is a tag added to a protein of interest as a fusion protein to unable purification and detection. The tag is 220 amino acid long, ca. 26 kDa which makes it quite large compare to Myc or FLAG tags.This antibody is directly conjugated to ALP.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
Native and denatured forms of purified GST or GST fusion proteins
GST-tag (glutathione S-transferase) is a tag added to a protein of interest as a fusion protein to unable purification and detection. The tag is 220 amino acid long, ca. 26 kDa which makes it quite large compare to Myc or FLAG tags.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to 3 years. Re-constituted antibody can be stored at 4°Cfor several days to weeks. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Expected Species:
native and denatured forms of purified GST or GST fusion proteins
Overnight incubation of this antibody with dilution 1:5 000 with 0,5 g of GST-tagged protein produced strong background but works fine with samples of total Escherichia coli lysate if GST-tagged protein is expressed in low amounts.
Application Details:
1: 1: 1000 (ELISA), 1: 2000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
26 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Exact working dilution for each application needs to be determined experimentally
Ricin is a naturally occuring protein found in castor bean (Ricinus communis) acting as protein synthesis inhibitor. It is a toxin involved in plant defence. A chain of ricin can inactivate few thousands of ribosomes per minute. B chain facilitates the entry of A chain into the cell. Both protein chains, A and B must be present in order to produce an active toxin.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to 3 years. Re-constituted antibody can be stored at 4°Cfor several days to weeks. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Ricinus communis
Immunogen:
Ricin B chain isolated from Ricinus communis var. Impala, UniProt: P02879
Ricin is a naturally occuring protein found in castor bean (Ricinus communis) acting as protein synthesis inhibitor. It is a toxin involved in plant defence. A chain of ricin can inactivate few thousands of ribosomes per minute. B chain facilitates the entry of A chain into the cell. Both protein chains, A and B must be present in order to produce an active toxin. Ricin toxic A chain is an N-glycosylated heterodimer of approximately 60 to 65 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to 3 years. Re-constituted antibody can be stored at 4°Cfor several days to weeks. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Ricinus communis
Immunogen:
Ricin A chain isolated from Ricinus communis var. Impala
Cytokinins (CK) belong to a class of plant growth substances (plant hormones) which promote cell deivision by means of local and long distance signalling.Zeatin is an adenine-type cytokinin synthesised in stems, leaves and roots.
Product Type:
Antibody
Storage Temp:
Aliquote and store at -20 °C to avoid freezing and thawing cycles.
Psc is a polycomb group (PcG) protein. PcG proteins act by forming multiprotein complexes, which are required to maintain the transcriptionally repressive state of homeotic genes throughout development. PcG proteins are not required to initiate repression, but to maintain it during later stages of development. Alternative names: Protein posterior sex combs
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to 3 years. Re-constituted antibody can be stored at 4°Cfor several days to weeks. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Drosophila melanogaster
Immunogen:
GST-conjugated, full length Psc protein of Drosophila melanogaster, UniProt: P35820
Cas9 (CRISPR-associated endonuclease 9) is an RNA-guided DNA endonuclease associated with the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) type II adaptive immunity system. CRISPR clusters are transcribed and processed into CRISPR RNA (crRNA). Cas9 protein serves as a genome engineering tool to induce site-directed double strand breaks in DNA. Alternative name: Csn1.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. For long term storage -80°Cis recommended. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Cas9 from Streptococcus pyogenes
Immunogen:
Recombinant protein part from the N-terminus of Cas9 from Streptococcus pyogenes.
Applications:
Immunofluorescence (IF), Immunoprecipitation (IP), Western blot (WB)
m6A (N6-methyladenosine) is a modified base, abundant in mRNA in most eukaryotes and found in tRNA?s, rRNA?s, snRNA?s and in long non-coding RNA?s. Adenosine methylation is catalyzed by m6A methyltransferase, a large protein complex which has a preference for the consensus sequence GGACU.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store lyophilized/reconstituted at -20 °C; for long term storage -80°Cis recommened; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
ClpB2 | Chaperone protein ClpB2 unlike other ClpB proteins it is not induced by heat shock or other stresses but instead functions as essential, constitutive protein.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Synechococcus sp. strain PCC 7942
Expected Species:
Cyanobacteria Species of your interest not listed? Contact us
Immunogen:
C-terminal 165 amino acid sequence of the Synechococcus sp. strain PCC 7942 ClpB2 protein, fused to the MBP (maltose binding protein). UniProt: O34209
ClpB1 Chaperone protein ClpB1 is involved in acquired thermotolerance in cyanobacteria and belongs to molecular chaperones. Contributes to cold acclimation process in cyanobacteria.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Synechococcus sp. strain PCC 7942
Expected Species:
Cyanobacteria Species of your interest not listed? Contact us
Immunogen:
C-terminal 163 amino acid sequence of the Synechococcus sp. strain PCC 7942 ClpB1 protein, fused to the MBP (maltose binding protein). UniProt: P53533
For western blot detection image refer to the article below
Application Details:
1 : 1000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
79 | 93 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Porankiewicz and Clarke (1997). Induction of the heat shock protein ClpB affects cold acclimation in the cyanobacterium Synechococcus sp. strain PCC 7942. J Bacteriol. 1997 Aug;179(16):5111-7.
CERK1 (Chitin elicitor receptor kinase 1) is a Lysin motif (LysM) receptor kinase that functions as a cell surface receptor in chitin elicitor (chitooligosaccharides) signaling leading to innate immunity toward both biotic and abiotic stresses (e.g. tolerance to salinity, heavy-metal stresses, and Botrytis cinerea infection). Recognizes microbe-derived N-acetylglucosamine (NAG)-containing ligands. Involved in the resistance to pathogenic fungi.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Ngou et al. (2021) Mutual potentiation of plant immunity by cell-surface and intracellular receptors. Nature. 2021 Mar 10. doi: 10.1038/s41586-021-03315-7. Epub ahead of print. PMID: 33692545.Wang et al. (2021) Arabidopsis PUB2 and PUB4 connect signaling components of pattern-triggered immunity. New Phytol. 2021 Dec 17. doi: 10.1111/nph.17922. Epub ahead of print. PMID: 34918346
Special application note:
This product can be sold containing proclin if requested
Francisella tularensis is a pathogenic species of Gram-negative, aerobe, rod-shaped coccobacillus. It is the causative agent of tularemia, the pneumonic form of which is often lethal without treatment. It spreads easily by aerosol and has high virulence making this a Tier 1 Select Agent by the U.S. government. In nature this strain can survive for several weeks at low temperatures in animal carcasses, soil, and water.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to 3 years. Re-constituted antibody can be stored at 4°Cfor several days to weeks. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Francisella tularensis
Immunogen:
The 17 kDa major membrane protein of Francisella tularensis subsp. Holarctica (expressed in E. coli), which is abundant in most (all) strains of Francisella’s.
GDH2 (glutamate dehydrogenase 2) is a beta-subunit of the glutamate dehydrogenase, an enzyme found mainly in the mitochondria of stem and leaf companion cells.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to 3 years. Re-constituted antibody can be stored at 4°Cfor several days to weeks. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Lupinus luteus
Expected Species:
Hordeum vulgare, Zea mays Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from GDH2 from Lupinus luteus
BIK1 (Botrytis-induced kinase 1) belongs to the protein kinase superfamily. BIK1 is a crucial component of host response signaling required to activate the resistance responses to Botrytis and A. brassicicola infection.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Noccaea caerulescensSpecies of your interest not listed? Contact us
Ngou et al. (2021) Mutual potentiation of plant immunity by cell-surface and intracellular receptors. Nature. 2021 Mar 10. doi: 10.1038/s41586-021-03315-7. Epub ahead of print. PMID: 33692545.Wang et al. (2021) Arabidopsis PUB2 and PUB4 connect signaling components of pattern-triggered immunity. New Phytol. 2021 Dec 17. doi: 10.1111/nph.17922. Epub ahead of print. PMID: 34918346
Special application note:
This product can be sold containing ProClin if requested
Beta-Actin is a conserved protein involved in cell motility, structure and integrity, tissue development and the development of organism. Actin is expressed at high levels in almost all tissues and cell lines. This makes it ideal to use as a loading control in Western blot.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C.
Host Animal:
Rabbit
Species Reactivity:
Human
Immunogen:
Synthetic peptide derived from the N-terminal of the beta-actin UniProt: P60709
GAPDH is a protein that has both glyceraldehyde-3-phosphate dehydrogenase and nitrosylase functions, therefore it plays an important role in both glycolysis and nuclear functions.It is expressed at high levels in almost all tissues and cell lines making it ideal for use as a loading control marker in immunoblots.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C.
Host Animal:
Rabbit
Species Reactivity:
Human
Expected Species:
Xenopus laevis
Immunogen:
Allantoic fluid of 10 days old embryonated eggs inoculated with influenza A virus. UniProt: Human: P04406
RPS4 (Disease resistance protein RPS4) recognizes the AvrRps4 type III effector avirulence protein from P. syringae and confers specific resistance.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana (recombinant RPS4)
Expected Species:
Arabidopsis thaliana
Immunogen:
KLH-conjugated synthetic peptide derived from Arabidopsis thaliana RPS4 sequence, UniProt: Q9XGM3, TAIR: At5g45250. Chosen peptide is not found in RPS4B isoform.
PSY (Phytoene synthase) is a rate-limiting enzyme in the carotenoid biosynthetic pathway.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Cerda et al. (2020). Functional characterisation and in silico modelling of MdPSY2 variants and MdPSY5 phytoene synthases from Malus domestica. J Plant Physiol . 2020 Jun;249:153166.doi: 10.1016/j.jplph.2020.153166.
LFY (Leafy) transcriptional regulator that promotes the transition to flowering and is involved in floral meristem development.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Amelanchier aff. bartramiana KC-2017, Arabis alpina, Bauhinia ramosissima, Coccinia racemiflora, Crataegus viridis, Fragaria nubicola, Gaultheria procumbens, Kageneckia oblonga, Neillia incisa, Piliostigma reticulatum, Physocarpus capitatus, Vauquelinia californica Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from LFY sequence of Arabidopsis thaliana, UniProt: Q00958, TAIR: AT5G61850
ABI4 (Abscisic acid insensitive 4) is a transcription factor involved in the regulation of gene expression by stress factors. Confers sensitivity to abscisic acid (ABA) and regulates the ABA signaling pathway during seed germination upon nitrate-mediated lateral root inhibition, in hexokinase-dependent sugar responses (including feed-back regulation of photosynthesis and mobilization of storage lipid during germination), and in response to osmotic stress mediated by NaCl, KCl or mannitol. Plays a role in sucrose sensing or signaling, especially at low fluence far red light. ABI4 gene is expressed most abundantly in developing sliliques and to a lesser degree in seedlings. Alternative names: ABSCISIC ACID INSENSITIVE 4, ABI4, GLUCOSE INSENSITIVE 6, GIN6, IMPAIRED SUCROSE INDUCTION 3, ISI3, SALOBRENO 5,SAN5, SUCROSE UNCOUPLED 6, SUN6, SUGAR INSENSITIVE 5, SIS5, ERF ABI4, Ethylene-responsive transcription factor ABI4, ERF052, At2g40220, T7M7_16, T7M7.16.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles.Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana (recombinant ABI4)
Expected Species:
Arachis duranensis, Brassica oleracea, Camelia sativa, Carica papaya, Cicer arietinum, Cinnamomum micranthum f. kanehirae, Citrus clementina, Coffea arabica, Cucurbita maxima, Cucurbita pepo, Eutrema salsugineum, Fragaria vesca, Glycine soja, Lupinus angustifolius, Malus domestica, Medicago truncatula, Morus notabilis, Nicotiana attenuata, Nicotiana tabacum, Papaver somniferum, Pyrus x bretschneideri, Sesamum indicum, Tarenaya hassleriana, Theobroma cacao, Trifolium pratenseSpecies of your interest not listed? Contact us
CTR1 (Constitutive triple response 1) is acting as a negative regulator in the ethylene response pathway. Alternative names: Protein CONSTITUTIVE TRIPLE RESPONSE1, Serine/threonine-protein kinase CTR1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted, make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana CTR1 protein sequence, UniProt: Q05609, TAIR: At5g03730
PGR5 (Protn gradient regulation 5) is involved in the regulation of the cyclic electron flow (CEF) around Photosystem I and cellular response to light intensity and photoprotection. Essential for the reduction of PGRL1A by ferredoxin and for photoprotection.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
This product can be sold containing proclin if requested
Application Details:
1: 1000 - 1: 5000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
14,29 kDa
Not reactive in:
diatoms, Chlorella sp., cyanobacteria
Selected references:
Cao et al. (2022) Autophagic pathway contributes to low-nitrogen tolerance by optimizing nitrogen uptake and utilization in tomato. Hortic Res. 2022 Mar 23;9:uhac068. doi: 10.1093/hr/uhac068. PMID: 35669705; PMCID: PMC9164271.Ermakova et al. (2022) Enhanced abundance and activity of the chloroplast ATP synthase in rice through the overexpression of the AtpD subunit. J Exp Bot. 2022 Jul 29:erac320. doi: 10.1093/jxb/erac320. Epub ahead of print. PMID: 35904136.Urban, Rogowski & Romanowska (2022), Crucial role of the PTOX and CET pathways in optimizing ATP synthesis in mesophyll chloroplasts of C3 and C4 plants, Environmental and Experimental Botany, Volume 202, October 2022, 105024, https://doi.org/10.1016/j.envexpbot.2022.105026Yang et al. (2020). Two dominant boreal conifers use contrasting mechanisms to reactivate photosynthesis in the spring. Nat Commun. 2020 Jan 8;11(1):128. doi: 10.1038/s41467-019-13954-0.Rantala et al. (2020). PGR5 and NDH-1 systems do not function as protective electron acceptors but mitigate the consequences of PSI inhibition. Biochim Biophys Acta Bioenerg. 2020 Jan 11;1861(3):148154. doi: 10.1016/j.bbabio.2020.148154.
Protein pelota homolog is involved in the mechanism for releasing non-functional ribosomes and degrading damaged mRNA. This protein belongs to the eukaryotic release factor 1 (ERF1) family, and the Pelota subfamily.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
p15 [Peanut clump virus]
Immunogen:
Recombinant p15 [Peanut clump virus] Protein accession number: NP_620041.
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
2b protein [Tomato aspermy virus]
Immunogen:
Recombinant 2b protein [Tomato aspermy virus] Protein accession number: NP_620826.
2b protein [Cucumber mosaic virus] is one of the first identified suppressors that could inhibit post-transcriptional gene silencing (PTGS), but with little or no effect on miRNA functions. CMV 2b protein also interferes with miRNA pathways, eliciting developmental anomalies.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
2b protein [Cucumber mosaic virus]
Immunogen:
Recombinant 2b protein [Cucumber mosaic virus] Protein accession number: NP_619631.
GN (Gnom) activates the ARF proteins by exchanging bound GDP for free GTP and plays a role in vesicular protein sorting. Acts as the major regulator of endosomal vesicle trafficking but is also involved in the endocytosis process. GN is required for correct cell wall organization leading to normal cell adhesion during seedling development amd plays also an essential role in hydrotropism of seedling roots. Alternative names: Pattern formation protein EMB30, Protein EMBRYO DEFECTIVE 30, Protein MIZU-KUSSEI2, Protein VASCULAR NETWORK 7
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana GN protein sequence, UniProt: Q42510, TAIR: At1g13980
Nitrocellulose membrane with pore size 0.45 m is recommended as well as TBS-T as antibody incubation buffer. This antibody is also recognzing recombinant GN fused to GFP.
Application Details:
1 : 1000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
162 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
To be added when avaibale, antibody released in December 2020.
Peanut Ara h1 is a major peanut allergen. It shows significant homology with the vicilin seed storage protein found in most higher plants.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arachis hypogaea
Immunogen:
Recombinant peanut allergen Ara h1, UniProt: P43237, amino acid 26-216.
ATP synthase is the universal enzyme that synthesizes ATP from ADP and phosphate using the energy stored in a transmembrane ion gradient. This enzyme is localised in mitochondrial inner membrane.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Brassica oleracea var. botrytis cv. 'Diadom'
Expected Species:
Chlamydomonas reinhardtii, Nicotiana tabacum, Oryza sativa, Phaeodactylum tricornutum Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from available plant, algal mitochondrial sequences of beta subunits of F-type ATP synthases, including Arabidopsis thaliana ATP synthase subunit beta-1 UniProt:P83483, TAIR:AT5G08670ATP synthases subunit beta-2 UniProt:P83484, TAIR: AT5G08690, ATPase subunit beta-3, UniProt: Q9C5A9, TAIR:AT5G08680, which belong to mitochondrial respiratory chain complex I.
Wei et al. (2019). Arabidopsis mtHSC70-1 plays important roles in the establishment of COX-dependent respiration and redox homeostasis. J Exp Bot. 2019 Aug 6. pii: erz357. doi: 10.1093/jxb/erz357.
Special application note:
Lack of antibody reactivity was confirmed on chloroplast fraction.This product can be sold containing ProClin if requested.
PDF1 (Plant defensin 1) provides broad-spectrum resistance to pathogens and possesses antifungal activity. Alternative names: Anther-specific protein S18 homolog,Cysteine-rich antifungal protein 1, AFP1,Low-molecular-weight cysteine-rich protein 67, Protein LCR67.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Solanim lycopersicum
Expected Species:
Arabidopsis thaliana, Brassica rapa, Camelina sativa, Eutrema salsugineum, Capsella rubella, Sorghum sp.Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from Arabidopsis thaliana PDF1.1 UniProt: P30224-1, TAIR: At1g75830The peptide sequence, it is perfectly conserved in following Arabidopsis thaliana isoforms: PDF1.2c, PDF1.2b, PDF1.2A, PDF1.3. PDF2 isoform sequence did not come in the blast.
Nikoloudakis et al. (2020). Structural Diversity and Highly Specific Host-Pathogen Transcriptional Regulation of Defensin Genes Is Revealed in Tomato. Int J Mol Sci. 2020 Dec 9;21(24):9380. doi: 10.3390/ijms21249380. PMID: 33317090; PMCID: PMC7764197.
FAAH (Fatty acid amide hydrolase) is an enzyme, which degrades bioactive fatty acid amides to their corresponding acids, thereby serving to terminate the signaling functions of these molecules. Converts N-actylethanolamine (NAE) to ethanolamine. Might be involved in abscisic acid signaling and plant defense.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
ICE1 (Inducer of CBF expression 1) is a negative regulator in brassinosteroid signal transduction pathway important for plant growth. Phosphorylates and increases the degradation of BZR1 and BZR2/BES1 by the proteasome. Phosphorylates BHLH150, beet curly top virus C4 and tomato golden mosaic virus AC4 on threonine and serine residues. Upon brassinosteroid signaling, inhibits stomatal development by phosphorylating and inhibiting the MAPKK kinase YDA and the MAPK kinases MKK4 and MKK5.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica napus, Brassica rapa, Capsella bursa-pastoris, Capsella rubella, Eutrema salsugineum, Noccaea caerulescens Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from Arabidopsis thaliana ICE1 sequence, UniProt: Q9LSE2#Q9LSE2-2, TAIR: AT3G26744. The peptide is not conserved in protein coded by SCRM2 gene. UniProt: A0A1P8AMV9
HDT3 is probably mediating in the deacetylation of lysine residues on the N-terminal part of the core histones (H2A, H2B, H3 and H4). Histone deacetylation gives a tag for epigenetic repression and plays an important role in transcriptional regulation, cell cycle progression and developmental events. This protein is also involved in the modulation of abscisic acid and stress-responsive genes.Synonymes:HD-tuins protein 3, Histone deacetylase 2c
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Noccaea caerulescens Species of your interest not listed? Contact us
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Park et. al (2018). Epigenetic switch from repressive to permissive chromatin in response to cold stress. Proc Natl Acad Sci U S A. 2018 Jun 5;115(23):E5400-E5409. doi: 10.1073/pnas.1721241115.
mCherry is derived from DsRed, a red fluorescent protein from so-called disc corals of the genus Discosoma. DsRed is a 223 amino acid ~28kDa protein similar in size and properties to GFP, hoever it produces a red rather than a green fluorochrome. mCherry in its monomeric form is useful for applications such as F rster Resonance Energy Transfer (FRET, also known as Fluorescence Resonance Energy Transfer). The protein is an engineered derivative of one of a family of proteins originally isolated from Cnidarians (jelly fish, sea anemones and corals).
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
mCherry
Expected Species:
mScarlett
Immunogen:
Recombinant full length mCherry expressed and purified from E. coli.
FUM (Fumarase) Fumarate hydratase 1, mitochondrial (FUM1), Fumarate hydratase 2, cytosolic (FUM2) are enzymes which belong to a subpathway of tricarboxylic acid cycle, part of carbohydrate metabolism.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
The antibody may be stored at -20 °C for one year in its original formulation. Additionally, antibody may be stored at 2°Cto 8°Cfor up to 1 month without detectable loss of activity. Avoid repeated freeze-thaw cycles of the diluted antibody.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Ananas comosus, Capsicum chinense, Cynara cardunculus var. scolymus, Diplotaxis tenuifolia, Eruca versicaria, Genlisea aurea, Glycine soja, Gossypium hirsutum, Helianthus annuus, Hordeum vulgare, Nicotiana sylvestris, Nicotiana tabacum, Oryza sativa, Rhizophora mucronata, Ricinus communis, Solanum lycopersicum, Trifolium pratense, Zea mays, Vigna radiata, Quercus suberSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide chosen from Arabidopsis thaliana FUM protein sequence, mitochondrial (FUM1): P93033, TAIR: At2g47510, cytosolic (FUM2): UniProt Q9FI53, TAIR: At5g50950
TRF1 (Telomeric repeat-binding factor 1) is a component of telesome which is involved in the regulation of telomere lenght and protection of chromosomes. TRF1 binds double-stranded 5'-TTAGGG-3' repeat on telomers and negatively regulates the lenght of telomers.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
SOBIR1 is a kinase with dual specificity acting on both serine/threonine and tyrosine-containing substrates. It is involved in the activation of plant defense and cell death. It also regulates abscission.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles.Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Antibody is recognizing AtSOBIR1, SISOBIR1 and endogenous NbSOBIR1. In co-IP experiment one band of expeceted size is observed for NbSOBIR1 (72 kDa), AtSOBIR1-Myc(86 kDa) and SISOBIR1-Myc (84 kDa)
CO (CONSTANS) is a putative transcription factor which is involved in the long day flowering pathway and has been implied to control mediation between circadian clock and flowering. It regulates flowering time by interactions with SOC1 (suppressor of CO 1), TF1 (terminal flower 1), and FT (flowering locus T). Furthermore it is involved in proline and ethylene biosynthesis.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles.Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
To be added when available, antibody released in February 2021.
Special application note:
Recommended protocol for CO protein extraction Serrano-Bueno et al. 2020. Detection has to be done on a nuclear extract preparation in the evening on a Long Day that is the moment when CO protein is more stable.
AUX1 (Auxin transporter protein 1) is a carrier protein involved in proton-driven auxin influx. Synthesized in developing leaves and transpported to tips. Involved in lateral root formation, trichoblast polarization and root hair elongation. Required for gravitropism and thigmotropism, especially in roots, by modulating responses to auxin, ethylene and cytokinins. Needed for ammonium-mediated root-growth inhibition. Alternative names: AUX1, AUXIN RESISTANT 1, WAV5, WAVY ROOTS 5, PIR1, MAP1, MODIFIER OF ARF7/NPH4 PHENOTYPES 1, Auxin influx carrier protein 1, Polar auxin transport inhibitor-resistant protein 1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles.Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Goat
Species Reactivity:
Arabidopsis thaliana (recombinant AUX1)
Expected Species:
Arabidopsis thaliana
Immunogen:
KLH-conjugated peptide derived from protein sequence of Arabidopsis thaliana AUX1. UniProt: Q96247, TAIR: AT2G38120
PIF4 (PHYTOCHROME INTERACTING FACTOR 4) is a transcription factor involved in the phytochrome B signaling pathway. Interacts with APRR1/TOC1 and PIF3 and binds to EGL2 and RGA. Alternative names: AtPIF4, Basic helix-loop-helix protein 9, AtbHLH9, bHLH 9, SRL2, Short under red-light 2, EN102, Transcription factor EN 102, bHLH transcription factor bHLH009.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles,Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Goat
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica napus, Brassica rapa, Camelina sativa, Eutrema salsugineumSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana PIF4, UniProt:Q8W2F3, TAIR:AT2G43010
Material used need to be up to 8 days old as detection in older rosette leaf may fail
Application Details:
1 : 1000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
48,3 | 60 kDa
Not reactive in:
Solanum lycopersicum
Selected references:
Fang et al. (2022) TANDEM ZINC-FINGER/PLUS3 regulates phytochrome B abundance and signaling to fine-tune hypocotyl growth. Plant Cell. 2022;34(11):4213-4231. doi:10.1093/plcell/koac236Bajracharya, Xi, Grace, et al. (2022) PHYTOCHROME-INTERACTING FACTOR 4/HEMERA-mediated thermosensory growth requires the Mediator subunit MED14. Plant Physiol. 2022;190(4):2706-2721. doi:10.1093/plphys/kiac412Agrawal et al. (2022) MEDIATOR SUBUNIT17 integrates jasmonate and auxin signaling pathways to regulate thermomorphogenesis. Plant Physiol. 2022 Aug 1;189(4):2259-2280. doi: 10.1093/plphys/kiac220. PMID: 35567489.Lee at al. (2021) Spatial regulation of thermomorphogenesis by HY5 and PIF4 in Arabidopsis. Nat Commun. 2021 Jun 16;12(1):3656. doi: 10.1038/s41467-021-24018-7. PMID: 34135347; PMCID: PMC8209091.Lee, Paik & Huq. (2020). SPAs promote thermomorphogenesis by regulating the phyB-PIF4 module in Arabidopsis. Development. 2020 Oct 8;147(19):dev189233. doi: 10.1242/dev.189233. PMID: 32994167; PMCID: PMC7561471.
Special application note:
PIF proteins are not that stable, therefore special precautions should be taken during extraction and whole procedure should be performed in as little light as possible (light green light). Extraction of PIF proteins is described in Shen et al. (2007).
PIF3 (Phytochrome interacting factor 3) is a transcription factor which acts positively in the phytochrome signaling pathway. It activates transcription by binding to the G box. Subcellular localization is nucleus. Alternative names:Basic helix-loop-helix protein 8, AtbHLH8, bHLH8, Phytochrome-associated protein 3, Phytochrome-interacting factor 3, Transcription factor EN 100, EN100, bHLH transcription factor bHLH008, PAP3, PHYTOCHROME-ASSOCIATED PROTEIN 3, POC1, PHOTOCURRENT 1,ABI1, ABA INSENSITIVE 1, AtABI1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles,Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Goat
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Cardamine hirsuta Species of your interest not listed? Contact us
PIF3 protein runs at higher MW than expected, as observed previously (Al-Sady et al. 2006). PIF proteins are not that stable, therefore special precautions should be taken during extraction and whole procedure should be performed in as little light as possible (light green light).
Application Details:
1 : 1000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
57 | ca, 65 kDa
Not reactive in:
Nicotiana attenuata
Selected references:
Sinclair et al. (2017) Etiolated Seedling Development Requires Repression of Photomorphogenesis by a Small Cell-Wall-Derived Dark Signal. Curr Biol. 2017 Nov 20;27(22):3403-3418.e7. doi: 10.1016/j.cub.2017.09.063.
Special application note:
Please, do not re-use PIF3 antibody solution after first incubation with your membrane as most of antibody will bind in this step and next result will not be reproducable
WHIRLY proteins are multifunctional DNA/RNA-binding proteins (Prikryl et al. 2008, NAR 36: 5152-5165). WHIRLY1 was shown to be located both in chloroplasts and nucleus (Grabowski et al. 2008, Plant Physiology 147:1800-1804). In chloroplasts it is part of nucleoids (Pfalz et al. 2006, Plant Cell 18:176-197; Melonek et al. 2010, Planta 232:471-481). In the nucleus, WHIRLY1 is an acitivator of pathogen response genes (Desveaux et al. 2000, Plant Cell 12:1477-1489). WHIRLY2 is a mitochondrial protein and affects DNA copy number (Cai et al. 2015, Plant Physiology 169:660-673).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to 3 years. Re-constituted antibody can be stored at 4°Cfor several days to weeks. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Goat
Species Reactivity:
Hordeum vulgare
Expected Species:
Brachypodium sylvaticum, Oryza sativa, Panicum miliaceum, Setaria italica, Triticum urartu Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from HvWHIRLY1 protein sequence, NCBI
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Karpinska et al. (2022). WHIRLY1 functions in the nucleus to regulate barley leaf development and associated metabolite profiles. Biochem J. 2022 Mar 18;479(5):641-659. doi: 10.1042/BCJ20210810. PMID: 35212355; PMCID: PMC9022988.
WHIRLY proteins are multifunctional DNA/RNA-binding proteins (Prikryl et al. 2008, NAR 36: 5152-5165). WHIRLY1 was shown to be located both in chloroplasts and nucleus (Grabowski et al. 2008, Plant Physiology 147:1800-1804). In chloroplasts it is part of nucleoids (Pfalz et al. 2006, Plant Cell 18:176-197; Melonek et al. 2010, Planta 232:471-481). In the nucleus, WHIRLY1 is an acitivator of pathogen response genes (Desveaux et al. 2000, Plant Cell 12:1477-1489). WHIRLY2 is a mitochondrial protein and affects DNA copy number (Cai et al. 2015, Plant Physiology 169:660-673).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4 C; make aliquots to avoid working with a stock. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
Hordeum vulgare
Expected Species:
Brachypodium distachyon, Triticum urartuSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from HvWHIRLY2 protein sequence, NCBI
Horseradish peroxidase (HRP) is a secretory plant peroxidase that catalyzes the oxidation of small aromatic substrates, such as plant hormone and lignin precursors by hydrogen peroxide, acts in oxidation of toxic reductants, biosynthesis and degradation of lignin, response to environmental stresses such as wounding, pathogen attack and oxidative stress.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
ABP1 is an auxin receptor which regulates polar auxin transport. It is involved in the shade avoidance responsse, controls cell division and elongation, controls the size of a root meristem and madiates auxin responsivness. ABP1 promotes endocytosis via clathrin recruitment and restricts PIN internalization upon auxin binding via inhibition of clathrin-mediated endocytosis.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles.Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Brown & Jones (1994). Mapping the auxin-binding site of Auxin-binding protein. 1 J Biol Chem 269: 21138-21140, Jones & Herman (1993). KDEL-Containing Auxin-Binding Protein 1 is Secreted to the Plasma Membrane and Cell Wall. Plant Physiol. 101: 595-606, Jones et al. (1991) Red light-regulated growth. I. Changes in the abundance of indoleacetic acid and a 22-kilodalton auxin-binding protein in maize mesocotyl. Plant Physiol 97: 352-358
ABP1 is an auxin receptor which regulates polar auxin transport. It is involved in the shade avoidance responsse, controls cell division and elongation, controls the size of a root meristem and madiates auxin responsivness. ABP1 promotes endocytosis via clathrin recruitment and restricts PIN internalization upon auxin binding via inhibition of clathrin-mediated endocytosis.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles.Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
ABP4 is an auxin receptor which regulates polar auxin transport.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles,Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Zea mays
Expected Species:
Setaria italica, Sorghum bicolor, Zea mays Species of your interest not listed? Contact us
Immunogen:
BSA-conjugated peptide derived from Zea mays ABP4 sequence, UniProt: P33488
ABP1 is an auxin receptor which regulates polar auxin transport. It is involved in the shade avoidance responsse, controls cell division and elongation, controls the size of a root meristem and madiates auxin responsivness. ABP1 promotes endocytosis via clathrin recruitment and restricts PIN internalization upon auxin binding via inhibition of clathrin-mediated endocytosis.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles.Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Cytosolic Sulfotransferase 12 is involved in long distance signaling in plant systemic aquired resistance (SAR), hence enhances plant response to pathogen infection. This sulfotransferase catalyzes the sulfate conjugation of 24-epibrassinosteroids.Alternative names: Sulfotransferase 1, Sulfotransferase 12, SOT12
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to 3 years. Re-constituted antibody can be stored at 4°Cfor several days to weeks. Once reconstituted, make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Arabidopsis lyrata subsp. lyrata, Arabis alpina, Brassica napus, Brassica oleracea var. oleracea, Brassica rapa subsp. pekinensis, Capsella rubella, Eutrema salsugineum, Noccaea caerulescensSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from A. thaliana SOT12 protein sequence UniProt: P52839, TAIR: At2g03760
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Pascual et al (2021). ACONITASE 3 is part of the ANAC017 transcription factor-dependent mitochondrial dysfunction response, Plant Physiology, 2021;, kiab225, https://doi.org/10.1093/plphys/kiab225Shapiguzov et al. (2019). Arabidopsis RCD1 coordinates chloroplast and mitochondrial functions through interaction with ANAC transcription factors. Elife. 2019 Feb 15;8. pii: e43284. doi: 10.7554/eLife.43284
RACK1A is a major component of RACK1 regulatory proteins playing a major role in multiple signal transduction pathways. Synonymes: Receptor for activated C kinase 1A, WD-40 repeat auxin-dependent protein ARCA.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Arabis alpina, Brasica sp., Camelina sativa, Capsella rubella, Eutrema salsugineum, Ricinus communis, Tarenaya hassleriana Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from Arabidopsis thaliana RACK1A protein sequence O24456, At1g18080. The peptide is also conserved in isofrom RACK1B and RACK1C of Arabidopsis thaliana.
GPA1 (G PROTEIN ALPHA-1) is involved as a modulator or transducer in various transmembrane signaling systems. Together with GCR1, may regulate the cell cycle via a signaling cascade Promotes abscisic acid (ABA) responses in guard cells. But, together with GCR1 and GB1, acts as a negative regulator of ABA during seed germination and early seedling development. Involved in the blue light (BL) signaling. Alternative name: GP-alpha-1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
AGB1 belongs to a family of proteins involved in signal transduction. They are acting like molecular switches when transmitting signals from the outside to the inside of cells.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brasica sp., Cajanus cajan, Camelina sativa, Capsella rubella, Eutrema sp., Cicer arietinum, Gossypium sp., Medicago truncatula, Morus sp., Cajanus cajan, Pisum sativum, Sesamum indicum, Solanum sp., Tarenaya hassleriana, Theobroma cacao, Trifolium subterraneum Species of your interest not listed? Contact us
Histone-lysine N-methyltransferase (Ez) is a Polycomb group (PcG) protein, and a catalytic subunit of the Esc/E(z) complex. By methylating Lys-9 and Lys-27 of histone H3, this complex is involved in transcriptional repression of target genes. E(z) is important for the repression during the first six hours of embryogenesis. The Esc/E(z) complex, together with the recruitment of the PRC1 complex, is necessary for the repression of homeotic target genes. Alternative names: Lysine N-methyltransferase 6, Protein enhancer of zeste
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to 3 years. Re-constituted antibody can be stored at 4°Cfor several days to weeks. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
CRY1 (Cryptochrome 1) is a flavin-type blue-light photoreceptor with ATP binding and autophosphorylation activity and functions in perception of blue / green ratio of light. It regulates other light responses, including circadian rhythms, tropic growth, stomata opening, guard cell development, root development, bacterial and viral pathogen responses, abiotic stress responses, cell cycles, programmed cell death, apical dominance, fruit and ovule development, seed dormancy, and magnetoreception. Alternative names: Blue light photoreceptor1, Protein BLUE LIGHT UNINHIBITED 1, Protein ELONGATED HYPOCOTYL 4, Protein OUT OF PHASE 2, OOP2.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Nicotiana tabacum
Expected Species:
Cajanus cajan, Capsella orientalis, Corchorus capsularis, Fragaria ananassa, Fragaria vesca, Gossypium hirsutum, Medicago truncatula, Nelumbo nucifera, Populus tremula, Zostera marina Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from protein sequence of Arabidopsis thaliana CRY1, UniProt:Q43125, TAIR:AT4G08920
NAD-ME (Mitochondrial NAD-dependent malic enzyme) is an enzyme which in some C4 plants catalyzes the decarboxylation of 4 carbon malate in the bundle sheath cells, releasing carbon dioxide. This enzyme plays a key role in photosynthetic carbon fixation.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Long et al. (1994). Cloning and analysis of the C4 photosynthetic NAD-dependent malic enzyme of amaranth mitochondria. J Biol Chem. 1994 Jan 28;269(4):2827-33.
Special application note:
Antibody can be used in immunolocalization using immunogold TEM.This antibody recognizes the large subunit (MEL) of the NAD-ME.Immunolocalization method is described in Long et al. (1994).
FtsH belong to a family of ATP dependent peptidases. Localized in a chloroplast are following isoforms: FTSH1 (synonymes AAA, FTSH, FTSH Protease 1), Ftsh2 (VAR2, VARIEGATED 2), FtsH5 (VAR1, VARIEGATED 1), FtsH6 (FTSH PROTEASE 6), FtsH7, FtsH8. FtsH9. Localized in mitochondria are following isoforms: FtsH3, FtsH4, FtsH10, FtsH11.FtsH5 (VAR1) is a component of the ATP-dependent zinc metallopeptidase. It is involved in the thylakoids biogenesis and in the repair of damaged D1 subunit of photosystem II, a process that protects against cell death under high light conditions. It forms a complex with VAR1. FtsH5 (VAR1) and FtsH1 are interchangeable in thylakoid membranes.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
FtsH belong to a family of ATP dependent peptidases. Localized in a chloroplast are following isoforms: FTSH1 (synonymes AAA, FTSH, FTSH Protease 1), Ftsh2 (VAR2, VARIEGATED 2), FtsH5 (VAR1, VARIEGATED 1), FtsH6 (FTSH PROTEASE 6), FtsH7, FtsH8. FtsH9. Localized in mitochondria are following isoforms: FtsH3, FtsH4, FtsH10, FtsH11.FtsH2 (VAR2) is a component of the ATP-dependent zinc metallopeptidase. It is involved in the thylakoids biogenesis and in the repair of damaged D1 subunit of photosystem II, a process that protects against cell death under high light conditions. VAR1 transcript and protein levels increase with light intensity and it forms a complex with VAR1. Mutants show a variegated phenotype, which decreases during development.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
IFR (isoflavone reductase) is an enzyme involved in isoflavonoid biosynthesis in plants.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
The antibody may be stored at -20 °C for one year in its original formulation. Additionally, antibody may be stored at 2°Cto 8°Cfor up to 1 month without detectable loss of activity. Avoid repeated freeze-thaw cycles of the diluted antibody.
Host Animal:
Rabbit
Species Reactivity:
Oryza sativa
Expected Species:
Oryza sativa
Immunogen:
KLH-conjugated peptide derived from Oryza sativa UniProt: Q9FTN5, LOC_Os01g01660.1
PARP (EC=2.4.2.30) is a protein involved in the base excision repair pathway (BER) and is catalyzing the poly(ADP-ribosyl)ation of a limited number of acceptor proteins involved in chromatin architecture and in DNA metabolism. PARP is a marker of a single-strand breaks (SSBs), Rybaczek and Kowalewicz-Kulbat (2013).Alternative names: ADPRT 2, NAD(+) ADP-ribosyltransferase 2, Poly[ADP-ribose] synthetase 2.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
RING1 involved in protein ubiquitination. Alternative names: RING-type E3 ubiquitin transferase RING1Curated, Sex comb extra protein, dRING protein, dRING1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Drosophila melanogaster
Immunogen:
Recombinant RING1 of Drosophila melanogaster, amino acids: 150-250, UniProt: Q9VB08
Applications:
Chromatin Immunoprecipitation (ChIP), Western blot (WB)
pHRed is a red fluorescent sensor of pH. Fluorescence emission of pHRed peaks at 610 nm while exhibiting dual excitation peaks at 440 nm and 585 nm.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
pHRed
Immunogen:
Recombinat part of pHRed of Chlamydomonas reinhardtii.
The reactivity of the antiserum is directed to the subclass IgG1. It does not react with other subclasses of IgG, IgG/Fab fragments, IgM and IgA or any non-Ig protein in mouse serum, as tested by immunoelectrophoresis and double radial immunodiffusion In enzyme-immunocytochemical and immunohistochemical staining for the detection of IgG1 at the cellular and subcellular level by staining of appropriately treated cell and tissue substrates; to demonstrate circulating IgG1 antibodies in serodiagnostic microbiology and autoimmune diseases; to identify a specific antigen using a reference antibody of mouse origin known to be of the IgG1 isotype in the middle layer of the indirect test procedure; in non-isotopic assay methodology (e.g. ELISA) to measure IgG1 in mouse serum or other body fluids. This immunoconjugate is not pre-diluted. The optimum working dilution of each conjugate should be established by titration before being used. Excess labelled antibody must be avoided because it may cause high unspecific background staining and interfere with the specific signal. Working dilutions for histochemical and cytochemical use are usually between 1:100 and 1:500; in ELISA and comparable non-precipitating antibody-binding assays between 1:1.000 and 1:10,000 depending on the method used.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Stored at or below -20 °C. Prior to use, an aliquot is thawed slowly at ambient temperature, spun down again and used to prepare working dilutions by adding sterile phosphate buffered saline (PBS, pH 7,2). Repeated thawing and freezing should be avoided. Working dilutions should be stored at 4 C, not refrozen, and preferably used the same day. If a slight precipitation occurs upon storage, this should be removed by centrifugation. It will not affect the performance of the immunoconjugate. Lyophilized at +4 C--at least 10 years. Reconstituted at or below -20 C--3-5 years. Reconstituted at +4 C--7 days.
Host Animal:
Goat
Species Reactivity:
Mouse
Immunogen:
Pools of purified homogenous IgG1 isolated from pooled mouse serum, Freund’s complete adjuvant is used in the first step of the immunization procedure,
Applications:
Dot blot (Dot), ELISA (ELISA), Immunocytochemistry (ICC), Immunohistochemistry (paraffin) (IHC), Western blot (WB)
This immunoconjugate is not species-specific since inter-species cross-reactivity is a normal feature of antisera to immunoglobulins, However this conjugate has been passed over appropriate immuno-adsorbents to remove antibodies cross-reacting with Human immunoglobulins, This renders it specific for use in test systems containing material of Human origin (e,g, Human tissue/Mouse monoclonal antibody to a Human tissue constituent/anti Mouse Ig isotype-specific immunoconjugate
Conjugate is present in PBS (pH 7,2), No reactivity is observed to other subclasses of IgG, IgG/Fab fragments, IgM and IgA or any non-Ig protein in mouse serum
The reactivity of the antiserum is directed to the subclass IgG1. It does not react with other subclasses of IgG, IgG/Fab fragments, IgM and IgA or any non-Ig protein in mouse serum, as tested by immunoelectrophoresis and double radial immunodiffusion In enzyme-immunocytochemical and immunohistochemical staining for the detection of IgG1 at the cellular and subcellular level by staining of appropriately treated cell and tissue substrates; to demonstrate circulating IgG1 antibodies in serodiagnostic microbiology and autoimmune diseases; to identify a specific antigen using a reference antibody of mouse origin known to be of the IgG1 isotype in the middle layer of the indirect test procedure; in non-isotopic assay methodology (e.g. ELISA) to measure IgG1 in mouse serum or other body fluids. This immunoconjugate is not pre-diluted. The optimum working dilution of each conjugate should be established by titration before being used. Excess labelled antibody must be avoided because it may cause high unspecific background staining and interfere with the specific signal. Working dilutions for histochemical and cytochemical use are usually between 1:100 and 1:500; in ELISA and comparable non-precipitating antibody-binding assays between 1:1.000 and 1:10,000 depending on the method used.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
The lyophilized conjugate is shipped at ambient temperature and may be stored at 4 C; prolonged storage at or below -20 °C. It is reconstituted by adding 1 ml sterile distilled water, spun down to remove insoluble particles, divided into small aliquots, frozen and stored at or below -20 °C. Prior to use, an aliquot is thawed slowly at ambient temperature, spun down again and used to prepare working dilutions by adding sterile phosphate buffered saline (PBS, pH 7,2). Repeated thawing and freezing should be avoided. Working dilutions should be stored at 4 C, not refrozen, and preferably used the same day. If a slight precipitation occurs upon storage, this should be removed by centrifugation. It will not affect the performance of the immunoconjugate. Lyophilized at +4 C--at least 10 years. Reconstituted at or below -20 C--3-5 years. Reconstituted at +4 C--7 days.
Host Animal:
Goat
Species Reactivity:
Mouse
Immunogen:
Pools of purified homogenous IgG1 isolated from pooled mouse serum, Freund’s complete adjuvant is used in the first step of the immunization procedure,
Applications:
Dot blot (Dot), ELISA (ELISA), Immunocytochemistry (ICC), Immunohistochemistry (paraffin) (IHC), Western blot (WB)
This immunoconjugate is not species-specific since inter-species cross-reactivity is a normal feature of antisera to immunoglobulins, However this conjugate has been passed over appropriate immuno-adsorbents to remove antibodies cross-reacting with Human immunoglobulins, This renders it specific for use in test systems containing material of Human origin (e,g, Human tissue/Mouse monoclonal antibody to a Human tissue constituent/anti Mouse Ig isotype-specific immunoconjugate
For reconstitution add 1 ml of sterile water, Let it stand for 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Conjugate is present in PBS (pH 7,2), No reactivity is observed to other subclasses of IgG, IgG/Fab fragments, IgM and IgA or any non-Ig protein in mouse serum
Goat anti-Human IgD (Fc specific), Biotin conjugated is a secondary antibody which binds to the Fc part of human IgD.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antiserum is stable at 4°Cfor several years. After reconstitution, the antibody is stable for one week at 4 and for 3-5 years if stored at -20 .
Host Animal:
Goat
Species Reactivity:
Human IgD, Fc part
Immunogen:
Purified human IgD,
Applications:
Dot blot (Dot), ELISA (ELISA), Immunocytochemistry (ICC), Immunohistochemistry (IHC), Western blot (WB)
Goat anti-Human IgD (Fc specific) is a secondary antibody which binds to the Fc part of human IgD.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antiserum is stable at 4°Cfor several years. After reconstitution, the antibody is stable for one week at 4 and for 3-5 years if stored at -20 .
Host Animal:
Goat
Species Reactivity:
Human IgD
Immunogen:
Purified monoclonal human IgD,
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect Immunofluorescence (IF), Western blot (WB)
D14 (Strigolactone esterase D14) is an enzyme involved in strigolactone signaling pathway.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana D14, UniProt:Q9SQR3, TAIR: At3g03990
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Yao et al. (2021) Desmethyl butenolides are optimal ligands for karrikin receptor proteins. New Phytol. 2021 Jan 21. doi: 10.1111/nph.17224. Epub ahead of print. PMID: 33474738.
PTOX (plastid terminal oxidase) is a component of electron transfer chain responsible for desaturation of phytoene, which prevents the generation of reactive oxygen species. It is involved in the differentiation of plastids: chloroplasts, amyloplasts, and etioplasts. PTOX is expressed ubiquitously in plant tissues and is located in the lumen.Synonymes: IM, IM1, immutants, AOX4, alternative oxidase 4, ubiquinol oxidase 4, chloroplastic/chromoplastic
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
In most plants it is a minor polypeptide and consequently enrichment by analyzing membrane fractions for example is recommended
Application Details:
1 : 4000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 100 µl of sterile water
Molecular Weight:
30 | 37-41 kDa (Arabidopsis thaliana)
Not reactive in:
Galdieria sulphuraria, Phaeodactylum tricornutum
Selected references:
Urban, Rogowski & Romanowska (2022), Crucial role of the PTOX and CET pathways in optimizing ATP synthesis in mesophyll chloroplasts of C3 and C4 plants, Environmental and Experimental Botany, Volume 202, October 2022, 105024, https://doi.org/10.1016/j.envexpbot.2022.105024Pralon et al. (2020). Mutation of the Atypical Kinase ABC1K3 Partially Rescues the PROTON GRADIENT REGULATION 6 Phenotype in Arabidopsis thaliana. Front. Plant Sci., 25 March 2020Bolte et al. (2020). Dynamics of the localization of the plastid terminal oxidase PTOX inside the chloroplast. J Exp Bot. 2020 Feb 15. pii: eraa074. doi: 10.1093/jxb/eraa074.Cournac et al. (2000b). Flexibility in photosynthetic electron transport: a newly identified chloroplast oxidase involved in chlororespiration. Philos Trans R Soc Lond B Biol Sci. 2000 Oct 29;355(1402):1447-54Cournac et al. (2000a). Electron flow between photosystem II and oxygen in chloroplasts of photosystem I-deficient algae is mediated by a quinol oxidase involved in chlororespiration. J Biol Chem. 2000 Jun 9;275(23):17256-62.
Special application note:
This product can be sold containing proclin if requested
LUC (Luciferase) from Photinus pyralis (Common eastern firefly) (Lampyris pyralis), light producing beetle is an enzyme in the light production.This antibody is directly conjugated to Biotin.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
LUC
Immunogen:
KLH-conjugated synthetic peptide derived from N-terminal part of LUC protein sequence of Photinus pyralis, UniProt: Q27758
LUC (Luciferase) from Photinus pyralis (Common eastern firefly) (Lampyris pyralis), light producing beetle is an enzyme in the light production.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
LUC
Immunogen:
KLH-conjugated synthetic peptide derived from N-terminal part of LUC protein sequence of Photinus pyralis, UniProt: Q27758
Depends upon a MW of a protein which is LUC-tagged,
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Yuan et al. (2021). BBX19 fine-tunes the circadian rhythm by interacting with PSEUDO-RESPONSE REGULATOR proteins to facilitate their repressive effect on morning-phased clock genes, The Plant Cell, 2021;, koab133, https://doi.org/10.1093/plcell/koab133
LUC (Luciferase) from Photinus pyralis (Common eastern firefly) (Lampyris pyralis), light producing beetle is an enzyme in the light production.This antibody is directly conjugated to HRP.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
LUC
Immunogen:
KLH-conjugated synthetic peptide derived from N-terminal part of LUC protein sequence of Photinus pyralis, UniProt: Q27758
LUC (Luciferase) from Photinus pyralis (Common eastern firefly) (Lampyris pyralis), light producing beetle is an enzyme in the light production.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
LUC
Immunogen:
KLH-conjugated synthetic peptide derived from N-terminal part of LUC protein sequence of Photinus pyralis, UniProt: Q27758
LUC (Luciferase) from Photinus pyralis (Common eastern firefly) (Lampyris pyralis), light producing beetle is an enzyme in the light production.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
LUC
Immunogen:
KLH-conjugated synthetic peptide derived from N-terminal part of LUC protein sequence of Photinus pyralis, UniProt: Q27758
LUC (Luciferase) from Photinus pyralis (Common eastern firefly) (Lampyris pyralis), light producing beetle is an enzyme in the light production.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
LUC
Immunogen:
KLH-conjugated synthetic peptide derived from N-terminal part of LUC protein sequence of Photinus pyralis, UniProt: Q27758
LUC (Luciferase) from Photinus pyralis (Common eastern firefly) (Lampyris pyralis), light producing beetle is an enzyme in the light production.This antibody is directly conjugated to ALP.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
LUC
Immunogen:
KLH-conjugated synthetic peptide derived from N-terminal part of LUC protein sequence of Photinus pyralis, UniProt: Q27758
LUC (Luciferase) from Photinus pyralis (Common eastern firefly) (Lampyris pyralis), light producing beetle is an enzyme in the light production.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
LUC
Immunogen:
KLH-conjugated synthetic peptide derived from N-terminal part of LUC protein sequence of Photinus pyralis, UniProt: Q27758
Depends upon a MW of a protein which is LUC-tagged,
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Ormancey et al. (2023) Complementary peptides represent a credible alternative to agrochemicals by activating translation of targeted proteins. Nat Commun. 2023;14(1):254. Published 2023 Jan 17. doi:10.1038/s41467-023-35951-0
Cas9 (CRISPR-associated endonuclease 9) is an RNA-guided DNA endonuclease associated with the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) type II adaptive immunity system. CRISPR clusters are transcribed and processed into CRISPR RNA (crRNA). Cas9 protein serves as a genome engineering tool to induce site-directed double strand breaks in DNA.This antibody is directly conjugated to Biotin.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
Staphylococcus aureus
Expected Species:
Staphylococcus pyogenes UniProt: Q99ZW2
Immunogen:
KLH-conjugated synthetic peptide derived from Streptococcus thermophilus Cas9/Csn1 protein sequence, UniProt: Q03JI6(peptide sequence is conserved in pYLCRISPR/Cas9Pubi-H vector)
Cas9 (CRISPR-associated endonuclease 9) is an RNA-guided DNA endonuclease associated with the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) type II adaptive immunity system. CRISPR clusters are transcribed and processed into CRISPR RNA (crRNA). Cas9 protein serves as a genome engineering tool to induce site-directed double strand breaks in DNA.This antibody is directly conjugated to HRP.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
Staphylococcus aureus
Expected Species:
Staphylococcus pyogenes UniProt: Q99ZW2
Immunogen:
KLH-conjugated synthetic peptide derived from Streptococcus thermophilus Cas9/Csn1 protein sequence, UniProt: Q03JI6(peptide sequence is conserved in pYLCRISPR/Cas9Pubi-H vector)
Cas9 (CRISPR-associated endonuclease 9) is an RNA-guided DNA endonuclease associated with the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) type II adaptive immunity system, CRISPR clusters are transcribed and processed into CRISPR RNA (crRNA), Cas9 protein serves as a genome engineering tool to induce site-directed double strand breaks in DNA.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
Staphylococcus aureus
Expected Species:
Staphylococcus pyogenes UniProt: Q99ZW2
Immunogen:
KLH-conjugated synthetic peptide derived from Streptococcus thermophilus Cas9/Csn1 protein sequence, UniProt: Q03JI6(peptide sequence is conserved in pYLCRISPR/Cas9Pubi-H vector)
Cas9 (CRISPR-associated endonuclease 9) is an RNA-guided DNA endonuclease associated with the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) type II adaptive immunity system, CRISPR clusters are transcribed and processed into CRISPR RNA (crRNA), Cas9 protein serves as a genome engineering tool to induce site-directed double strand breaks in DNA.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
Staphylococcus aureus
Expected Species:
Staphylococcus pyogenes UniProt: Q99ZW2
Immunogen:
KLH-conjugated synthetic peptide derived from Streptococcus thermophilus Cas9/Csn1 protein sequence, UniProt: Q03JI6(peptide sequence is conserved in pYLCRISPR/Cas9Pubi-H vector)
Cas9 (CRISPR-associated endonuclease 9) is an RNA-guided DNA endonuclease associated with the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) type II adaptive immunity system, CRISPR clusters are transcribed and processed into CRISPR RNA (crRNA), Cas9 protein serves as a genome engineering tool to induce site-directed double strand breaks in DNA.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
Staphylococcus aureus
Expected Species:
Staphylococcus pyogenes UniProt: Q99ZW2
Immunogen:
KLH-conjugated synthetic peptide derived from Streptococcus thermophilus Cas9/Csn1 protein sequence, UniProt: Q03JI6(peptide sequence is conserved in pYLCRISPR/Cas9Pubi-H vector)
Cas9 (CRISPR-associated endonuclease 9) is an RNA-guided DNA endonuclease associated with the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) type II adaptive immunity system. CRISPR clusters are transcribed and processed into CRISPR RNA (crRNA). Cas9 protein serves as a genome engineering tool to induce site-directed double strand breaks in DNA.This antibody is directly conjugated to ALP.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
Staphylococcus aureus
Expected Species:
Staphylococcus pyogenes UniProt: Q99ZW2
Immunogen:
KLH-conjugated synthetic peptide derived from Streptococcus thermophilus Cas9/Csn1 protein sequence, UniProt: Q03JI6(peptide sequence is conserved in pYLCRISPR/Cas9Pubi-H vector)
Cas9 (CRISPR-associated endonuclease 9) is an RNA-guided DNA endonuclease associated with the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) type II adaptive immunity system. CRISPR clusters are transcribed and processed into CRISPR RNA (crRNA). Cas9 protein serves as a genome engineering tool to induce site-directed double strand breaks in DNA.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Staphylococcus aureus
Expected Species:
Staphylococcus pyogenes UniProt: Q99ZW2
Immunogen:
KLH-conjugated synthetic peptide derived from Streptococcus thermophilus Cas9/Csn1 protein sequence, UniProt: Q03JI6(peptide sequence is conserved in pYLCRISPR/Cas9Pubi-H vector)
GUS (Beta-glucuronidase) is an enzyme which when incubated with colorless or non-fluorescent substrates, can catalyze reaction of their transformation into coloured or fluorescent products.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
GUS
Immunogen:
KLH-conjugated synthetic peptide derived from Escherichia coli GUS protein at amino acid 358.
depends upon a MW of a protein which is expressed with GUS
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Xiumei et al. (2022) Pathogenesis-related protein 1 suppresses oomycete pathogen by targeting against AMPK kinase complex,Journal of Advanced Research, 2022, ISSN 2090-1232, https://doi.org/10.1016/j.jare.2022.02.002.Xiao et al. (2022) An amino acid transporter-like protein (OsATL15) facilitates the systematic distribution of thiamethoxam in rice for controlling the brown planthopper. Plant Biotechnol J. 2022 Jun 9. doi: 10.1111/pbi.13869. Epub ahead of print. PMID: 35678495. (Immunolocalization)Nizkorodova et al. (2020). The Effect of Translation Promoting Site (TPS) on Protein Expression in E. coli Cells. Mol Biotechnol (2020). doi.org/10.1007/s12033-020-00251-1Nikorodova and Isakov (2019). New insights into the mechanism of action of e-element enhancer in E.coli. Eurasian Journal of Applied Biotechnology 2/2019
Special application note:
This antibody will not work with pCAMBIA vectors due to mutation starting at amino acid position 358
JAR1 (Jasmonic acid-amido synthetase JAR1; jasmonate resistant 1) is catalyzing the synthesis of jasmonates-amino acid conjugates by adenylation. Plays an important role in the accumulation of JA-Ile in response to wounding, both locally and systemically; promotes JA responding genes especially in distal part of wounded plants, via the JA-Ile-stimulated degradation of JAZ repressor proteins by the SCF(COI)E3 ubiquitin-protein ligase pathway. Involved in the apoptosis-like programmed cell death (PCD) induced by fungal toxin fumonisin B1-mediated (FB1). Contributes to the sensitivity toward F.graminearum.Alternative names: Jasmonate-amino acid synthetase JAR1, Protein FAR-RED INSENSITIVE 219, Protein JASMONATE RESISTANT 1
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Capsicum annuum, Gossypium hirsutum, Nicotiana tabacum, Prunus yedoensis var. nudiflora, Solanum tuberosum, Ulmus americana Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from Arabidopsis thaliana JAR1 protein sequence, UniProt: Q9SKE2, TAIR: At2g46370
Purity is > 95% based on SDS-PAGE.Supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2. 0.05% (w/v).For use as a standard or control in most immunoassay formats.
Purity is > 95% based on SDS-PAGE.Supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2. 0.05% (w/v).For use as a standard or control in most immunoassay formats.
Purity is > 95% based on SDS-PAGE.Supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2. 0.05% (w/v).For use as a standard or control in most immunoassay formats.
Supplied in 10 mM Sodium Phosphate, 0.15 M Na/K Chloride, pH 7.2.For use as a standard or control in most immunoassay formats.This product is derived from Syrian Hamster.
Duck IgY. Protein A purified in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2. Contains 0.05 % sodium azide.
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2. 0.05% (w/v) Sodium Azide is added as a preservative.
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, prepare small aliquots and store at -20 °C. For storage at 2-8 C, add a preservative to prevent growth of bacteria.This product is used as a blocking reagent or control for
Purified serum, lipid extracted and dialyzed against 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2.
Special application note:
Rehydrate with 11.0 ml of deionized water.(Product has been overfilled to ensure complete recovery.) Swirl gently and let stand for up to 2 hours at 18-25 C. Centrifuge reconstituted serum to remove any precipitates.This product is used as a blocking reagent or control for most immunoassay applications.
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, prepare small aliquots and store at -20 °C. For storage at 2-8 C, add a preservative to prevent growth of bacteria.This product is used as a blocking reagent or control for
Suitable as a control or blocking reagent in immunoassays
Application Details:
To be determined by end user
Purity:
Purified serum, lipid extracted and dialyzed against 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2.
Special application note:
Rehydrate with 11 ml of deionized water.(Product has been overfilled to ensure complete recovery.) Swirl gently and let stand for up to 2 hours at 18-25 C. Centrifuge reconstituted serum to remove any precipitates.Non-immune.
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, prepare small aliquots and store at -20 °C. For storage at 2-8 C, add a preservative to prevent growth of bacteria.This product is used as a blocking reagent or control for
Suitable as a control or blocking reagent in immunoassays
Application Details:
To be determined by end user
Purity:
Purified serum, lipid extracted and dialyzed against 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2.
Special application note:
Rehydrate with 11 ml of deionized water,(Product has been overfilled to ensure complete recovery,) Swirl gently and let stand for up to 2 hours at 18-25 C, Centrifuge reconstituted serum to remove any precipitates
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, prepare small aliquots and store at -20 °C. For storage at 2-8 C, add a preservative to prevent growth of bacteria.This product is used as a blocking reagent or control for
Purified serum, lipid extracted and dialyzed against 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2.
Special application note:
This product is used as a blocking reagent or control for most immunoassay applications.Rehydrate with 5.5 ml of deionized water. (Product has been overfilled to ensure complete recovery) Swirl gentle and let stand for up to 2 hours at 18-25 C. Centrifuge reconstituted serum to remove any precipitates.
Histones are the main constituents of the protein part of chromosomes of eukaryotic cells. They are rich in the amino acids arginine and lysine and have been greatly conserved during evolution. Histones pack the DNA into tight masses of chromatin. Two core histones of each class H2A, H2B, H3 and H4 assemble and are wrapped by 146 base pairs of DNA to form one octameric nucleosome. Phosphorylation of H3S10 is associated with mitosis.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Human
Expected Species:
Chicken, Drosophila melanogaster, Mouse, Plant, Rat, Xenopus sp.
Immunogen:
KLH-conjugated synthetic peptide
Applications:
Chromatin immunoprecipitation (ChIP), Dot Blot (Dot), ELISA (ELISA), Immunofluorescence (IF), Immunoprecipitation (IP), Western blot (WB)
Histones are the main constituents of the protein part of chromosomes of eukaryotic cells. They are rich in the amino acids arginine and lysine and have been greatly conserved during evolution. Histones pack the DNA into tight masses of chromatin. Two core histones of each class H2A, H2B, H3 and H4 assemble and are wrapped by 146 base pairs of DNA to form one octameric nucleosome. Phosphorylation of H3S10 is associated with mitosis.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Human
Expected Species:
Chicken, Drosophila melanogaster, Mouse, Plant, Rat, Xenopus sp.
Immunogen:
KLH-conjugated synthetic peptide
Applications:
Chromatin immunoprecipitation (ChIP), Dot Blot (Dot), ELISA (ELISA), Immunofluorescence (IF), Western blot (WB)
Histones are the main constituents of the protein part of chromosomes of eukaryotic cells. They are rich in the amino acids arginine and lysine and have been greatly conserved during evolution. Histones pack the DNA into tight masses of chromatin. Two core histones of each class H2A, H2B, H3 and H4 assemble and are wrapped by 146 base pairs of DNA to form one octameric nucleosome. Phosphorylation of H3S10 is associated with mitosis.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Human
Expected Species:
Chicken, Drosophila melanogaster, Mouse, Plant, Rat, Xenopus sp.
Immunogen:
KLH-conjugated synthetic peptide
Applications:
Chromatin immunoprecipitation (ChIP), Dot Blot (Dot), ELISA (ELISA), Immunofluorescence (IF), Western blot (WB)
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, prepare small aliquots and store at -20 °C. For storage at 2-8 C, add a preservative to prevent growth of bacteria.This product is used as a blocking reagent or control for
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, prepare small aliquots and store at -20 °C. For storage at 2-8 C, add a preservative to prevent growth of bacteria.This product is used as a blocking reagent or control for
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, prepare small aliquots and store at -20 °C. For storage at 2-8 C, add a preservative to prevent growth of bacteria.This product is used as a blocking reagent or control for
Purified serum, lipid extracted and dialyzed against 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2.
Special application note:
Rehydrate with 2.2 ml of deionized water.(Product has been overfilled to ensure complete recovery.) Swirl gently and let stand for up to 2 hours at 18-25 C. Centrifuge reconstituted serum to remove any precipitates.This product is used as a blocking reagent or control for most immunoassay applications.
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, prepare small aliquots and store at -20 °C. For storage at 2-8 C, add a preservative to prevent growth of bacteria.This product is used as a blocking reagent or control for
Purified serum, lipid extracted and dialyzed against 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2.
Special application note:
Rehydrate with 11.0 ml of deionized water.(Product has been overfilled to ensure complete recovery.) Swirl gently and let stand for up to 2 hours at 18-25 C. Centrifuge reconstituted serum to remove any precipitates.This product is used as a blocking reagent or control for most immunoassay applications.
Hamster IgG purified contains Protein G purified hamster IgG from normal serum, e.g. serum of non immunized animals and is excellent for use as blocking reagent in immunoassays.
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at 2-8°C.
Host Animal:
Hamster
Species Reactivity:
Hamster IgG
Applications:
For use as a standard or control in most immunoassay formats
Total IgG. Protein G purified in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2. Contains 0.05 % sodium azide.
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2. 0.05% (w/v) Sodium Azide is added as a preservative.
Total IgG. Protein G purified in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2. Contains 0.05 % sodium azide.
Special application note:
Purity is > 95% based on SDS-PAGE.Supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2. 0.05% (w/v) Sodium Azide is added as a preservative.For use as a standard or control in most immunoassay formats.
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified goat IgG.
Reconstitution:
For reconstitution add 1,1 ml of sterile water
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Rabbit IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.1% (v/v) Kathon CG is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on rabbit IgGBased on IEP, no reactivity is observed to: • non-immunoglobulin rabbit serum proteins • light chains on all rabbit immunoglobulins • Rabbit IgG F(ab)'2 fragment • serum proteins from bovine, horse or human
Goat anti-rabbit IgG Fc, FITC (fluorescein-5-isothiocyanate) conjugated, is a secondary antibody which binds to rabbit IgGs in immunological assays. FITC has Amax = 494 nm, Emax = 518 nm. Antibodies are adsorbed against bovine, horse and human serum proteins and affinity purified using solid phase rabbit IgG Fc.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified goat IgG.
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Rabbit IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with:• heavy (γ) chains on rabbit IgG Based on IEP, no reactivity is observed to: • non-immunoglobulin rabbit serum proteins • light chains on all rabbit immunoglobulins • Rabbit IgG F(ab)'2 fragment • serum proteins from bovine, horse or human
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified goat IgG.
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Rabbit IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on rabbit IgG .Based on IEP, no reactivity is observed to:• non-immunoglobulin rabbit serum proteins • light chains on all rabbit immunoglobulins • rabbit IgG F(ab)'2 fragment • serum proteins from bovine, horse or human
Goat anti-Rabbit IgG Fc, ALP conjugated, min. cross-reactivity to bovine horse or human serum proteins is a secondary antibody, conjugated to ALP, which binds to rabbit IgG (H&L), Fc in immunological assays.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store liquid at Store at 2-8°C. For storage at -20 C, dilute with an equal volume of glycerol to prevent loss of enzymatic activity. Prepare working dilutions prior to use and then discard.
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Rabbit IgG .Antibody is supplied in 30 mM Triethanolamine, pH 7.2, 5 mM Magnesium Chloride, 0.1 mM Zinc Chloride, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on rabbit IgG .Based on IEP, no reactivity is observed to: • non-immunoglobulin rabbit serum proteins • light chains on all rabbit immunoglobulins • Rabbit IgG F(ab)'2 fragment • serum proteins from bovine, horse or human .
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified goat IgG.
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on rabbit IgG • light chains on all rabbit immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin rabbit serum proteins .
Goat anti-Rabbit IgG (H&L), F(ab)'2 Fragment, min. cross-reactivity to non-immunoglobulin rabbit serum proteins and human serum proteins is a secondary antibody, which binds to rabbit IgG (H&L), F(ab)'2 Fragment in immunological assays.
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified goat IgG.
Special application note:
Antibody purity is > 90% based on SDS-PAGE .Affinity purified using solid phase Rabbit IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on rabbit IgG • light chains on all rabbit immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin rabbit serum proteins • serum proteins from human.
Goat anti-Rabbit IgG (H&L), F(ab)'2 Fragment, DyLight 488 conjugated is a secondary antibody conjugated to DyLight 488, which binds to rabbit IgG in immunological assays. DyLight 488 has Amax = 493 nm, Emax = 518 nm. DyLight is a registered trade mark of Thermofisher Inc., and its subsidaries.
For reconstitution add 0,55 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Rabbit IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on rabbit IgG • light chains on all rabbit immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin rabbit serum proteins .
Donkey anti-Rabbit IgG (H&L), F(ab)'2 Fragment, DyLight 488 conjugated is a secondary antibody conjugated to DyLight 488, which binds to rabbit IgG in immunological assays. DyLight 488 has Amax = 493 nm, Emax = 518 nm. DyLight is a registered trade mark of Thermofisher Inc., and its subsidaries.
For reconstitution add 0,55 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Rabbit IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on rabbit IgG • light chains on all rabbit immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin rabbit serum proteins .
Donkey anti-Rabbit IgG (H&L), F(ab)'2 Fragment, min. cross-reactivity to Bovine, Chicken, Goat, Guinea Pig, Hamster, Horse, Human, Mouse, Rat or Sheep is a secondary antibody which binds to rabbit IgG (H&L), F(ab)'2 Fragment in immunological assays.
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified donkey IgG.
Special application note:
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Rabbit IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on Rabbit IgG • light chains on all Rabbit immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin Rabbit serum immunoglobulins • IgG from Bovine, Chicken, Goat, Guinea Pig, Hamster, Horse, Human, Mouse, Rat or Sheep.
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified donkey IgG.
Special application note:
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Rabbit IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on rabbit IgG • light chains on all rabbit immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin rabbit serum proteins .
Goat anti-Rabbit IgG (H&L), min. cross-reactivity to bovine, goat, human, mouse or rat IgG or serum is a secondary antibody which binds to rabbit IgG in immunological assays.
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified goat IgG.
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Rabbit IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on rabbit IgG • light chains on all rabbit immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin rabbit serum proteins • serum proteins from bovine, goat, human, mouse, or rat • IgG from bovine, goat, human, mouse or rat .
Goat anti-Rabbit IgG (H&L), DyLight 680 conjugated is a secondary antibody conjugated to DyLight 680, which binds to rabbit IgG in immunological assays. DyLight 680 has Amax = 682 nm, Emax = 715 nm. DyLight is a registered trade mark of Thermofisher Inc., and its subsidaries.
For reconstitution add 1,1 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Rabbit IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on rabbit IgG • light chains on all rabbit immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin rabbit serum proteins .
Goat anti-Rabbit IgG (H&L), DyLight 550 conjugated, min. cross-reactivity to human serum proteins is a secondary antibody conjugated to DyLight 550, which binds to rabbit IgG in immunological assays. DyLight 550 has Amax = 562 nm, Emax = 576 nm. DyLight is a registered trade mark of Thermofisher Inc., and its subsidaries.
For reconstitution add 1,1 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Rabbit IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on rabbit IgG • light chains on all rabbit immunoglobulins . Based on IEP, no reactivity is observed to: • non-immunoglobulin rabbit serum proteins • human serum proteins .
Donkey anti-Rabbit IgG (H&L), DyLight 405 conjugated, min. cross-reactivity to bovine, chicken, goat, guinea pig, hamster, horse, human, mouse, rat or sheep IgG is a secondary antibody conjugated to DyLight 405, which binds to rabbit IgG in immunological assays. DyLight 405 has Amax = 400 nm, Emax = 420 nm. DyLight is a registered trade mark of Thermofisher Inc., and its subsidaries
For reconstitution add 1,1 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Rabbit IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on rabbit IgG • light chains on all rabbit immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin rabbit serum proteins • IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, mouse, rat or sheep .
Goat anti-Rabbit IgG (H&L), DyLight 405 conjugated is a secondary antibody conjugated to DyLight 405, which binds to rabbit IgG in immunological assays. DyLight 405 has Amax = 400 nm, Emax = 420 nm. DyLight is a registered trade mark of Thermofisher Inc., and its subsidaries.
For reconstitution add 1,1 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Rabbit IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on rabbit IgG • light chains on all rabbit immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin rabbit serum proteins .
Donkey anti-Rabbit IgG (H&L), DyLight 405 conjugated is a secondary antibody conjugated to DyLight 405, which binds to rabbit IgG in immunological assays. DyLight 405 has Amax = 400 nm, Emax = 420 nm. DyLight is a registered trade mark of Thermofisher Inc., and its subsidaries.
For reconstitution add 1,1 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Rabbit IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on rabbit IgG • light chains on all rabbit immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin rabbit serum proteins .
Donkey anti-Rabbit IgG (H&L), Biotin conjugated, min. cross-reactivity to mouse IgG or serum proteins is a secondary antibody conjugated to biotin, which binds to rabbit IgG in immunological assays.
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Rabbit IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on rabbit IgG • light chains on all rabbit immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin rabbit serum proteins • mouse IgG or serum proteins .
For reconstitution add 1,1 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgM.Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgM • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins .
For reconstitution add 1,1 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgM.Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.1% (v/v) Kathon CG is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgM • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins .
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgM.Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgM • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins .Concentration: 1.50 mg/ml (E 1% at 280 nm = 13.0)
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgM.Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgM • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins .
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified goat IgG.
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgM.Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgM • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins .
For reconstitution add 1,1 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgM.Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgM .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins • light chains on all mouse immunoglobulins .
Goat anti-Mouse IgM ( chain), min. cross-reactivity to human IgG or serum proteins is a secondary antibody which binds to mouse IgM ( chain) in immunological assays.
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified goat IgG.
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgM-kappa.Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgM .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins • light chains on all mouse immunoglobulins • human IgG or serum proteins .
For reconstitution add 1,1 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgM.Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.1% (v/v) Kathon CG is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgM .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins • light chains on all mouse immunoglobulins .
Goat anti-Mouse IgM ( chain), FITC conjugated, min. cross-reactivity to human IgG or serum proteins is a secondary antibody conjugated to FITC, which binds to mouse IgM ( chain) in immunological assays.
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgM.Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgM .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins • light chains on all mouse immunoglobulins • human IgG or serum proteins .
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgM.Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgM .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins • light chains on all mouse immunoglobulins .
Goat anti-Mouse IgM ( chain), Biotin conjugated is a secondary antibody conjugated to biotin, which binds to mouse IgM ( chain) in immunological assays.
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgM.Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgM .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins • light chains on all mouse immunoglobulins .
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified goat IgG.
Special application note:
Antibody purity is > 90 % based on SDS-PAGE. Small amounts of intact IgG may be present.Affinity purified using solid phase Mouse IgG. F(ab)’2 fragment was prepared by pepsin digestion.Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2. 0.05 % (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: heavy (γ) chains on Mouse IgG.Based on IEP, no reactivity is observed to: light chains on all Mouse immunoglobulins, non-immunoglobulin Mouse serum proteins, Mouse IgG, F(ab)’2 fragment, serum proteins from Bovine, Horse, or Human.
Goat anti-Mouse IgG Fc, TRITC conjugated, min. cross-reactivity to bovine, horse or human serum proteins is a secondary antibody conjugated to TRITC, which binds to mouse IgG Fc in immunological assays.
For reconstitution add 1,1 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins • light chains on all mouse immunoglobulins • mouse IgG, F(ab)'2 fragment • serum proteins from bovine, horse, or human .
Goat anti-Mouse IgG Fc, min. cross-reactivity to bovine, horse or human serum proteins is a secondary antibody which binds to mouse IgG Fc in immunological assays.
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified goat IgG.
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins • light chains on all mouse immunoglobulins • mouse IgG, F(ab)'2 fragment • serum proteins from bovine, horse, or human .
Goat anti-Mouse IgG Fc, HRP conjugated, min. cross-reactivity to bovine, horse or human serum proteins is a secondary antibody conjugated to HRP, which binds to mouse IgG Fc in immunological assays.
For reconstitution add 1,1 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.1% (v/v) Kathon CG is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins • light chains on all mouse immunoglobulins • mouse IgG, F(ab)'2 fragment • serum proteins from bovine, horse, or human .
Goat anti-Mouse IgG Fc, FITC conjugated, min. cross-reactivity to bovine, horse or human serum proteins is a secondary antibody conjugated to FITC, which binds to mouse IgG Fc in immunological assays.
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins • light chains on all mouse immunoglobulins • mouse IgG, F(ab)'2 fragment • serum proteins from bovine, horse, or human .
Goat anti-Mouse IgG Fc, Biotin conjugated, min. cross-reactivity to bovine, horse or human serum proteins is a secondary antibody conjugated to biotin, which binds to mouse IgG Fc in immunological assays.
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins • light chains on all mouse immunoglobulins • mouse IgG, F(ab)'2 fragment • serum proteins from bovine, horse, or human .
Goat anti-Mouse IgG Fc, ALP conjugated, min. cross-reactivity to bovine, horse or human serum proteins is a secondary antibody conjugated to APL, which binds to mouse IgG Fc in immunological assays.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store non-diluted antibody at 2-8°C. For storage at -20 C, dilute with an equal volume of glycerol to prevent loss of enzymatic activity. Prepare working dilutions prior to use and then discard.
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 30 mM Triethanolamine, pH 7.2, 5 mM Magnesium Chloride, 0.1 mM Zinc Chloride, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins • light chains on all mouse immunoglobulins • mouse IgG, F(ab)'2 fragment • serum proteins from bovine, horse, or human .
Goat anti-Mouse IgG + IgM,, DyLight 633 conjugated, min w/human IgG or serum proteins is a secondary antibody conjugated to DyLight 633, which binds to mouse IgG + IgM in immunological assays. DyLight 633 has Amax = 638 nm, Emax = 658 nm. DyLight is a registered trade mark of Thermofisher Inc., and its subsidaries.
For reconstitution add 1,1 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgG + IgM.Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy chains on mouse IgG + IgM • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins • human IgG or serum proteins .
For reconstitution add 1,1 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgG + IgM.Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy chains on mouse IgG + IgM • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins .
Goat anti-Mouse IgG + IgM, min. cross-reactivity to human IgG or serum proteins is a secondary antibody, which binds to mouse IgG + IgM in immunological assays.
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified goat IgG.
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgG + IgM.Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy chains on mouse IgG + IgM • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins • human IgG or serum proteins .
For reconstitution add 1,1 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgG + IgM.Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.1% (v/v) Kathon CG is added as a preservative.Based on IEP, this antibody reacts with: • heavy chains on mouse IgG + IgM • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins .
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgG + IgM.Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy chains on mouse IgG + IgM • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins .
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgG + IgM.Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy chains on mouse IgG + IgM • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins .
The optimal working dilution should be determined by the investigator,
Purity:
Immunogen affinity purified goat IgG.
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgG + IgM.Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy chains on mouse IgG + IgM • light chains on all mouse immunoglobulins . Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins .
Goat anti-Mouse IgG (H&L), F(ab)'2 fragment, TRITC conjugated, min. cross-reactivity to bovine, goat, human, rabbit, or rat IgG (highly absorbed against rat IgG) is a secondary antibody conjugated to TRITC, which binds to mouse IgG (H&L), F(ab)'2 Fragment in immunological assays.
For reconstitution add 0,55 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins • bovine, goat, human, rabbit or rat IgG Based on ELISA, this antibody has <1% reactivity to: • rat IgG .
Goat anti-Mouse IgG (H&L), F(ab)'2 fragment, TRITC conjugated, min. cross-reactivity to bovine, goat, human, rabbit, or rat IgG is a secondary antibody conjugated to TRITC, which binds to mouse IgG (H&L), F(ab)'2 Fragment in immunological assays.
For reconstitution add 0,55 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin human serum immunoglobulins • bovine, goat, human, rabbit or rat IgG .
Donkey anti-Mouse IgG (H&L), F(ab)'2 Fragment, TRITC conjugated is a secondary antibody conjugated to TRITC, which binds to mouse IgG (H&L), F(ab)'2 Fragment in immunological assays.
For reconstitution add 0,55 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum immunoglobulins .
Donkey anti-Mouse IgG (H&L), F(ab)'2 fragment, TRITC conjugate, min. cross-reactivity to bovine, chicken, goat, guinea pig, hamster, horse, human, rabbit, rat or sheep IgG is a secondary antibody conjugated to TRITC, which binds to mouse IgG (H&L), F(ab)'2 Fragment in immunological assays.
For reconstitution add 0,55 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum immunoglobulins • IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, rabbit, rat or sheep .
Goat anti-Mouse IgG (H&L), F(ab)'2 fragment, min. cross-reactivity to bovine, horse, human, pig or rabbit serum protein is a secondary antibody which binds to mouse IgG (H&L), F(ab)'2 Fragment in immunological assays.
For reconstitution add 0,55 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum immunoglobulins • serum proteins from bovine, horse, human rabbit or swine .
Goat anti-Mouse IgG (H&L), F(ab)'2 fragment, min. cross-reactivity to bovine, horse, human, pig or rabbit serum protein is a secondary antibody which binds to mouse IgG (H&L), F(ab)'2 Fragment in immunological assays.
For reconstitution add 0,55 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum immunoglobulins • serum proteins from bovine, horse, human rabbit or swine .
Goat anti-Mouse IgG (H&L), F(ab)'2 fragment, min. cross-reactivity to bovine, horse, human, pig or rabbit serum protein is a FITC conjugated secondary antibody which binds to mouse IgG (H&L), F(ab)'2 Fragment in immunological assays.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store non-diluted antibody at 2-8°C. For storage at -20 C, dilute with an equal volume of glycerol to prevent loss of enzymatic activity. Prepare working dilutions prior to use and then discard.
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum immunoglobulins • serum proteins from bovine, horse, human rabbit or swine .
Goat anti-Mouse IgG (H&L), F(ab)'2 fragment, min. cross-reactivity to bovine, horse, human, pig or rabbit serum protein is a secondary antibody which binds to mouse IgG (H&L), F(ab)'2 Fragment in immunological assays.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store non-diluted antibody at 2-8°C. For storage at -20 C, dilute with an equal volume of glycerol to prevent loss of enzymatic activity. Prepare working dilutions prior to use and then discard.
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum immunoglobulins • serum proteins from bovine, horse, human rabbit or swine .
Goat anti-Mouse IgG (H&L), F(ab)'2 Fragment, min. cross-reactivity to bovine, horse, human, pig or rabbit serum protein is a secondary antibody which binds to mouse IgG (H&L), F(ab)'2 Fragment in immunological assays.
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified goat IgG.
Special application note:
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum immunoglobulins • serum proteins from bovine, horse, human rabbit or swine .
Goat anti-Mouse IgG (H&L), F(ab)'2 Fragment, min. cross-reactivity to bovine, goat, human, rabbit, or rat IgG (highly absorbed against rat IgG) is a secondary antibody which binds to mouse IgG (H&L), F(ab)'2 Fragment in immunological assays.
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified goat IgG.
Special application note:
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins • bovine, goat, human, rabbit or rat IgG Based on ELISA, this antibody has <1% reactivity to: • rat IgG .
Goat anti-Mouse IgG (H&L), F(ab)'2 Fragment, min. cross-reactivity to bovine, goat, human, rabbit, or rat IgG is a secondary antibody which binds to mouse IgG (H&L), F(ab)'2 Fragment in immunological assays.
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified goat IgG.
Special application note:
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum immunoglobulins • bovine, goat, human, rabbit or rat IgG .
Donkey anti-Mouse IgG (H&L), F(ab)'2 Fragment, min. cross-reactivity to bovine, chicken, goat, guinea pig, hamster, horse, human, rabbit, rat or sheep IgG is a secondary antibody which binds to mouse IgG (H&L), F(ab)'2 Fragment in immunological assays.
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified donkey IgG.
Special application note:
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum immunoglobulins • IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, rabbit, rat or sheep .
Goat anti-Mouse IgG (H&L), F(ab)'2 fragment, HRP conjugated, min. cross-reactivity to bovine, goat, human, rabbit, or rat IgG (highly absorbed against rat IgG) is a secondary antibody conjugated to HRP, which binds to mouse IgG (H&L), F(ab)'2 Fragment in immunological assays.
For reconstitution add 0,55 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.1% (v/v) Kathon CG is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins • bovine, goat, human, rabbit or rat IgG Based on ELISA, this antibody has <1% reactivity to: • rat IgG .
Goat anti-Mouse IgG (H&L), F(ab)'2 fragment, HRP conjugated, min. cross-reactivity to bovine, goat, human, rabbit, or rat IgG is a secondary antibody conjugated to HRP, which binds to mouse IgG (H&L), F(ab)'2 Fragment in immunological assays.
For reconstitution add 0,55 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum immunoglobulins • bovine, goat, human, rabbit or rat IgG .
Donkey anti-Mouse IgG (H&L), F(ab)'2 fragment, HRP conjugated, min. cross-reactivity to bovine, chicken, goat, guinea pig, hamster, horse, human, rabbit, rat or sheep IgG is a secondary antibody conjugated to HRP, which binds to mouse IgG (H&L), F(ab)'2 Fragment in immunological assays.
For reconstitution add 0,55 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.1% (v/v) Kathon CG is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum immunoglobulins • IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, rabbit, rat or sheep .
Donkey anti-Mouse IgG (H&L), F(ab)'2 Fragment, HRP conjugated is a secondary antibody conjugated to HRP, which binds to mouse IgG (H&L), F(ab)'2 Fragment in immunological assays.
For reconstitution add 0,55 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.1% (v/v) Kathon CG is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum immunoglobulins .
Goat anti-Mouse IgG (H&L), F(ab)'2 fragment, FITC conjugated, min. cross-reactivity to bovine, goat, human, rabbit, or rat IgG is a secondary antibody conjugated to FITC, which binds to mouse IgG (H&L), F(ab)'2 Fragment in immunological assays.
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum immunoglobulins • bovine, goat, human, rabbit or rat IgG .
Donkey anti-Mouse IgG (H&L), F(ab)'2 fragment, FITC conjugate, min. cross-reactivity to bovine, chicken, goat, guinea pig, hamster, horse, human, rabbit, rat or sheep IgG is a secondary antibody conjugated to FITC, which binds to mouse IgG (H&L), F(ab)'2 Fragment in immunological assays.
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum immunoglobulins • IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, rabbit, rat or sheep .
Donkey anti-Mouse IgG (H&L), F(ab)'2 Fragment, FITC conjugated is a secondary antibody conjugated to FITC, which binds to mouse IgG (H&L), F(ab)'2 Fragment in immunological assays.
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum immunoglobulins .
Goat anti-Mouse IgG (H&L), F(ab)'2 fragment, Biotin conjugated, min. cross-reactivity to bovine, goat, human, rabbit, or rat IgG (highly absorbed against rat IgG) is a secondary antibody conjugated to biotin, which binds to mouse IgG (H&L), F(ab)'2 Fragment in immunological assays.
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins • bovine, goat, human, rabbit or rat IgG Based on ELISA, this antibody has <1% reactivity to: • rat IgG .
Goat anti-Mouse IgG (H&L), F(ab)'2 fragment, Biotin conjugated, min. cross-reactivity to bovine, goat, human, rabbit, or rat IgG is a secondary antibody conjugated to biotin, which binds to mouse IgG (H&L), F(ab)'2 Fragment in immunological assays.
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG �� light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum immunoglobulins • bovine, goat, human, rabbit or rat IgG .
Keyhole limpet hemocyanin (KLH) is a large cooper-containing protein consisting of subunits with MW of 400 kDa. It is found in the hemolymph of the sea mollusk Megathura crenulata. This extracellular respiratory protein has many immunostimulatory properties, including the ability to enhance the host’s immune response by interacting with T cells, monocytes, macrophages, and polymorphonuclear lymphocytes. Since its discovery, KLH has been used primarily as a carrier for vaccines and antigens and as adjuvant treatment in regimens such as antimicrobial therapy.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
Megathura crenulata - most commonly used carrier protein
Antibody can be used as a negative control to determine if observed signal is generated by anti-KLH or anti-peptide antibodies, Due to its large size KLH protein will be very difficult to separate on SDS-PAGE
Application Details:
1: 5 000 (ELISA), 1: 5 000 (WB), 1: 1000 (IL)
Purity:
Immunogen affinity purified serum in PBS, pH 7.4, conjugated to biotin.
Molecular Weight:
ca, 400 kDa/subunit
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Protein present in plant vascular tissue (xylem and vascular cambium) is detected by anti-KLH antibodies (H glund et al. 2002) which might lead to false results in IL when using anti-peptide antibodies generated to KLH-conjugated peptide.
Keyhole limpet hemocyanin (KLH) is a large cooper-containing protein consisting of subunits with MW of 400 kDa. It is found in the hemolymph of the sea mollusk Megathura crenulata. This extracellular respiratory protein has many immunostimulatory properties, including the ability to enhance the host’s immune response by interacting with T cells, monocytes, macrophages, and polymorphonuclear lymphocytes. Since its discovery, KLH has been used primarily as a carrier for vaccines and antigens and as adjuvant treatment in regimens such as antimicrobial therapy.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
Megathura crenulata - most commonly used carrier protein
Antibody can be used as a negative control to determine if observed signal is generated by anti-KLH or anti-peptide antibodies, Due to its large size KLH protein will be very difficult to separate on SDS-PAGE
Application Details:
1: 10 000 (ELISA), 1: 10 000 (WB), 1: 1000 (IL)
Purity:
Immunogen affinity purified serum in PBS pH 7.4, conjugated to HRP.
Molecular Weight:
ca, 400 kDa/subunit
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Protein present in plant vascular tissue (xylem and vascular cambium) is detected by anti-KLH antibodies (H glund et al. 2002) which might lead to false results in IL when using anti-peptide antibodies generated to KLH-conjugated peptide.
Keyhole limpet hemocyanin (KLH) is a large cooper-containing protein consisting of subunits with MW of 400 kDa, It is found in the hemolymph of the sea mollusk Megathura crenulata, This extracellular respiratory protein has many immunostimulatory properties, including the ability to enhance the host's immune response by interacting with T cells, monocytes, macrophages, and polymorphonuclear lymphocytes, Since its discovery, KLH has been used primarily as a carrier for vaccines and antigens and as adjuvant treatment in regimens such as antimicrobial therapy.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 650.
Molecular Weight:
ca, 400 kDa/subunit
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known.
Selected references:
To be added when available. Antibody released in May 2023.
Special application note:
Protein present in plant vascular tissue (xylem and vascular cambium) is detected by anti-KLH antibodies (H glund et al, 2002) which might lead to false results in IL when using anti-peptide antibodies generated to KLH-conjugated peptide.DyLight 650 has Amax = 652 nm, Emax = 672 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
Keyhole limpet hemocyanin (KLH) is a large cooper-containing protein consisting of subunits with MW of 400 kDa, It is found in the hemolymph of the sea mollusk Megathura crenulata, This extracellular respiratory protein has many immunostimulatory properties, including the ability to enhance the host's immune response by interacting with T cells, monocytes, macrophages, and polymorphonuclear lymphocytes, Since its discovery, KLH has been used primarily as a carrier for vaccines and antigens and as adjuvant treatment in regimens such as antimicrobial therapy.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 594.
Molecular Weight:
ca, 400 kDa/subunit
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known,
Selected references:
To be added when available. Antibody released in May 2023.
Special application note:
Protein present in plant vascular tissue (xylem and vascular cambium) is detected by anti-KLH antibodies (H glund et al, 2002) which might lead to false results in IL when using anti-peptide antibodies generated to KLH-conjugated peptide.DyLight 594 has Amax = 593 nm, Emax = 618 nm.DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
Keyhole limpet hemocyanin (KLH) is a large cooper-containing protein consisting of subunits with MW of 400 kDa, It is found in the hemolymph of the sea mollusk Megathura crenulata, This extracellular respiratory protein has many immunostimulatory properties, including the ability to enhance the host's immune response by interacting with T cells, monocytes, macrophages, and polymorphonuclear lymphocytes, Since its discovery, KLH has been used primarily as a carrier for vaccines and antigens and as adjuvant treatment in regimens such as antimicrobial therapy.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 488.
Molecular Weight:
ca, 400 kDa/subunit
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known.
Selected references:
To be added when available. Antibody released in May 2023.
Special application note:
Protein present in plant vascular tissue (xylem and vascular cambium) is detected by anti-KLH antibodies (H glund et al, 2002) which might lead to false results in IL when using anti-peptide antibodies generated to KLH-conjugated peptide.DyLight 488 Amax = 493 nm, Emax = 519 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
Keyhole limpet hemocyanin (KLH) is a large cooper-containing protein consisting of subunits with MW of 400 kDa. It is found in the hemolymph of the sea mollusk Megathura crenulata. This extracellular respiratory protein has many immunostimulatory properties, including the ability to enhance the host’s immune response by interacting with T cells, monocytes, macrophages, and polymorphonuclear lymphocytes. Since its discovery, KLH has been used primarily as a carrier for vaccines and antigens and as adjuvant treatment in regimens such as antimicrobial therapy.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
Megathura crenulata - most commonly used carrier protein
Antibody can be used as a negative control to determine if observed signal is generated by anti-KLH or anti-peptide antibodies. Due to its large size KLH protein will be very difficult to separate on SDS-PAGE.Optimal working dilution has to be determined by end user.
Application Details:
1 : 5 000 (ELISA), 1 : 1000 (IL), 1 : 5 000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4, conjugated to ALP.
Molecular Weight:
ca, 400 kDa/subunit
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Protein present in plant vascular tissue (xylem and vascular cambium) is detected by anti-KLH antibodies (H glund et al. 2002) which might lead to false results in IL when using anti-peptide antibodies generated to KLH-conjugated peptide. Further information about it can be found here.
Keyhole limpet hemocyanin (KLH) is a large cooper-containing protein consisting of subunits with MW of 400 kDa. It is found in the hemolymph of the sea mollusk Megathura crenulata. This extracellular respiratory protein has many immunostimulatory properties, including the ability to enhance the host’s immune response by interacting with T cells, monocytes, macrophages, and polymorphonuclear lymphocytes. Since its discovery, KLH has been used primarily as a carrier for vaccines and antigens and as adjuvant treatment in regimens such as antimicrobial therapy.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Megathura crenulata - most commonly used carrier protein
Antibody can be used as a negative control to determine if observed signal is generated by anti-KLH or anti-peptide antibodies, Due to its large size KLH protein will be very difficult to separate on SDS-PAGE
Application Details:
1: 10 000 (ELISA), 1: 10 000 (WB), 1: 1000 (IL)
Purity:
Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
ca, 400 kDa/subunit
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Geadkaew et al. (2014). Bi-functionality of Opisthorchis viverrini aquaporins. doi:10.1016/j.biochi.2014.11.013.H glund et al. (2002). An Antigen Expressed During Plant Vascular Development Crossreacts with Antibodies Towards KLH (Keyhole Limpet Hemocyanin). J of Histochem & Cytochem. 50:999-1003.
Special application note:
Protein present in plant vascular tissue (xylem and vascular cambium) is detected by anti-KLH antibodies (H glund et al. 2002) which might lead to false results in IL when using anti-peptide antibodies generated to KLH-conjugated peptide.
XLG2 protein is involved in G protein-coupled receptor signaling pathway and is involved in defense response, hypersensitive response and response to bacterium.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Recombinant XLG2 of Arabidopsis thaliana UniProt: C6KIE6, TAIR: AT4G34390
PDR8 protein is a key factor which controls the extent of cell death in defense response. Alternative names: ABC transporter ABCG.36, AtABCG36, pleiotropic drug resistance protein 8, protein PENETRATION 3
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Camelina sativa, Eutrema salsugineumSpecies of your interest not listed? Contact us
TIPs belong to MIP/aquaporin protein family. Alternative names: Aquaporin TIP1-1,gamma-tonoplast intrinsic protein, gamma-TIP, aquaporin TIP, gamma-tonoplast intrinsic protein, gamma-TIP, aquaporin TIP, tonoplast intrinsic protein, root-specific RB7, gamma-tonoplast intrinsic protein 2, gamma-TIP2, salt stress-induced tonoplast intrinsic protein
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Oryza sativa
Expected Species:
Brassica napus, Gossypium hirsutum, Hordeum vulgare, Populus trichocarpa, Raphanus sativus, Ricinus communisSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide conserved in Raphanus sativus TIP1;1 and TIP1;2 (protein accesion number available in Suga et al. 2001). Peptide is also conserved in Arabidopsis thaliana TIP1-1 P25818, At2g36830, TIP1-2 Q41963, At3g26520
Protein or membrane sample should be treated at 70 C for 10 min before loading on the gel.Diluted antibody solution can be used 2 to 3 times within one month if it contains 0.1 % sodium azide as preservative and is stored at -20 °C to -80 C.Triton X-100 should not be included in the protein extraction buffer, when cell organelles or membrane proteins must be separated from soluble proteins. Because, Triton X breaks membrane structure and solubilizes most membranes proteins. Furthermore, it should be noted that Triton X at high concentrations binds SDS and mask the detergent effect of SDS for SDS-PAGE. Also, micelles of Triton X behave as a large complex with molecular mass of 90 kDa at high concentrations in SDS-PAGE.
Application Details:
1 : 1000 (WB)
Purity:
Antigen affinity purified serum, in PBS pH 7.4
Reconstitution:
For reconstitution, add 50 l of sterile water.
Molecular Weight:
25,8 | 23 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Mao and Sun (2015). Arabidopsis seed-specific vacuolar aquaporins are involved in maintaining seed longevity under the control of ABSCISIC ACID INSENSITIVE 3. J Exp Bot. 2015 May 26. pii: erv244.Suga et al. (2001). Specificity of the accumulation of mRNAs and proteins of the plasma membrane and tonoplast aquaporings in radish organs. Planta 212:294-304.
LEA (Late embryogenesis abundant) proteins are very hydrophilic proteins, described over 25 years ago as accumulating during late stages of plant seed development. Found in vegetative plant tissues following exposure to environmental stress. Synonymes: Putative late embryogenesis abundant protein LEA.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
LEA (Late embryogenesis abundant) proteins are very hydrophilic proteins, described over 25 years ago as accumulating during late stages of plant seed development. Found in vegetative plant tissues following exposure to environmental stress. Synonymes: Putative late embryogenesis abundant protein LEA.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Part of a recombinant Arabidopsis thaliana LEA4-5, corresponding to position 78-158, UniProt: Q9FG31 , TAIR: AT5G06760
LEA (Late embryogenesis abundant) proteins are very hydrophilic proteins, described over 25 years ago as accumulating during late stages of plant seed development. Found in vegetative plant tissues following exposure to environmental stress. Synonymes: Putative late embryogenesis abundant protein LEA.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Rubisco catalyzes the rate-limiting step of carbon dioxide fixation in photosynthesis. This enzyme contains two subunits, each present in eight copies. In plants and green algae, 55-kD large subunit is coded by the chloroplast rbcL gene, and the 15-kD small subunit is coded by a family of nuclear RbcS genes.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Davies et al. (1997) Induction of extracellular matrix glycoproteins in Brassica petioles by wounding and in response to Xanthomonas campestris. Mol Plant Microbe Interact. 1997;10(7):812-820. doi:10.1094/MPMI.1997.10.7.812Wang. et al. (1995) The monoclonal antibody JIM19 modulates abscisic acid action in barley aleurone protoplasts. Planta 196, 271-276 (1995). https://doi.org/10.1007/BF00201384
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Davies et al. (1997) Induction of extracellular matrix glycoproteins in Brassica petioles by wounding and in response to Xanthomonas campestris. Mol Plant Microbe Interact. 1997;10(7):812-820. doi:10.1094/MPMI.1997.10.7.812Wang. et al. (1995) The monoclonal antibody JIM19 modulates abscisic acid action in barley aleurone protoplasts. Planta 196, 271-276 (1995). https://doi.org/10.1007/BF00201384
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Marcus et al. (2010) Restricted access of proteins to mannan polysaccharides in intact plant cell walls, the plant joutnal, volume 64, Issue 2, October 2010
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. This antibody, directed to branched galactan, is now a cell wall marker that can facilitate the study of vascular development across a range of different angiosperms.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Torode, O Neill, Marcus et al. (2018) Branched Pectic Galactan in Phloem-Sieve-Element Cell Walls: Implications for Cell Mechanics. Plant Physiol. 2018;176(2):1547-1558. doi:10.1104/pp.17.01568
LEA (Late embryogenesis abundant) proteins are very hydrophilic proteins, described over 25 years ago as accumulating during late stages of plant seed development. Found in vegetative plant tissues following exposure to environmental stress. Synonymes: Putative late embryogenesis abundant protein LEA.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
ELF4 (Early flowering 4) is the component of the central CCA1/LHY-TOC1 negative feedback loop in the circadian clock that promotes clock accuracy and is required for sustained rhythms in the absence of daily light/dark cycles. Increases ELF3 nuclear distribution and localization in nuclear bodies. ELF4 is necessary for light-induced expression of both CCA1 and LHY and mediates both entrainment to an environmental cycle and circadian rhythm sustainability under constant conditions. Controls flowering time. Alternative name: Protein ARRHYTHMIC 44.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to several years. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
KLH-conjugated peptide derived from N-terminal of Arabidopsis thaliana ELF4, UniProt: O04211, TAIR: AT2G40080
The plasma membrane H+ ATPase of plants and fungi generates a proton gradient that drives the active transport of nutrients by H+-symport
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Psb27-H1 (Photosystem II repair protein 27) is involved in repair of photodamaged photosystem II (PSII). Localized in the chloroplast lumen, and involved in cellular response to light intensity. Alternative name: Thylakoid lumenal protein PSB27-H1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica oleracea, Brassica rapa,Capsella rubella, Coffea arabica,Camellia sinensis,Cucurbita pepo subsp. pepo, Erythranthe guttata,Gossypium hirsutum, Hevea brasiliensis, Hibiscus syriacu,Morus notabilis, Populus alba, Populus trichocarpa,Raphanus sativus, Quillaja saponaria Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana PSB27-H1 protein sequence, UniProt: Q9LR64, TAIR: At1g03600
Freshly extracted samples are recommended for the analysis. For protein transfer, use a membrane with a pore size of 0.2 m to secure that the protein will transfer correctly, as described here.
Application Details:
1 : 1000 (WB)
Purity:
Antigen affinity purified serum, in PBS pH 7.4
Reconstitution:
For reconstitution, add 50 l, of sterile or deionized water.
Molecular Weight:
18.8 | 11.7 | kDa (due to terminal processing)
Not reactive in:
Chlamydomonas reinhardtii
Selected references:
To be added when available, antibody available in April 2023.
Ribosomal protein L4, chloroplastic, is one of the primary proteins involved in rRNA-binding, located in chloroplast. Alternative names: EMB2784, EMBRYO DEFECTIVE 2784, PLASTID RIBOSOMAL PROTEIN L4, PRPL4, RIBOSOMAL PROTEIN L4.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Cas9 (CRISPR-associated endonuclease 9) is an RNA-guided DNA endonuclease associated with the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) type II adaptive immunity system. CRISPR clusters are transcribed and processed into CRISPR RNA (crRNA). Cas9 protein serves as a genome engineering tool to induce site-directed double strand breaks in DNA. Alternative name: Csn1.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 4 C; Please remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Mouse
Species Reactivity:
Cas9 from Streptococcus pyogenes
Immunogen:
Recombinant protein part from the N-terminus of Cas9 from Streptococcus pyogenes.
Heat-shock protein 70 (Hsp70) is the major stress-inducible protein in vertebrates and is highly conserved throughout evolution. It plays a role as a molecular chaperone and is important for allowing cells to cope with acute stressor insult, especially those affecting the protein machinery. Heat shock cognate protein 70 (HSC70), is a highly conserved protein and a member of the family of molecular chaperones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 g/ l
Storage Temp:
Stable for at least one year at -20 °C. Avoid multiple freeze-thaw cycles, prepare aliquotes. Please, remember to spin a tube briefly prior opening them to avoid any loses that might occur from material adhering to the cap or sides of the tube.
Glutathion reductase (GR) is an enzyme responsible for maintaining of high levels of reduced glutathionein the cytosol.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Glutathione reductase isolated and purified from Saccharomyces cerevisiae, UniProt: P41921
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Glyceraldehyde-3-phosphate dehydrogenase is an enzyme of a first step of the pathway that synthesizes pyruvate from D-glyceradehyde 3-phosphate. Alternative name: GAPDH 3
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Glyceraldehyde-3-phosphate dehydrogenase isolated and purified from Saccharomyces cerevisiae, UniProt: P00359
Applications:
Dot blot (Dot), ELISA (ELISA), Immunocytochemistry (IHC), Western blot (WB)
Glyceraldehyde-3-phosphate dehydrogenase is an enzyme of a first step of the pathway that synthesizes pyruvate from D-glyceradehyde 3-phosphate. Alternative name: GAPDH 3
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Glyceraldehyde-3-phosphate dehydrogenase isolated and purified from Saccharomyces cerevisiae, UniProt: P00359
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Hexokinase is an enzyme which catalyzes the phosphorylation of hexose, such as D-glucose and D-fructose, to hexose 6-phosphate (D-glucose 6-phosphate and D-fructose 6-phosphate, respectively).Alternative names: Hexokinase PII, Hexokinase-B
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Hexokinase isolated and purified from Saccharomyces cerevisiae, UniProt: P04807
Hexokinase is an enzyme which catalyzes the phosphorylation of hexose, such as D-glucose and D-fructose, to hexose 6-phosphate (D-glucose 6-phosphate and D-fructose 6-phosphate, respectively).Alternative names: Hexokinase PII, Hexokinase-B
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Hexokinase isolated and purified from Saccharomyces cerevisiae, UniProt: P04807
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Alkaline phosphatase is an enzyme which is involved in dephosphorylation process. Found in periplasmic space in Escherichia coli. Alternative name: APase
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Alkaline phosphatase isolated and purified from Escherichia coli, UniProt: P00634
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Alkaline phosphatase is an enzyme which is involved in dephosphorylation process. Found in periplasmic space in Escherichia coli. Alternative name: APase
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Alkaline phosphatase isolated and purified from Escherichia coli, UniProt: P00634
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
3-Phosphoglyceric phosphokinase is an enzyme which generates ATP by catalysing the transfer of a phosphate group from 1,3-diphosphoglycerate to ADP, in glycolysis and gluconeogenesis.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
3-Phosphoglyceric phosphokinase isolated and purified from Saccharomyces cerevisiae
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
3-Phosphoglyceric phosphokinase is an enzyme which generates ATP by catalysing the transfer of a phosphate group from 1,3-diphosphoglycerate to ADP, in glycolysis and gluconeogenesis.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
3-Phosphoglyceric phosphokinase isolated and purified from Saccharomyces cerevisiae, UniProt: P00560
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Phosphoglucose isomerase, is a cytoplasmic enzyme, which catalyses the conversion of glucose-6-phosphate to fructose-6-phosphate, the second step in glycolysis, and the reverse reaction during gluconeogenesis. Alternative names: GPI , Phosphoglucose isomerase, PGI Phosphohexose isomerase, PHI
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Phosphoglucose isomerase isolated and purified from Saccharomyces cerevisiae, UniProt: P12709
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Phosphoglucose isomerase, is a cytoplasmic enzyme, which catalyses the conversion of glucose-6-phosphate to fructose-6-phosphate, the second step in glycolysis, and the reverse reaction during gluconeogenesis. Alternative names: GPI , Phosphoglucose isomerase, PGI Phosphohexose isomerase, PHI
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Phosphoglucose isomerase isolated and purified from Saccharomyces cerevisiae, UniProt: P12709
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Gluconate kinase is involved in the pathway D-gluconate degradation, which is part of carbohydrate acid metabolism.Alternative names: Gluconate kinase 2, Thermoresistant gluconokinase
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Gluconate kinase isolated and purified from Escherichia coli, UniProt: P46859
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Gluconate kinase is involved in the pathway D-gluconate degradation, which is part of carbohydrate acid metabolism.Alternative names: Gluconate kinase 2, Thermoresistant gluconokinase
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Gluconate kinase is isolated and purified from Escherichia coli, UniProt: P46859
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Ribonucleic acid polymerase DNA-dependent RNA polymerase (RNAP) catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. This subunit plays an important role in subunit assembly since its dimerization is the first step in the sequential assembly of subunits to form the holoenzyme.
Product Type:
Antibody
Antibody Type:
PolyclonalRibonucleic acid polymerase isolated and purified from Escherichia coli, Freund's complete adjuvant is used in the first step of the immunization procedure
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Ribonucleic acid polymerase isolated and purified from Escherichia coli, UniProt: P0A7Z4
Applications:
Dot blot (Dot), ELISA (ELISA),Immunocytochemistry (IHC), (ICC),Immunohistochemistry (paraffin), Western blot (WB)
Ribonucleic acid polymerase DNA-dependent RNA polymerase (RNAP) catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. This subunit plays an important role in subunit assembly since its dimerization is the first step in the sequential assembly of subunits to form the holoenzyme.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Ribonucleic acid polymerase isolated and purified from Escherichia coli, UniProt: P0A7Z4
Applications:
Indirect immunofluorescence (indirect IF)ELISA (ELISA),Dot blot (Dot),Western blot (WB)
Nuclease from Staphylococcus aureus is an enzyme secreted by these bacteria to degrade neutrophil extracellular trap of a host.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Staphylococcus aureus
Expected Species:
Species of your interest not listed?Contact us
Immunogen:
Nuclease isolated and purified from Staphylococcus aureus
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Nuclease from Staphylococcus aureus is an enzyme secreted by these bacteria to degrade neutrophil extracellular trap of a host.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Staphylococcus aureus
Expected Species:
Species of your interest not listed?Contact us
Immunogen:
Nuclease isolated and purified from Staphylococcus aureus
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF),Western blot (WB)
NADH-FMN oxidoredutase is an enzyme involved in riboflavin metabolism and often forms a two-component system with monooxygenases and displays a strong preference for NADH over NADPH. Alternative names: FMN reductase (NADH); NADH-FMN reductase; NADH-dependent FMN reductase; NADH:FMN oxidoreductase; NADH:flavin oxidoreductase
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Photobacterium fischeriSpecies of your interest not listed?Contact us.support@agrisera.com
Expected Species:
Species of your interest not listed?Contact us.support@agrisera.com
Immunogen:
NADH-FMN oxidoredutase isolated and purified from Photobacterium fischeri
Applications:
ELISA (ELISA), Dot blot (Dot), Indirect immunofluorescence (indirect IF), Western blot (WB)
Luciferase is an enzyme that catalyzes a light-emitting reaction and can be found in bacteria, algae, fungi, jellyfish, insects, shrimp, and squid, and the resulting light that these organisms produce is termed bioluminescence. Bacterial luciferase genes (luxA, luxB, luxC, luxD, and luxE), responsible for the light-emitting reaction (the lux genes) have been used in construction of bioreporters that emit a blue-green light with a maximum intensity at 490 nm.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Photobacterium fischeri
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Luciferase isolated and purified from Photobacterium fischeri
Applications:
ELISA (ELISA), Dot blot (Dot), Indirect immunofluorescence (indirect IF), Western blot (WB)
Luciferase is an enzyme that catalyzes a light-emitting reaction and can be found in bacteria, algae, fungi, jellyfish, insects, shrimp, and squid, and the resulting light that these organisms produce is termed bioluminescence. Bacterial luciferase genes (luxA, luxB, luxC, luxD, and luxE), responsible for the light-emitting reaction (the lux genes) have been used in construction of bioreporters that emit a blue-green light with a maximum intensity at 490 nm.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Photobacterium fischeri
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Luciferase isolated and purified from Photobacterium fischeri
Applications:
ELISA (ELISA),Dot blot (Dot), Indirect immunofluorescence (indirect IF), Western blot (WB)
c-Myc is derived from Myc proto-oncogene protein. The c-Myc protein is a transcription factor (nuclear localization). c-Myc is commonly activated in a variety of tumor cells and plays an important role in cellular proliferation, differentiation, apoptosis and cell cycle progression. A short peptide was used as an epitope tag, that is easily recognized by tag specific antibodies. This is a universal detection reagent which will allow detection of any c-Myc tag containing protein.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store in the dark at 2-8°C. Do not freeze. Avoid prolonged exposure to light. Do not use after expiration date stamped on vial label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
c-Myc tagged fusion proteins
Immunogen:
Conjugated synthetic peptide: AEEQKLISEEDLL derived from the C-terminal region of human c-Myc. UniProt: P01106
c-Myc is derived from Myc proto-oncogene protein. The c-Myc protein is a transcription factor (nuclear localization). c-Myc is commonly activated in a variety of tumor cells and plays an important role in cellular proliferation, differentiation, apoptosis and cell cycle progression. A short peptide was used as an epitope tag, that is easily recognized by tag specific antibodies. This is a universal detection reagent which will allow detection of any c-Myc tag containing protein.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store in the dark at 2-8°C. Do not freeze. Avoid prolonged exposure to light. Do not use after expiration date stamped on vial label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
c-Myc tagged fusion proteins
Immunogen:
Conjugated synthetic peptide: AEEQKLISEEDLL derived from the C-terminal region of human c-Myc. UniProt: P01106
Tubulin alpha (TUA) together with beta tubulin is making up microtubules. The microtubules are intracellular dynamic polymers made up of evolutionarily conserved polymorphic alpha/beta-tubulin heterodimers and a large number of microtubule-associated proteins (MAPs). The microtubules consist of 13 protofilaments and have an outer diameter 25 nm. Microtubules have their intrinsic polarity; highly dynamic plus ends and less dynamic minus ends. Microtubules are required for vital processes in eukaryotic cells including mitosis, meiosis, maintenance of cell shape and intracellular transport.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store in the dark at 2-8°C. Do not freeze. Avoid prolonged exposure to light. Do not use after expiration date stamped on vial label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
c-Myc is derived from Myc proto-oncogene protein. The c-Myc protein is a transcription factor (nuclear localization). c-Myc is commonly activated in a variety of tumor cells and plays an important role in cellular proliferation, differentiation, apoptosis and cell cycle progression. A short peptide was used as an epitope tag, that is easily recognized by tag specific antibodies. This is a universal detection reagent which will allow detection of any c-Myc tag containing protein.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on the label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
c-Myc tagged fusion proteins
Immunogen:
Conjugated synthetic peptide: AEEQKLISEEDLL derived from the C-terminal region of human c-Myc. UniProt: P01106
Applications:
Immunoprecipitation (IP), Immunohistochemisty (IHC), paraffin, Flow cytometry (Flowcyt), Western blot (WB)
Tubulin alpha (TUA) together with beta tubulin is making up microtubules. The microtubules are intracellular dynamic polymers made up of evolutionarily conserved polymorphic alpha/beta-tubulin heterodimers and a large number of microtubule-associated proteins (MAPs). The microtubules consist of 13 protofilaments and have an outer diameter 25 nm. Microtubules have their intrinsic polarity; highly dynamic plus ends and less dynamic minus ends. Microtubules are required for vital processes in eukaryotic cells including mitosis, meiosis, maintenance of cell shape and intracellular transport.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on the label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Dendra2 is an improved version of green-to-red photo switchable protein Dendra, from an octocoral (Dendronephthya) and compared to it, Dendra2 exhibits brighter fluorescence before and after photoswitching. Excitation maximum of Dendra2 is 490 nm before and 553 nm after photoactivation, and its emission maximum is 507 nm before and 573 nm after photoactivation. Activating light for Dendra2 is UV/violet to blue. Nonactivated Dendra2 spectral characteristics are similar to EGFP, and this green fluorescence can be detected at low light intensities of blue light. At high intensities of the same blue light (or of UV/violet light) Dendra2 is photoactivated and gets emission characteristics similar to TRITC.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on the label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Dendra2-tagged proteins
Immunogen:
Dendra2 tag protein
Applications:
Immunocytochemistry (ICC), Flow cytometry (FlowCyt) (QC tested), Western blot (WB)
Nitrotyrosine can be detected in proteins from a variety of tissues, usually in association with pathological conditions. Reaction of nitric oxide with superoxide produces peroxynitrite, which can undergo heterolytic cleavage into nitronium and hydroxyl ions. Nitration of tyrosine residues by nitronium ion forms nitrotyrosine groups in the respective proteins. Nitrotyrosine is thus a marker for inflammation-associated tissue damage.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on the label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Nitrotyrosine ,Nitrotyrosine
Immunogen:
NO2-Tyr-CH2-Thyroglobulin
Applications:
Immunohistochemistry (IHC) paraffin, Iimmunohistochemistry (IHC) frozen sections, Western blot (WB)
GST-tag (glutathione S-transferase) from a parasite Schistosoma japonicum is a tag added to a protein of interest as a fusion protein for protein purification and detection. It allows purification by affinity chromatography on immobilized glutathione. GST is utilized as a fusion protein with foreign proteins in a range of prokaryotic expression vectors, including the pGEX family of vectors. The tag is 220 amino acid long, ca. 26 kDa which makes it quite large compare to Myc or FLAG tags.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on the label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
To be added when available, antibody released in October 2021.
Special application note:
This antibody is recognizing native and denatured fusion proteins containing the GST-Tag sequence expressed in E. coli, yeast, mammalian, and in vitro transcription/translation systems. It can be also used for immuno purification of GST-tagged proteins.
c-Myc is derived from Myc proto-oncogene protein. The c-Myc protein is a transcription factor (nuclear localization). c-Myc is commonly activated in a variety of tumor cells and plays an important role in cellular proliferation, differentiation, apoptosis and cell cycle progression. A short peptide was used as an epitope tag, that is easily recognized by tag specific antibodies. This is a universal detection reagent which will allow detection of any c-Myc tag containing protein.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on the label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
c-Myc tagged fusion proteins
Immunogen:
Conjugated synthetic peptide: AEEQKLISEEDLL derived from the C-terminal region of human c-Myc. UniProt: P01106
Applications:
Flow cytometry (Flowcyt), Immunohistochemistry (IHC), paraffin, Immunoprecipitation (IP), Western blot (WB)
Mouse anti-DYKDDDDK is a primary antibody which binds to DYKDDDDK (Sigma FLAG ). The small size of this tag and its high hydrophilicity decrease the probability of interference with its expression, proteolytic maturation, antigenicity, localization and function.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on the label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
DYKDDDDK (Sigma FLAG ) epitope tag
Immunogen:
KLH-conjugated synthetic peptide: DYKDDDDK (Sigma FLAG )
Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on the label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Species independent
Immunogen:
BSA-conjugated phosphotyrosine
Applications:
Immunocyto chemistry (ICC), Flowcyt (FC), Western blot (WB)
Horseradish peroxidase removes hydrogen peroxide, acts in oxidation of toxic reductants, biosynthesis and degradation of lignin, response to environmental stresses such as wounding, pathogen attack and oxidative stress. HRP is also used as an epitope tag, for protein overexpression.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on the label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Immunocytochemistry: this was successfully used for staining of formaldehyde-fixed, Triton-permeabilized cells transfected with HRP gene
Application Details:
1 g/ml (WB)
Conjugation:
IgG1
Isotype:
IgG1
Purity:
Purified by precipitation and chromatography.
Selected references:
To be added when available. Antibody released in October 2021.
Special application note:
The antibody binds horseradish peroxidase, It is suitable for preparation of PAP (Peroxidase-Anti-Peroxidase soluble complexes), where three molecules of HRP are complexed with two molecules of anti-HRP antibodies
Beta-Galactosidase is an enzyme (EC:3.2.1.23) involved in hydrolysis of terminal non-reducing beta-D-galactose residues into beta-D-galactosides. The protein is encoded by lacZ gene.Alternative names: Beta-gal, Lactase, GalB
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on the label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Escherichia coli, GalB-tagged fusion proteins
Immunogen:
beta-Galactosidase purified from E. coli. UniProt: P00722
Actin is a highly conserved protein and an essential component of cell cytoskeleton and plays an important role in cytoplasmic streaming, cell shape determination, cell division, organelle movement and extension growth. Preferentially expressed in young and expanding tissues, floral organ primordia, developing seeds and emerging inflorescence.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
This is a key enzyme of plant metabolism catalyzing the first reaction in the biosynthesis from L-phenylalanine of a wide variety of natural products based on the phenylpropane skeleton.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Nicotiana benthamiana
Expected Species:
Arabidopsis thaliana, Hibiscus syriacus, Lotus corniculatus, Solanum dulcamara, Solanum lycopersicum,Vigna unguiculata, Species of your interest not listed? Contact us
Phosphinothricin N-acetyltransferase (BAR) is an enzyme is an effector of phosphinothricin tripeptide (PTT or bialaphos) resistance, herbicide resitance gene. BAR (BASTA) gene is used as a selectable marker for genetic transformation of plants.Alternative names: PPT N-acetyltransferase, Phosphinothricin-resistance protein.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
BAR (BASTA)
Expected Species:
Streptomyces viridochromogenesSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from position 36-50 of Phosphinothricin N-acetyltransferase (BAR or BASTA), UniProt: P16426
BAR (BASTA) gene is a selectable marker of plant genetic transformation, Nada (2016). Novel recombinant binary vectors harboring Basta (bar) gene as a plant selectable marker for genetic transformation of plants. Physiol Mol Biol Plants. 2016 Apr; 22(2): 241–251.
Application Details:
1 : 1000 (WB)
Purity:
Antigen affinity purified serum, in PBS pH 7.4
Reconstitution:
For reconstitution add 50 l, of sterile or deionized water.
Molecular Weight:
20.6 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
To be added when available, antibody available in May 2023.
Phosphinothricin N-acetyltransferase (BAR) is an enzyme is an effector of phosphinothricin tripeptide (PTT or bialaphos) resistance, herbicide resitance gene. BAR (BASTA) gene is used as a selectable marker for genetic transformation of plants.Alternative names: PPT N-acetyltransferase, Phosphinothricin-resistance protein.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
BAR (BASTA)
Expected Species:
Streptomyces viridochromogenesSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from position 170-183 of Phosphinothricin N-acetyltransferase (BAR or BASTA), UniProt: P16426
BAR (BASTA) gene is a selectable marker of plant genetic transformation, Nada (2016). Novel recombinant binary vectors harboring Basta (bar) gene as a plant selectable marker for genetic transformation of plants. Physiol Mol Biol Plants. 2016 Apr; 22(2): 241–251.
Application Details:
1 : 1000 - 1: 5000 (WB)
Purity:
Antigen affinity purified serum, in PBS pH 7.4
Reconstitution:
For reconstitution add 50 l, of sterile or deionized water.
Molecular Weight:
20.6 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
To be added when available, antibody available in May 2023.
PDLP1 (Plasmodesmata-located protein 1) mediates callose deposit during fungal infection and is required for systemic acquired resistance (SAR), mediated by azelaic acid (AzA), glycerol-3-phosphate (G3P), and salicylic acid (SA). Alternative names: PD-located protein 1,Cysteine-rich repeat secretory protein 56, Plasmodesmata localizing protein 1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Saccharomyces cerevisiae Rnr1 (EC=1.17.4.1) is an enzyme from ribonucleoside diphosphate reductase large chain family. Is localized to cytoplasm and provides precursors necessary for DNA synthesis. Alternative names: ribonucleotide reductase large subunit 1, ribonucleotide reductase R1 subunit 1
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Two KLH-conjugated synthetic peptides derived from c-terminal of Saccharomyces cerevisiae Rnr1 protein, sequence UniProt: P21524
HaloTag is derived from the haloalkane dehalogenase enzyme DhaA of Rhodococcus rhodochrous and can be incorporated to a protein of interest (POI) and facilitate cellular and biochemical analysis.. HaloTag is a trademark of Promega Corporation.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Recombinant proteins with HaloTag
Expected Species:
Recombinant proteins with HaloTag
Immunogen:
KLH-conjugated peptide derived from DhaA of Rhodococcus rhodochrous, so called HaloTag .
LEA (Late embryogenesis abundant) proteins are very hydrophilic proteins, described over 25 years ago as accumulating during late stages of plant seed development. Found in vegetative plant tissues following exposure to environmental stress.Synonymes: Putative late embryogenesis abundant protein LEA.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana (recombinant LEA6)
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana LEA6 protein sequences, UniProt: O64820, TAIR: At2g23110, UniProt: Q8S8R1 TAIR: AT2G23120 and UniProt: O23658, TAIR: AT2G33690
EGFP is an Energy-transfer acceptor. Its role is to transduce the blue chemiluminescence of the protein aequorin into green fluorescent light by energy transfer. Fluoresces in vivo upon receiving energy from the Ca(2+)-activated photoprotein aequorin. Contains a chromophore consisting of modified amino acid residues. The chromophore is formed by autocatalytic backbone condensation between Xaa-N and Gly-(N+2), and oxidation of Tyr-(N+1) to didehydrotyrosine. Maturation of the chromophore requires nothing other than molecular oxygen.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lypholized antibody at 4 °C. After reconstitution keep aliquots at -20 °C for a higher stability. Avoid repetitive freeze/thaw cycles. Centrifuge briefly to remove any insoluble material.Expiry date: 12 months after purchase if unopened
Host Animal:
Rabbit
Species Reactivity:
GFP, EGFP
Immunogen:
Recombinant GFP from Aequorea coerulescens (belt jellyfish) overexpressed and purified from E.coli, UniProt: Q6YGZ0
AKIN10 (E.C.= 2.7.11.1) is a catalytic subunit of the putative trimeric SNF1-related protein kinase (SnRK) complex, which may play a role in a signal transduction cascade regulating gene expression and carbohydrate metabolism in higher plants. Synonymes: AKIN alpha-2
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica oleracea, Brassica napus, Camelina sativa, Capsella rubella, Eutrema salsugineum, Raphanus sativusSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from C-terminal part of Arabidopsis thaliana AKIN10 sequence UniProt: Q38997, TAIR: At3g01090
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Nucleaoprotein (N) of Novel Coronavirus SARS-CoV-2/ 2019-nCoV (human) plays a fundamental role during virion assembly through packaging of the positive strand viral genome RNA into a helical ribonucleocapsid (RNP).Alternative names: NC, Protein N, Nucleocapsid protein
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80°C. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Human Nucleoprotein (N) of Novel Coronavirus SARS-CoV-2/ 2019-nCoV
Immunogen:
Recombinant Human Novel Coronavirus Nucleoprotein (N) (1-419aa), UniProt: P0DTC9
Affinity chrompatography purified in 10 mM PBS, pH 7.4, 50 % glycerol, 0.03% Proclin 300.
Molecular Weight:
48 | 55 kDa
Special application note:
This is a detection antibody, which can be combined with Capture antibody:AS21 4576 | Anti-Nucleoprotein (N) of Novel Coronavirus SARS-CoV-2/ 2019-nCoV (human), monoclonal antibodies and Positive control: AS20 4388 | Human Novel Coronavirus Nucleoprotein(N)
Nucleaoprotein (N) of Novel Coronavirus SARS-CoV-2/ 2019-nCoV (human) plays a fundamental role during virion assembly through packaging of the positive strand viral genome RNA into a helical ribonucleocapsid (RNP).Alternative names: NC, Protein N, Nucleocapsid protein
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80°C. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Human Nucleoprotein (N) of Novel Coronavirus SARS-CoV-2/ 2019-nCoV
Immunogen:
Recombinant Human Novel Coronavirus Nucleoprotein (N) (1-419aa), UniProt: P0DTC9
Affinity chrompatography purified in 10 mM PBS, pH 7.4, 50 % glycerol, 0.03% Proclin 300.
Molecular Weight:
48 | 55 kDa
Special application note:
This product is a capture antibody, which can be combined with Detection antibody: AS21 4577 | Anti-Nucleoprotein (N) of Novel Coronavirus SARS-CoV-2/ 2019-nCoV (human), monoclonal antibodiesand Positive control: AS20 4388 | Human Novel Coronavirus Nucleoprotein(N)
Based on IEP this antibody reacts with: F(ab')2 fragment of human IgG. Based on IEP no reactivity is observed to: Fc fragment of human IgGnon-immunoglobulin human serum proteinsserum proteins from bovine, horse and mouse
Application Details:
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified goat IgG.
Special application note:
Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 0.05 % (w/v) of sodium azide as preservative. It is a clear, colourless liquid, filter sterilized.Antibody purity ≥95% based on SDS-PAGE.
Based on IEP this antibody reacts with: F(ab')2 fragment of human IgG. Based on IEP no reactivity is observed to: non-immunoglobulin human serum proteinsFc fragment of human IgG
Application Details:
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified goat IgG.
Special application note:
Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 0.05 % (w/v) of sodium azide as preservative. It is a clear, colourless liquid, filter sterilized.Antibody purity ≥95% based on SDS-PAGE.
The Alzheimer amyloid precursor protein (APP) is a transmembrane protein whose abnormal processing is associated with the pathogenesis of Alzheimer’s disease. APP695 lacking the protease inhibitor domain is the predominant form in neuronal tissues. APP695 is cleaved by caspases into the 664-residue amino (N)-terminal fragment that lacks the carboxyl C-terminal 31-residues (APP delataC31) and the 31-residues C-terminal fragment (APP-C31). APP delta C31 potentially plays pathophysiological roles in neuronal death.
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Human, mouse, rat
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide corresponding to the C-terminal of the caspase 3-cleaved human APP (aa 658-664 of human APP695) UniProt: P05067
Applications:
ELISA (ELISA), Immunolocalisation (IL), Western blot (WB)
Nishimura et al (2003). Upregulation and antiapoptotic role of endogenous Alzheimer amyloid precursor protein in dorsal root ganglion neurons. Exp Cell Res. 2003 Jun 10;286(2):241-51. doi: 10.1016/s0014-4827(03)00066-1. PMID: 12749853.Nishimura et al. (2002) Cell death induced by a caspase-cleaved transmembrane fragment of the Alzheimer amyloid precursor protein. Cell Death Differ. 2002 Feb;9(2):199-208. doi: 10.1038/sj.cdd.4400931. PMID: 11840170.
The Alzheimer Amyloid Precursor Protein (APP) is a transmembrane protein whose abnormal processing is associated with the pathogenesis of Alzheimer’s disease. APP695 lacking the protease inhibitor domain is the predominant form in neuronal tissues. APP695 is cleaved by caspases into the 664-residue amino (N)-terminal fragment that lacks the carboxyl C-terminal 31-residues (APPC31) and the 31-residues C-terminal fragment (APP-C31). Both fragments might be potent inducers of neuronal apoptosis. An antibody (named ACT1) against the N-terminus of caspase 3-generated APP C-terminal 31 aa of human APP695 (APP-C31 ) was raised in rabbit.
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Human, Mouse, Rat
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Synthetic peptide corresponding to the N-terminal of human caspase 3-generated APP C-terminal 31 amino acids (aa 665-670) UniProt: P05067
Applications:
ELISA (ELISA), Immunolocalisation (IL), Western blot (WB)
Nishimura et al. (2002) Cell death induced by a caspase-cleaved transmembrane fragment of the Alzheimer amyloid precursor protein. Cell Death Differ. 2002 Feb;9(2):199-208. doi: 10.1038/sj.cdd.4400931. PMID: 11840170.
Caspases are a family of cysteine proteases which play essential roles in apoptosis. Among them, Caspase 3 is a frequently activated death protease, catalyzing the specific cleavage of many key cellular proteins. Caspase 3 is synthesized as an inactive 32 kDa pro-enzyme which undergo proteolytic processing in response to apoptotic stimulation to produce the active form which consists of the p20/p17, and p12 subunits. Caspase 3 is the predominant caspase involved in the cleavage of Alzheimer amyloid precursor protein (APP), which is associated with neuronal death in Alzheimer ‘s disease. An antibody (named ACP3) against activated caspase 3 was raised in rabbit. This antibody recognizes the active form of human caspase 3, p20/p17 subunit but does not recognize the proenzyme p32.
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Human, Mouse and Rat
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide corresponding to the human caspase 3 cleavage site, 6 aa (CGIETD) UniProt: P42574
Applications:
ELISA (ELISA), Immunolocalisation (IL), Western blot (WB)
The antibody does not react with the proenzyme p32
Application Details:
1: 500 - 1: 1000 (IL), 1:3000-1:1000 (WB)
Purity:
Serum. Contains 0.05 % sodium azide.
Molecular Weight:
31,6 | 17 and 19 kDa
Selected references:
Nishimura et al (2003). Upregulation and antiapoptotic role of endogenous Alzheimer amyloid precursor protein in dorsal root ganglion neurons. Exp Cell Res. 2003 Jun 10;286(2):241-51. doi: 10.1016/s0014-4827(03)00066-1. PMID: 12749853.Nishimura et al. (2002) Cell death induced by a caspase-cleaved transmembrane fragment of the Alzheimer amyloid precursor protein. Cell Death Differ. 2002 Feb;9(2):199-208. doi: 10.1038/sj.cdd.4400931. PMID: 11840170.
Glyoxalase I (GLO1) is an enzyme that plays a role in the detoxification of methylglyoxal (MG), a side-product of glycolysis, via condensation with glutathione to produce S-lactoyl-glutathione. GLO1 is a zinc metalloenzyme whose crystal structure has been solved. The bacterial and yeast enzymes are monomeric while the mammalian one is homodimeric and its sequence is well conserved. GLO1 is found over-expressed in some tumors. GLO1 has also been suggested to be involved in anxiety diseases, autism, and Alzheimer’s disease.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rat
Species Reactivity:
Human, simian, mouse
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Recombinant, full length mouse GLO1 UniProt: Q9CPU0 fused to GST
Applications:
ELISA (ELISA), Immunofluorescence (IF), Western blot (WB)
Jiang et al. (2018). Role of the Glyoxalase System in Alzheimer's Disease. J Alzheimers Dis. 2018;66(3):887-899. doi: 10.3233/JAD-180413. PMID: 30400091.Hovatta et al. (2005) Glyoxalase 1 and glutathione reductase 1 regulate anxiety in mice. Nature. 2005 Dec 1;438(7068):662-6. doi: 10.1038/nature04250. Epub 2005 Oct 23. PMID: 16244648.Junaid et al. (2004) Proteomic studies identified a single nucleotide polymorphism in glyoxalase I as autism susceptibility factor. Am J Med Genet A. 2004 Nov 15;131(1):11-7. doi: 10.1002/ajmg.a.30349. PMID: 15386471; PMCID: PMC1360505.
CALS12/PMR4 (Callose synthase 12) is involved in sporophytic and gametophytic development and required for normal leaf development and callose formation induced by wounding and pathogen attack. Alternative names: 1,3-beta-glucan synthase, Protein GLUCAN SYNTHASE-LIKE 5, Protein POWDERY MILDEW RESISTANT 4.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Capsella rubella, Camelina sativa, Eutrema salsugineum, Brassica napus, Brassica oleracea, Brassica rapa, Tarenaya hasslerianaSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana CALS12 protein sequence, UniProt: Q9ZT82 , TAIR: At4g03550
PhyB (Phytochrome B) is a Red/far-red photoreceptor involved in the regulation of de-etiolation. Protein exists in two inter-convertible forms: Pr and Pfr (active). Involved in the light-promotion of seed germination and in the shade avoidance response. Alternative names: Protein LONG HYPOCOTYL 3, Protein OUT OF PHASE 1, OOP1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Arabis alpina, Camelina sativa, Capsella rubella, Brassica napus, Brassica oleracea, Eutrema salsugineum, Raphanus sativusSpecies of your interest not listed? Contact us
DNA methylation is a type of chemical modification of DNA that can be inherited and subsequently removed without changing the original DNA sequence. Therefore it is part of the epigenetic code and is also the most well characterized epigenetic mechanism. DNA methylation results in addition of a methyl group to DNA — for example, to the number 5 carbon of the cytosine pyrimidine ring — which involves reduction in gene expression. In adult somatic tissues, DNA methylation typically occurs in a CpG dinucleotide context; non-CpG methylation is prevalent in embryonic stem cells.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
DNA methylation is a type of chemical modification of DNA that can be inherited and subsequently removed without changing the original DNA sequence. Therefore it is part of the epigenetic code and is also the most well characterized epigenetic mechanism. DNA methylation results in addition of a methyl group to DNA — for example, to the number 5 carbon of the cytosine pyrimidine ring — which involves reduction in gene expression. In adult somatic tissues, DNA methylation typically occurs in a CpG dinucleotide context; non-CpG methylation is prevalent in embryonic stem cells.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Purified IgM in PBS. Contains 50 % glycerol, filter sterilized.
Selected references:
Sharif et al. (2007) The SRA protein Np95 mediates epigenetic inheritance by recruiting Dnmt1 to methylated DNA. Nature. 2007 Dec 6;450(7171):908-12. doi: 10.1038/nature06397. Epub 2007 Nov 11. PMID: 17994007.Nishiyama et al. (2002) A chloroplast-resident DNA methyltransferase is responsible for hypermethylation of chloroplast genes in Chlamydomonas maternal gametes. Proc Natl Acad Sci U S A. 2002 Apr 30;99(9):5925-30. doi: 10.1073/pnas.082120199. PMID: 11983892; PMCID: PMC122878.Sano, Imokawa & Sager (1988) Detection of heavy methylation in human repetitive DNA subsets by a monoclonal antibody against 5-methylcytosine. Biochim Biophys Acta. 1988 Nov 10;951(1):157-65. doi: 10.1016/0167-4781(88)90036-x. PMID: 2847796.Sano, Royer & Sager (1980) Identification of 5-methylcytosine in DNA fragments immobilized on nitrocellulose paper. Proc Natl Acad Sci U S A. 1980 Jun;77(6):3581-5. doi: 10.1073/pnas.77.6.3581. PMID: 6251470; PMCID: PMC349661.
In the eukaryotic cells, DNA is packaged repetitively into nucleosomes by means of interactions among two molecules of four classes of histone, H2A, H2B, H3 and H4. Each of the histone proteins has an evolutionarily conserved amino-terminal ‘tail’ that protrudes from the nucleosome. This tail is the target of numerous diverse signaling pathways, resulting in the addition of many post-translational modifications. These modifications include phosphorylation, acetylation, methylation, ADP-ribosylation and mono-ubiquitination. Many important new modifications within the structured core and the carboxy-terminal tail regions of histones are also being identified. It is becoming increasingly clear that these modifications represent crucial regulatory events that govern the accessibility and function of the genome.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
ChIP method for this antibody is described in Maruyama et al. (2006).
Application Details:
1 : 1000 (WB)
Purity:
Serum. Contains 0.05 % sodium azide.
Molecular Weight:
13,8 | 17, 24-25 kDa (unmodified and mono-ubiquinated H2B)
Selected references:
Maruyama et al (2006). Histone H2B mutations in inner region affect ubiquitination, centromere function, silencing and chromosome segregation. EMBO J. 2006 Jun 7;25(11):2420-31. doi: 10.1038/sj.emboj.7601110. Epub 2006 May 11. PMID: 16688222; PMCID: PMC1478186.
Tubulin is the major constituent of microtubules. There are three members (alpha, beta and gamma) and two subtypes in the tubulin family. Of these members, beta tubulin (449 aa, 51 kDa) is found at microtubule organizing centers (MTOC) such as the spindle poles or the centrosome, suggesting that it is involved in the minus-end nucleation of microtubule assembly during cell cycle.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Schizosaccharomyces pombe
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated C-terminal peptide C-YEIEEEKEPLEY-OH from beta tubulin of Schizosaccharomyces pombe, UniProt: P05219
Applications:
ELISA (ELISA), Immunofluorescence (IF), Western blot (WB)
Immunogen affinity purified serum in PBS and 50 % glycerol, filter sterilized.
Molecular Weight:
51 | 45 kDa
Selected references:
Fedyanina et al. (2009) Tubulin heterodimers remain functional for one cell cycle after the inactivation of tubulin-folding cofactor D in fission yeast cells. Yeast. 2009 Apr;26(4):235-47. doi: 10.1002/yea.1663. PMID: 19330768; PMCID: PMC5705012.
Rad22 protein of Schizosaccharomyces pombe (469 aa, 52 kDa) is a functional and structural homologue of Saccharomyces cerevisiae and human Rad52 proteins, which play a major role together with Rhp51 in genetic recombination and recombination repair, by mediating strand annealing reaction between homologous DNA strands.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces pombe
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Purified, full length, recombinant Rad22 protein from Saccharomyces cerevisiae, UniProt: P36592 overexpressed in E. coli
Applications:
ELISA (ELISA), Immunofluorescence (IF), Immunoprecipiatation (IP), Western blot (WB)
Lehmann (1996). Molecular biology of DNA repair in the fission yeast Schizosaccharomyces pombe. Mutat Res. 1996 Aug 8;363(3):147-61. doi: 10.1016/0921-8777(96)00017-1. PMID: 8765156.
Rhp51 protein of Schizosaccharomyces pombe (fission yeast) is a functional and structural homolog of E.coli RecA protein and Rad51 proteins of eukaryotes, which play a major role in genetic recombination and recombination repair by mediating strand exchange reaction between homologous DNA strands.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces pombe
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Purified, full length, recombinant Rhp51 protein from Saccharomyces pombe, UniProt: P36601
Applications:
Chromatin immunoprecipitation (ChIP), Immunoprecipitation (IP),Immunofluorescence (IF), Western blot (WB)
Akamatsu et al. (2007) Fission yeast Swi5/Sfr1 and Rhp55/Rhp57 differentially regulate Rhp51-dependent recombination outcomes. EMBO J. 2007 Mar 7;26(5):1352-62. doi: 10.1038/sj.emboj.7601582. Epub 2007 Feb 15. PMID: 17304215; PMCID: PMC1817630.Lambert et al. (2005). Gross chromosomal rearrangements and elevated recombination at an inducible site-specific replication fork barrier. Cell. 2005 Jun 3;121(5):689-702. doi: 10.1016/j.cell.2005.03.022. PMID: 15935756. (Immunoflourescence)Akamatsu et al. (2003) Two different Swi5-containing protein complexes are involved in mating-type switching and recombination repair in fission yeast. Proc Natl Acad Sci U S A. 2003 Dec 23;100(26):15770-5. doi: 10.1073/pnas.2632890100. Epub 2003 Dec 8. PMID: 14663140; PMCID: PMC307643. (Immunoprecipitation, Western Blot)Kibe et al. (2003). Fission yeast Rhp51 is required for the maintenance of telomere structure in the absence of the Ku heterodimer. Nucleic Acids Res. 2003 Sep 1;31(17):5054-63. doi: 10.1093/nar/gkg718. PMID: 12930956; PMCID: PMC212814. (ChIP)
This protein is an auxiliary protein of DNA polymerase delta and is involved in the control of eukaryotic DNA replication by increasing the polymerase's accessibility during elongation of the leading strand. Involved in DNA repair and recombination.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C and avoid temperature below -25°C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Recombinant PCNA protein from Saccharomyces cerevisiae, UniProt: P15873
Applications:
Chromatin immunoprecipitation (ChIP), Inmunoprecipitation (IP), Western blot (WB)
Subunit of heterotrimeric Replication Protein A (RPA); RPA is a highly conserved single-stranded DNA binding protein complex involved in DNA replication, repair, recombination; RPA protects against inappropriate telomere recombination, and upon telomere uncapping, prevents cell proliferation by a checkpoint-independent pathway; with Sgs1p-Top2p-Rmi1p, stimulates DNA catenation/decatenation activity of Top3p; protein abundance increases in response to DNA replication stress.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Recombinant Rfa3 protein from Saccharomyces cerevisiae, UniProt: P26755
Rfa1 (Replication Factor A protein 1) as part of the replication protein A (RPA/RP-A), a single-stranded DNA-binding heterotrimeric complex, may play an essential role in DNA replication, recombination and repair. Binds and stabilizes single-stranded DNA intermediates, preventing complementary DNA reannealing and recruiting different proteins involved in DNA metabolism. Binds to single-stranded sequences participating in DNA replication in addition to those mediating transcriptional repression (URS1) and activation (CAR1). Stimulates the activity of a cognate strand exchange protein (SEP1). It cooperates with T-AG and DNA topoisomerase I to unwind template DNA containing the simian virus 40 origin of DNA replication.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Purified, recombinant Rfa1 protein (without a tag) from Saccharomyces cerevisiae, UniProt: P22336
S. cerevisiae Rad 51 protein (400 aa, 43 kDa) is a functional and structural homolog of E.coli RecA and human Rad51 proteins and plays a central role in DNA homologous recombination and recombination repair by promoting homologous DNA strand exchange reaction. Dmcl, Rad55, Rad57 are paralogs of Rad51 and they form complex with Rad51 and Rad52 in mediating recombination processes.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Purified, full length, recombinant and HIS tagged RAD51 protein from Saccharomyces cerevisiae, UniProt: P25454
Applications:
ELISA (ELISA), Chromatin immunoprecipitation (ChIP), Immunofluorescence (IF), Immunoprecipitation (IP), Western blot (WB)
Cyclobutane Pyrimidine Dimer photolyase (Deoxyribodipyrimidine photo-lyase) is involved in repair of UV radiation-induced DNA damage. Catalyzes the light-dependent monomerization (300-600 nm) of cyclobutyl pyrimidine dimers (in cis-syn configuration), which are formed between adjacent bases on the same DNA strand upon exposure to ultraviolet radiation. Upon absorption of visible light electrons are transferred from Trp-307 through Trp-360 to Trp 383, and from there to FADH, giving rise to the fully reduced catalytic FADH .
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Purified, full length, recombinant DNA photolyase protein from E.coli, UniProt: P00914
Applications:
ELISA (ELISA), Immunoprecipitation (IP), Western blot (WB)
E. coli DNA polymerase 1 (928 aa; 103 kDa) is encoded by polA gene and involved in DNA replication and repair. In addition to polymerase activity, this DNA polymerase exhibits 3' to 5' and 5' to 3' exonuclease activity. It is able to utilize nicked circular duplex DNA as a template and can unwind the parental DNA strand from its template.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Purified, full length, recombinant POL I protein from E.coli, UniProt: P00582
The products of umuD , umuC , and recA genes (SOS genes) are required for mutagenesis induced by radiation or chemical agents. Transcription of these SOS genes is repressed by a repressor, LexA protein in uninduced cells. Exposure of cells to DNA-damaging agents activates RecA protein to promote proteolytic cleavage of LexA protein. Inactivation of LexA protein by the cleavage consequently derepresses the SOS genes, umuD, C and recA . UmuD protein is then auto-cleaved, which is promoted by RecA protein ssDNA in a ATP-dependent manner. The processed UmuD protein is the active form for mutagenesis and the UmuD-UmuC complex functions as an error-prone translesion DNA polymerase.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C and make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Immunogen:
Highly purified, full length, recombinant UmuD protein from E.coli, UniProt: P0AG11
Shinagawa et al. (1998). RecA protein-dependent cleavage of UmuD protein and SOS mutagenesis. Proc Natl Acad Sci U S A. 1988 Mar;85(6):1806-10. doi: 10.1073/pnas.85.6.1806. PMID: 3126496; PMCID: PMC279868.
E. coli RuvC protein (19 kDa) is a structurally specific endonuclease which binds specifically to the Holliday structure, an intermediate of recombination, at the late stage of homologous recombination and recombination repair and introduces a nick in the symmetrical point of the Holliday junction cleaving and resolving the recombinant.
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at -20 °C or -80°Cfor a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
RuvC protein is full length, highly purified (over 95 %, SDS-PAGE), recombinant without a tag at a concentration of 1 mg/ml (determined by BCA method). UniProt: P0A814
Purity:
Contans 50% glycerol, 10 mM Tris-HCl (pH 7,5), 2 mM EDTA, 100 mM NaCl, 5 mM mercaptoethanol. Over 95 % pure by SDS-PAGE.
Molecular Weight:
18,7 | 19 kDa
Selected references:
Shinagawa & Iwasaki (1996). Processing the holliday junction in homologous recombination. Trends Biochem Sci. 1996 Mar;21(3):107-11. PMID: 8882584.Iwasaki et al. (1991) Escherichia coli RuvC protein is an endonuclease that resolves the Holliday structure. EMBO J. 1991 Dec;10(13):4381-9. PMID: 1661673; PMCID: PMC453191.
Special application note:
This product can be used in:in vitro functional studies. RuvC cleaves recombination intermediate at Holiday JunctionAs a positive control in Western blot and standard in ELISA.
E. coli RuvC protein is a structurally specific endonuclease which binds specifically to the Holliday structure, an intermediate of recombination, at the late stage of homologous recombination and recombination repair and introduces nicks at the symmetrical points of the Holliday junction, cleaving and resolving the recombinant.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 6 monthss, afterwards at -80 C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Immunogen:
Purified, full length, recombinant RuvC protein from E.coli, UniProt: P0A814
Ichiyanagi et al. (1998). Mutational analysis on structure-function relationship of a holliday junction specific endonuclease RuvC. Genes Cells. 1998 Sep;3(9):575-86. doi: 10.1046/j.1365-2443.1998.00213.x. PMID: 9813108.Shinagawa & Iwasaki (1996). Processing the holliday junction in homologous recombination. Trends Biochem Sci. 1996 Mar;21(3):107-11. PMID: 8882584.Saito et al (1995). Identification of four acidic amino acids that constitute the catalytic center of the RuvC Holliday junction resolvase. Proc Natl Acad Sci U S A. 1995 Aug 1;92(16):7470-4. doi: 10.1073/pnas.92.16.7470. PMID: 7638215; PMCID: PMC41361.
E. coli RuvB protein forms a complex with RuvA protein at the late stage of homologous recombination and recombination repair and binds specifically to the Holliday structure which is the intermediate of recombination, allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region.
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at -20 °C or -80°Cfor a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
RuvB protein is full length, highly purified (over 95 %, SDS-PAGE), recombinant. UniProt: P0A812
Purity:
Contans 50% glycerol, 10 mM Tris-HCl (pH 7,5), 2 mM EDTA, 100 mM NaCl, 5 mM mercaptoethanol. Over 95 % pure by SDS-PAGE.
Molecular Weight:
37 kDa
Selected references:
Mazina et al. (2012) Polarity and bypass of DNA heterology during branch migration of Holliday junctions by human RAD54, BLM, and RECQ1 proteins. J Biol Chem. 2012 Apr 6;287(15):11820-32. doi: 10.1074/jbc.M112.341347. Epub 2012 Feb 22. PMID: 22356911; PMCID: PMC3320930.Han et al. (2006). Direct observation of DNA rotation during branch migration of Holliday junction DNA by Escherichia coli RuvA-RuvB protein complex. Proc Natl Acad Sci U S A. 2006 Aug 1;103(31):11544-8. doi: 10.1073/pnas.0600753103. Epub 2006 Jul 24. PMID: 16864792; PMCID: PMC1544206.Iwasaki et al. (1992) Escherichia coli RuvA and RuvB proteins specifically interact with Holliday junctions and promote branch migration. Genes Dev. 1992 Nov;6(11):2214-20. doi: 10.1101/gad.6.11.2214. PMID: 1427081.
Special application note:
This product can be used in:in vitro functional studies. RuvA and RuvB are forming a complex that promotes Holiday junction ( a recombination intermediate) branch-migration by using ATP hydrolysis energy.As a positive control in Western blot and standar in ELISA.
RuvB protein of Escherichia coli forms a complex with RuvA protein and the complex promotes branch migration of Holliday junction at the late stage of homologous recombination and recombination repair. RuvB is a DNA motor protein which possesses the ATPase activity, activated by DNA and RuvA protein. RuvB in the absence of ATP, it predominantly occurs in a monomer form. In the presence of ATP, it forms dimer and hexamer depending upon the concentration. With RuvA and Holliday junction., it forms a double hexamer.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor up to 6 monthss, afterwards at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Immunogen:
Purified, full length, recombinant RuvB protein from E.coli, UniProt: P0A812
RuvA protein of Escherichia coli binds specifically to the Holliday structure which is the intermediate of recombination at the late stage of homologous recombination and recombination repair and forms a complex with RuvB motor protein allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region. In solution, it forms a tetramer and binds to the cross-like DNA of the Holliday junction from below and above holding it in between.
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at 4°Cor -20 °C for a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
RuvA protein is full length, highly purified (over 90 %, SDS-PAGE). UniProt: P0A809
Purity:
Contains 50% glycerol, 10 mM Tris-HCl (pH 7,5), 2 mM EDTA, 100 mM NaCl, 5 mM mercaptoethanol. Over 90 % pure by SDS-PAGE.
Molecular Weight:
22 kDa (monomer)
Selected references:
Han et al. (2006). Direct observation of DNA rotation during branch migration of Holliday junction DNA by Escherichia coli RuvA-RuvB protein complex. Proc Natl Acad Sci U S A. 2006 Aug 1;103(31):11544-8. doi: 10.1073/pnas.0600753103. Epub 2006 Jul 24. PMID: 16864792; PMCID: PMC1544206.Iwasaki et al. (1992) Escherichia coli RuvA and RuvB proteins specifically interact with Holliday junctions and promote branch migration. Genes Dev. 1992 Nov;6(11):2214-20. doi: 10.1101/gad.6.11.2214. PMID: 1427081.
Special application note:
This product can be used in functional studies as Holliday junction specific binding protein, which promotes Holliday-junction branch migration in combination with RuvB protein
RuvA protein of Escherichia coli binds specifically to the Holliday structure which is the intermediate of recombination at the late stage of homologous recombination and recombination repair, and forms a complex with RuvB motor protein, allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region. In solution, it forms a tetramer and binds to the cross-like DNA of the Holliday junction from below and above, holding it in between
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor up to 6 monthss, for longer storage-80°Cis recommended; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Immunogen:
Purified, full length RuvA protein of Escherichia coli, UniProt: P0A809
E. coli RecA protein is a very important enzyme for homologous recombination and recombinational repair. Its synthesis is induced by SOS response caused by DNA damage. RecA protein has multiple functions such as single stranded DNA dependent ATPase activity, DNA annealing activity, formation of D-loop and Holliday structure in homologous recombination reaction, and coprotease activities that promote self-cleavages of LexA repressor, lambda phage repressor and UmuD protein. RecA protein binds to single and double stranded DNA for nucleofilament formation. It carries out a central role in homologous recombination.
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at -20 °C or -80°Cfor a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
RecA protein is full length, highly purified (over 90 %, SDS-PAGE) by several steps of chromatography. Provided at a concentration of 1 mg/ml estimated by BCA method. UniProt: P0A7G6
Purity:
Contains 50% glycerol, 20 mM Tris-HCl (pH 8), 1 mM EDTA, 150 mM KCl, 1 mM DTT. Over 90 % pure, by SDS-PAGE
Molecular Weight:
38 kDa
Selected references:
Ishibashi, Oura S & Umemura (2017) Adsorption of DNA binding proteins to functionalized carbon nanotube surfaces with and without DNA wrapping. Eur Biophys J. 2017 Sep;46(6):541-547. doi: 10.1007/s00249-017-1200-3. Epub 2017 Feb 15. PMID: 28204854.Oura et al. (2015) Biomolecular recognition ability of RecA proteins for DNA on single-walled carbon nanotubes. Colloids Surf B Biointerfaces. 2015 Feb 1;126:496-501. doi: 10.1016/j.colsurfb.2015.01.002. Epub 2015 Jan 10. PMID: 25612818.
RecA (Recombinase A) plays critically important roles in homologous recombination, recombination repair and regulation of cellular responses to DNA damage (SOS response). RecA promotes auto-cleavage of LexA repressor by its coprotease activity after DNA damage, and induces many proteins related to DNA repair including RecA itself.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Immunogen:
Hihgly purified, full length (352 amino acids) RecA protein of E.coli, UniProt: P0A7G6
Applications:
ELISA (ELISA), Indirect immunofluorescent (IF), Immunoprecipitation (IP), Western blot (WB)
Escherichia coli LexA protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA). LexA‘s self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As a result, the expression of genes belonging to the S
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at -20 °C or -80°Cfor a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
LexA protein is full length, highly purified (over 90 %, SDS-PAGE) provided at a concentration of 1 mg/ml estimated by BCA method. UniProt: P0A7C2
Purity:
Contains 50% glycerol, 10 mM Tris-HCl (pH 7,5), 2 mM EDTA, 100 mM NaCl, 1 mM DTT. Over 90 % pure by SDS-PAGE.
Molecular Weight:
22,3 | 23 kDa
Special application note:
This product can be used in:Functional studies of E.coli SOS response. This product will bind to SOS box in vitro and repress the expression of the genes belonging to SOS regulationWestern blot as a positive control, to confirm that the bait construct is expressed in yeast two-hybrid sstem using lexA genecontrol in ChIP in combination with anti-LexA antibodies
LexA represor binds specifically to the SOS-box sequence and represses the genes belonging to the SOS regulation. In response to DNA damage, RecA protein is activated by ss-DNA accumulated in the damaged cells and promotes autocleavage of LexA repressor by its coprotease activity. As a result, DNA repair genes and error prone polymerases are induced, and DNA damage is repaired and mutation is induced (1). The lexA gene is used for yeast two-hybrid experiments as a bait to identify the protein-protein interaction in vivo.Alternative names: exrA, spr, tsl, umuA
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Hishida et al (2004) Role of the Escherichia coli RecQ DNA helicase in SOS signaling and genome stabilization at stalled replication forks. Genes Dev. 2004 Aug 1;18(15):1886-97. doi: 10.1101/gad.1223804. PMID: 15289460; PMCID: PMC517408.
Special application note:
This product can be used in:studies of SOS regulation in E.coli detection of bait constructs in yeast two-hybrid systemimmunolocalization of LexA fusion proteins (fixed with 4 % formaldehyde)immunoprecipiation and ChIP
Alternative oxidases (AOX) are quinol oxidases located in the inner mitochondrial membrane of plants. They function as terminal oxidases in the alternate electron transport pathway, oxidizing ubiquinone to reduce oxygen to water.
Product Type:
Antibody
Antibody Type:
Polyclonal
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from Arabidopsis thaliana AOX2 protein sequence, UniProt: O22049 , TAIR: At5g64210
Cat2 (Catalase 2) is an enzyme which occurs in almost all aerobically respiring organisms and serves to protect cells from the toxic effects of hydrogen peroxide.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
The anti-Myc tag is a primary antibody which is used to detect proteins containing the Myc epitope tag. The Myc tag contains the amino acid sequence EQKLISEEDL, corresponding to amino acids 410-419 of human Myc.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Myc epitope tag, fused to N- or C-terminal of proteins
Immunogen:
KLH-conjugated synthetic peptide: EQKLISEEDL (Myc tag), derived from UniProt: Q6LBK7
The two Arabidopsis POLLUX-like homologs PEC1 and PEC2 represent plastid envelope membrane cation channels with K + conductivity that are required for the stress triggered Ca 2+ release into the stroma.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Camelina sativa, Capsella rubella, Nicotiana benthamiana, Noccaea caerulescens, Pisum sativum, Raphanus sativus, Species of your interest not listed? Contact us
Immunogen:
The soluble domain 466 (M244 until stop codon, ≈ 64 kDa) was cloned into pET16b and transformed into BLR 21 for 467 expression in Escherichia coli UniProt: Q8VZM7-1, TAIR: At5g02940
V lkner et al (2021) Two plastid POLLUX ion channel-like proteins are required for stress-triggered stromal Ca2+release, Plant Physiology, Volume 187, Issue 4, December 2021, Pages 2110–2125, https://doi.org/10.1093/plphys/kiab424
Special application note:
This antibody is recognizing PEC1, but not PEC2 or DMI1
Strep-tag II is a synthetic peptide consisting of eight amino acids (Trp-Ser-His-Pro-Gln-Phe-Glu-Lys) and this peptide sequence shows high affinity towards Strep-Tactin , a specifically engineered streptavidin, and can be N- or C- terminally fused to recombinant proteins.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Strep-tag II-proteins
Immunogen:
KLH-conjugated synthetic peptide Strep-tag II epitope tag, sequence: ASWSHPQFEKGA
mNeonGreen (Fluorescent Protein) is a new bright monomertic yellow-green fluorescent, with low conservation level to GFP. It has an excitation maximum at 506 nm and an emission maximum at 517 nm and therefore is compatible with the most GFP filter sets. mNeonGreen is 3x brighter compare to GFP, more stable and does not bleach so fast as GFP, which makes it very suitable for confocal and super resolution microscopy, for fusion proteins with low expression levels. It can be used in bicistronic vectors, which will allow simultaneous expression of two proteins separately, from the same RNA transcript. mNeonGreen has MW of 26.6 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
mNG tag in plant (Arabidopsis thaliana) and algal vectors (Chlamydomonas reinhardtii)
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from synthetic peptide, UniProt: A0A1S4NYF2 from common lancelet Branchiostoma lanceolatum
This antibody is detecting protein sequence of mNG tag in plant and algal vectors.This antibody is also reacting to some degree with YFP and mCherry.
Application Details:
1 g/1ml (IF), 1 : 1000 - 1: 5000 (WB)
Purity:
Immunogen affinity purified serum, in PBS pH 7.4.
Reconstitution:
For reconstitution add 50 l, of sterile water.
Molecular Weight:
Depends upon used fusion partner
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known.
Selected references:
To be added when available, antibody available in November 2021.
Special application note:
The peptide used to elicit this antibody is conserved in the following expression vectors: dCas9-P2A-DHFR(TSc3)-T2A-mNeonGreen [Cloning vector pBM020]Cas9-P2A-DHFR(TSc3)-T2A-mNeonGreen [Cloning vector pBM006]mNeonGreen4-tDeg [Cloning vector pminiCMV-mNeonGreen4-tDeg]ER-localized mNEONGREEN [Binary vector pKT-NM-erNEON]mNeonGreen-3xFLAG [Cloning vector pLM160-mNeonGreen]mNeonGreen-ty1 [Cloning vector pSAG1-mNeonGreen_TUB1-dTomato]mNeonGreen, partial [Binary vector pRATIO2131]The peptide used to elicit this antibody is not conserved in GFP protein sequence. Antibody is also recognzing mCheery sequence.
HSP23.5 (Heat shock protein 23.5 (mitochondrial) is involved in plant heat shock response.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
MnSOD3 (Superoxide dismutase) is an chloroplastic enzyme which destroys radicals which are normally produced within the cells and which are toxic to biological systems. It is induced under Fe limitation, Mn Deficiency, and H2O2 stress as shown by Page et al. (2012).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii
Expected Species:
green algaeSpecies of your interest not listed? Contact us
Immunogen:
Recombinant MnSOD3 of Chlamydomonas reinhardtii, product of a MSD3 gene Cre16.g676150; Phytozome
Specific extraction method requires to be applied, check as published in Page et al. (2012).MnSOD3 can be only detected in Fe-limited cells (0.5 or 0.2 mM added Fe) (i.e., samples exhibiting the novel MnSOD activity) but not in cells grown with higher concentrations of added Fe.
Application Details:
1: 1000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
32 | 35 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Page et al. (2012) Fe sparing and Fe recycling contribute to increased superoxide dismutase capacity in iron-starved Chlamydomonas reinhardtii. Plant Cell. 2012 Jun;24(6):2649-65. doi: 10.1105/tpc.112.098962. Epub 2012 Jun 8. PMID: 22685165; PMCID: PMC3406916.
VSP (Vegetative storage protein 1) may function as somatic storage protein during early seedling development. Expression of VSP1 is enhanced by wounding and protein is localized to vacuole.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Full length, purified recombinant His6-tagged VSP1 of Arabidopsis thaliana UniProt: O49195, TAIR: At5g24780
Reactivity of this antibody to VSP2 has not been determined, Sequence conservation of VSP1 and VSP2 is 86 % therefore, it is most likely that this antibody will also recognize VSP2,
Application Details:
1: 1000 - 1: 2000 (WB)
Purity:
Total IgG, purified on Protein A in PBS, 50 % glycerol, filter sterilized.
Molecular Weight:
28 | 27 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Matsushima et al. (2002). An endoplasmic reticulum-derived structure that is induced under stress conditions in Arabidopsis.Plant Physiol. 2002 Dec;130(4):1807-14. doi: 10.1104/pp.009464.
Arabidopsis thaliana auxin efflux carrier component AtPIN2 encoded by the AtPIN2 gene (also known as EIR1 and AGR1). AtPIN proteins are asymmetrically localized within plant plasma membranes and mediate polar auxin transport. AtPIN2 is a key regulator of the response of Arabidopsis roots to gravity. Alternative names: Auxin efflux carrier AGR, Ethylene-insensitive root 1, AtEIR1, Polar-auxin-transport efflux component AGR1, Protein AGRAVITROPIC 1, AtAGR1, Protein WAVY 6.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Beta vulgaris, Brassica napus, Camelina sativa, Cannabis sativa, Capsella rubella, Cucumis melo, Eucalyptus grandis, Eutrema salsugineum, Glycine max, Malus domestica, Morus notabilis, Prunus dulcis, Raphanus sativus, Spinacia oleracea, Vitis vinifera Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated mixture of two synthetic peptides derived from AtPIN2 sequence, UniProt:Q9LU77, TAIR:At5g57090
Beta-galactosidase is an exoglycosidase which hydrolyzes the β-glycosidic bond formed between agalactose and its organic moiety. It may also cleave fucosides and arabinosides but with much lower efficiency. It is an essential enzyme in the human body. Deficiencies in the protein can result ingalactosialidosis or Morquio B syndrome. In E. coli , the gene of β-galactosidase, the lacZ gene, is present as part of the inducible system lac operon which is activated in the presence of lactose when glucose level is low. It is commonly used in molecular biology as a reporter marker to monitor gene expression. It also exhibits a phenomenon called α-complementation which forms the basis for the blue/white screening of recombinant clones. This enzyme can be split in two peptides, LacZα and LacZΩ, neither of which is active by itself but when both are present together, spontaneously reassemble into a functional enzyme. This property is exploited in many cloning vectors where the presence of the lacZα gene in a plasmid can complement in trans another mutant gene encoding the LacZΩ in specific laboratory strains of E. coli . However, when DNA fragments are inserted in the vector, the production of LacZα is disrupted, the cells therefore show no β-galactosidase activity. The presence or absence of an active β-galactosidase may be detected by X-gal, which produces a characteristic blue dye when cleaved by β-galactosidase, thereby providing an easy means of distinguishing the presence or absence of cloned product in a plasmid. E. coli β-Galactosidase consists of 1,024 amino acids with molecular mass of 116 kDa and functional form is a homotetramer.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C, Avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube. , Do not store this antibody below -20 °C
Host Animal:
Rabbit
Species Reactivity:
Beta galactosidase (E.coli) and beta galactosidase tagged proteins
Immunogen:
Full length Beta galactosidase from E.coli UniProt: B7UJI9
Applications:
ELISA (ELISA), Immunofluorescence (IF), Immunoprecipitation (IP), Western blot (WB)
GST (Glutathione S-Transferase) is a 26kDa protein encoded by the parasitic helminth Schistosoma japonicum and widely used in the pGEX family of GST plasmid expression vectors as a fusion protein with foreign proteins.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at -20 °C, Avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
GST-tagged recombinant proteins
Immunogen:
Recombinant GST of Schistosoma japonicum UniProt: P08515
Applications:
Immunofluorescence (IF), Immunoprecipitation (IP), Western blot (WB)
GST-tag (glutathione S-transferase) is a tag added to N-terminus of a protein of interest as a fusion protein to unable purification and detection. The tag is 220 amino acid long, ca. 26 kDa which makes it quite large compare to Myc or FLAG tags.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
GST-tag
Immunogen:
Recombinant, full size GST, amino acids 1-212, NCBI: AAA57089
Applications:
ELISA (ELISA), Immunoprecipitation (IP), Western blot (WB)
GFP (Green fluorescent protein) was originally identified in photo organs on jellyfish Aequorea victoria. It is a naturally fluorescent protein which emits green light at a maximum wavelength of 509 nm when excited by blue or UV light. It is extensively used in laboratory as a reporter molecule to label and study cellular and subcellular proteins in living cells using a wide range of applications. Antibodies to GFP protein are used in immunoblotting and ELISA. GFP protein has molecular weight of 27 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
EGFP, S65T-GFP, RS-GFP, YFP
Immunogen:
Recombinant, His-tagged EGFP protein from Aequorea victoria, UniProt: P42212
Applications:
Immunofluorescence (IF), Immunoprecipitation (IP), Western blot (WB)
Tatsumi et al. (2017). G196 epitope tag system: a novel monoclonal antibody, G196,recognizes the small, soluble peptide DLVPR with high affinity. Sci Rep. 2017 Mar 7;7:43480.doi: 10.1038/srep43480. (Immunofluorescence, Western blot)
GFP (Green fluorescent protein) was originally identified in photo organs on jellyfish Aequorea victoria. It is a naturally fluorescent protein which emits green light at a maximum wavelength of 509 nm when excited by blue or UV light. It is extensively used in laboratory as a reporter molecule to label and study cellular and subcellular proteins in living cells using a wide range of applications. Antibodies to GFP protein are used in immunoblotting and ELISA. GFP protein has molecular weight of 27 kDa.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid, 1mg/ml.
Storage Temp:
Store at -20 °C, Avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rat
Species Reactivity:
Native GFP, Recombinant GFP (E,coli), all variants of GFP, including EGFP
Immunogen:
Recombinant GFP protein from Aequorea victoria, UniProt: P42212
Applications:
Chromatin immunoprecipitation (ChIP), ELISA (ELISA), Immunofluorescence (IF), Immunoprecipitation (IP), Western blot (WB)
Immunoglobulin Protein A purified in PBS, 50 % glycerol, filter sterilized.
Selected references:
Maehara et al. (2015). issue-specific expression of histone H3 variants diversified after species separation. Epigenetics Chromatin. 2015 Sep 17;8:35. doi: 10.1186/s13072-015-0027-3. (ChIP)Okazaki et al. (2012). Nuclear localization signal in a cancer-related transcriptional regulator protein NAC1. Carcinogenesis. 2012 Oct;33(10):1854-62.doi: 10.1093/carcin/bgs193. (Immunoprecipiation)
Actin-related proteins (ARPs) are found in the nuclei of all eukaryotic cells, but their functions are generally understood only in the context of their presence in various yeast and animal chromatin-modifying complexes. Arabidopsis ARP8 shows 30 and 29% amino acid identity to yeast actin and Arabidopsis ACT2 in the regions of alignment, respectively. Because it is not closely related to yeast or human ARP8 and shows similar weak homology to yeast ARP8 and ARP9, the Arabidopsis ARP8 is considered a plant-specific orphan ARP.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -80 C; Avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Antibody is recognizing following epitope, amino acids 447-471: SNLSIFPGPWCITRKQFRRKSRLMWThis antibody is recognizing the full-length 52 kDa recombinant ARP8 protein expressed in Escherichia coli as well as endogenous ARP8 of identical molecular weight in Arabidopsis thaliana extracts from different tissues: all vegetative and reproductive organs examined including seedlings, roots and siliques, with higher concentrations of the protein detected in developing flower buds and flowers within the inflorescence.
Application Details:
assay dependent
Conjugation:
IgG1
Isotype:
IgG1
Purity:
Cell culture supernatant
Molecular Weight:
52 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Kandasamy et al. (2008). ACTIN-RELATED PROTEIN8 encodes an F-box protein localized to the nucleolus in Arabidopsis. Plant Cell Physiol. 49(5):858-63. doi: 10.1093/pcp/pcn053.
Actin-related proteins (ARPs) are found in the nuclei of all eukaryotic cells, but their functions are generally understood only in the context of their presence in various yeast and animal chromatin-modifying complexes. Arabidopsis ARP8 shows 30 and 29% amino acid identity to yeast actin and Arabidopsis ACT2 in the regions of alignment, respectively. Because it is not closely related to yeast or human ARP8 and shows similar weak homology to yeast ARP8 and ARP9, the Arabidopsis ARP8 is considered a plant-specific orphan ARP.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -80 C; Avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica rapa, Camelina sativa, Capsella rubella, Eutrema salsugineum, Raphanus sativusSpecies of your interest not listed? Contact us
Antibody is recognizing following epitope, amino acids 2-26: aa 2-ILKKVWG SVWNRSNSGKDLVNHQRA-26 This antibody is recognizing the full-length 52 kDa recombinant ARP8 protein expressed in Escherichia coli as well as endogenous ARP8 of identical molecular weight in Arabidopsis thaliana extracts from different tissues: all vegetative and reproductive organs examined including seedlings, roots and siliques, with higher concentrations of the protein detected in developing flower buds and flowers within the inflorescence.
Application Details:
assay dependent
Conjugation:
IgG1
Isotype:
IgG1
Purity:
Cell culture supernatant
Molecular Weight:
52 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Kandasamy et al. (2008). ACTIN-RELATED PROTEIN8 encodes an F-box protein localized to the nucleolus in Arabidopsis. Plant Cell Physiol. 49(5):858-63. doi: 10.1093/pcp/pcn053.
Actin-related proteins (ARPs) are found in the nuclei of all eukaryotic cells, but their functions are generally understood only in the context of their presence in various yeast and animal chromatin-modifying complexes. Arabidopsis thaliana ARP6 is a clear homolog of other eukaryotic ARP6s, including Saccharomyces cerevisiae ARP6, which was identified as a component of the SWR1 chromatin remodeling complex. Arabidopsis ARP6 is localized to the nucleus during interphase but dispersed away from the chromosomes during cell division. ARP6 expression was observed in all vegetative tissues as well as in a subset of reproductive tissues. Null mutations in ARP6 caused numerous defects, including altered development of the leaf, inflorescence, and flower as well as reduced female fertility and early flowering in both long- and short-day photoperiods.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -80 C; Avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Arabidopsis thaliana
Immunogen:
ARP6 of Arabidopsis thaliana, UniProt: Q8LGE3, TAIR: At3g33520
Applications:
ELISA (ELISA), Immunoflourescence (IF), Western blot (WB)
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Deal et al. (2005). The nuclear actin-related protein ARP6 is a pleiotropic developmental regulator required for the maintenance of FLOWERING LOCUS C expression and repression of flowering in Arabidopsis. Plant Cell Oct;17(10):2633-46. doi:10.1105/tpc.105.035196.
Phytochrome is a photomorphogenically active pigment that modulates plant growth and development with respect to incident light intensity and wavelength distribution. It exists in two forms: an inactive, red-absorbing form (Pr),4 and an active far-red-absorbing form (Pfr). When either absorbs light, it is photoconverted to the other. Phytochrome is a dimeric, water-soluble, relatively labile chromoprotein with similar, if not identical, monomers of about 124 kDa each. It is also a relatively low abundance protein, even under the best of conditions. Genetic manipulation of phytochrome expression in plants leads to plants requiring less light and able to divert more energy to the production of fruits and seeds. For its physicochemical characterization, it has therefore been difficult to utilize techniques that require large quantitites of highly purified protein. Consequently, indirect methods for elucidating its structure/function relationships are especially important. These could also be applicable to fabaceae and closely related families.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -80 C; Avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Avena sativa, Pisum sativum
Expected Species:
graminae, fabaceaeSpecies of your interest not listed? Contact us
Immunogen:
Phytochrome
Applications:
ELISA (ELISA), Competitive ELISA, Immunoflourescence (IF), Immunoprecipiation (IP), Western blot (WB)
Epitope for this antibody is located at 36 kDa from N-terminus and very near the site of chromophore attachment
Application Details:
assay dependent
Purity:
Cell culture supernatant
Molecular Weight:
124 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Pratt et al. (1988). Mapping of antigenic domains on phytochrome from etiolated Avena sativa L. by immunoblot analysis of proteolytically derived peptides. Arch Biochem Biophys. 267(2):723-35. doi: 10.1016/0003-9861(88)90081-1.Cordonnier et al. (1983). Production and purification of monoclonal antibodies to Pisum and Avena phytochrome. Planta. 158(4):369-76. doi: 10.1007/BF00397340.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Pattathil et al. (2015). Insights into plant cell wall structure, architecture, and integrity using glycome profiling of native and AFEXTM-pre-treated biomass. J Exp Bot. Jul;66(14):4279-94.doi: 10.1093/jxb/erv107.
Mannan is one of the major constituent groups of hemicellulose in the wall of higher plants. It comprises linear or branched polymers derived from sugars such as D-mannose, D-galactose, and D-glucose.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
Host Animal:
Mouse
Species Reactivity:
gum and acetylated mannan from Lycopersicum esculentum
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Pattathil et al. (2015). Insights into plant cell wall structure, architecture, and integrity using glycome profiling of native and AFEXTM-pre-treated biomass. J Exp Bot. Jul;66(14):4279-94.doi: 10.1093/jxb/erv107.
Xyloglucan is a hemiceullose or polysaccharide that is found in the primary cell wall of all vascular plants. Xyloglucan binds to the surface of cellulose microfibrils and may link them together.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
The reactivity of the antiserum is directed to the subclass IgG2a. It reacts with IgG2a of the allelic types Igh-1a and Igh-1b, which include BALB/C, C57Bl, CBA/J, SJL/J and SM/J. hen used for the identification of IgG2a in other mouse strains the reaction may be weaker. The immunoconjugate contains antibodies to iso and allospecific determinants. It does not react with other subclasses of IgG, IgG/Fab fragments, IgM and IgA or any non-Ig protein in mouse serum, as tested by immunoelectrophoresis and double radial immunodiffusion.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
The lyophilized conjugate is shipped at ambient temperature and may be stored at 4 C; prolonged storage at or below -20 °C. It is reconstituted by adding 1 ml sterile distilled water, spun down to remove insoluble particles, divided into small aliquots, frozen and stored at or below -20 °C. Prior to use, an aliquot is thawed slowly at ambient temperature, spun down again and used to prepare working dilutions by adding sterile phosphate buffered saline (PBS, pH 7,2). Repeated thawing and freezing should be avoided. Working dilutions should be stored at 4 C, not refrozen, and preferably used the same day. If a slight precipitation occurs upon storage, this should be removed by centrifugation. It will not affect the performance of the immunoconjugate. Lyophilized at +4 C--at least 10 years. Reconstituted at or below -20 C--3-5 years. Reconstituted at +4 C--7 days.
Host Animal:
Goat
Species Reactivity:
Mouse IgG2a
Immunogen:
Pools of purified homogenous IgG2a isolated from pooled mouse sera belonging to the allelic types Igh- 1a and Igh-1b, Freund's complete adjuvant is used in the first step of the immunization procedure,
Applications:
Dot blot (Dot), ELISA (ELISA), Immunohistochemistry (paraffin) (IHC), Western blot (WB)
This immunoconjugate is not species-specific since inter-species cross-reactivity is a normal feature of antisera to immunoglobulins, However this conjugate has been passed over appropriate immuno-adsorbents to remove antibodies cross-reacting with Human immunoglobulins, This renders it specific for use in test systems containing material of Human origin (e,g, Human tissue/Mouse monoclonal antibody to a Human tissue constituent/anti Mouse Ig isotype-specific immunoconjugate
For reconstitution add 1 ml of sterile water, Let it stand for 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
This immunoconjugate is not species-specific since inter-species cross-reactivity is a normal feature of antisera to immunoglobulins, However this conjugate has been passed over appropriate immunoadsorbents to remove antibodies cross-reacting with Human immunoglobulins, This renders it specific for use in test systems containing material of Human origin (e,g, Human tissue/Mouse monoclonal antibody to a Human tissue constituent/anti Mouse Ig isotype-specific immunoconjugate
Phosphorylation is a post-translational modification of proteins in which a phosphate group is covalently bound to a serine, threonine or a thyrosine residue by a protein kinase. Phosphorylation of a protein can result in activation or inhibition of a proteins function and is thereby a regulatory mechanisms of protein activation.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at 2-8 C; add sodium azide to 0,05% for porlonged storage, Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Immunoglobulin Protein A purified in a 10 mM ammonium bicarbonate buffer, with 2 mg of BSA.
Reconstitution:
Recommended antibody concentration: 0.5 mg/ml (when dissolved at 0.5 mg/ml, the BSA concentration will be 1%). Recommended to dissolve in; 100 mM PBS or Tris-HCl, pH 7.0 Additional sodium azide ( up to 0.05%) is recommended for long term storage. For a 0.5 mg/ml antibody concentration in 1% BSA, dissolve in 200 μl buffer.
Fluorescent proteins, like BFP, can be used as protein "tags" to study the subcellular localization of proteins and/or their translocation upon stimulation and/or as markers for transfections in transient and stable expression systems.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at 2-8 C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
BFP
Immunogen:
Recombinant EBFP (NCBI accession number AX_766758 REGION: 1-717, expression vector pGEX-1N), expressed in E.coli.
Immunoglobulin Protein A purified in a 10 mM ammonium bicarbonate buffer, with 2 mg of BSA.
Reconstitution:
Recommended antibody concentration: 0.5 mg/ml (when dissolved at 0.5 mg/ml, the BSA concentration will be 1%). Recommended solvent; 100 mM PBS or Tris-HCl, pH 7.0 •Additional sodium azide ( up to 0.05%) is recommended for long term storage. •For a 0.5 mg/ml antibody concentration in 1% BSA, dissolve in 200 μl buffer.
Fluorescent proteins, like EBFP, can be used as protein "tags" to study the subcellular localization of proteins and/or their translocation upon stimulation and/or as markers for transfections in transient and stable expression systems.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at 2-8 C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
BFP, GFP, YFP
Immunogen:
Recombinant EBFP (NCBI accession number AX_766758 REGION: 1-717, expression vector pGEX-1N), expressed in E.coli.
Immunoglobulin Protein A purified in a 10 mM ammonium bicarbonate buffer, with 2 mg of BSA.
Reconstitution:
Recommended antibody concentration: 0.5 mg/ml (when dissolved at 0.5 mg/ml, the BSA concentration will be 1%). Recommended solvent; 100 mM PBS or Tris-HCl, pH 7.0 •Additional sodium azide ( up to 0.05%) is recommended for long term storage. •For a 0.5 mg/ml antibody concentration in 1% BSA, dissolve in 200 μl buffer.
Tubulin beta (TUB) together with alpha tubulin is making up microtubules.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 4 C; Do not freeze. Do not exceed exipry date is provided on the tube. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
human, mouse, pig
Expected Species:
Plants Species of your interest not listed? Contact us
Immunogen:
Beta-tubulin purified from porcine brain, UniProt: Q9H4B7
Applications:
Immunocytochemistry (ICC), Immunohistochemistry on frozen sections (IHC), Western blot (WB)
This antibody is recognizing N-terminal structural domain of beta tubulin.Recommended secondary antibody for Western blot is: goat anti mouse IgM AS16 3497Metal induced stress affected the expression of tubulin alpha and gamma, and that therefore, these proteins cannot be used as a loading control under that type of conditions. More information can be found here.
Application Details:
2-8 g/ml (ICC), 1 g/ml (WB)
Conjugation:
IgM
Isotype:
IgM
Purity:
Purified by precipitation and affinitychromatography in TBS. Contains 15 mM sodium azide.
Molecular Weight:
50,3 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Tubulin alpha (TUA) together with beta tubulin is making up microtubules.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 4 C; Do not freeze. Do not exceed exipry date is provided on the tube. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
This antibody is recognizing defined epitope (amino acid 65-97) on N-terminal structural domain of alpha tubulin.Recommended secondary antibody, goat anti-mouse IgG1, HRP conjugated AS16 3715
Application Details:
1 : 500 (ICC), 1-4 g/ml /FlowCyt), 1-4 g/ml (WB)
Conjugation:
IgG1
Isotype:
IgG1
Purity:
Immunoglobulin Protein A purified in PBS. Contain 15 mM sodium azide.
Molecular Weight:
51 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Liu et al. (2022) Identification of positive and negative regulators of antiviral RNA interference in Arabidopsis thaliana. Nat Commun. 2022 May 30;13(1):2994. doi: 10.1038/s41467-022-30771-0. PMID: 35637208; PMCID: PMC9151786.
Special application note:
Metal induced stress affected the expression of tubulin, and that therefore, this protein cannot be used as a loading control under that type of conditions, data in application example,
Tubulin gamma chain is essential for the control of microtubular network. It is found at microtubule organizing centers (MTOC) such as the spindle poles
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 4 C; Do not freeze. Do not exceed exipry date is provided on the tube. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
KLH-conjugated gamma-tubulin peptide EYHAATRPDYISWGTQ, amino acids 434-449. UniProt: P23258The epitope was located in the aminoacid sequence PDYISW (aa441-446 in human), which is identical for gamma-tubulin 1 and gamma-tubulin 2.
This antibody recognizes C-terminus (amino acids 434-449 in human) of gamma-tubulin, a 48 kDa structural constituent of cytoskeleton and microtubule organizing center (MTOC). The epitope which this antibody is recognizing is conserved in Arabidopsis thaliana Tubulin gamma-1 chain, UniProt: P38557, Gene ID: At3g61650 and Tubulin gamma-2 chain, UniProt: P38558, Gene ID: At5g05620Recommended secondary antibody: goat anti-mouse IgG1 AS16 3715
LUC (Luciferase) from Photinus pyralis (Common eastern firefly) (Lampyris pyralis), light producing beetle is an enzyme in the light production. Luciferase enzymes are used in bioluminescene assay systems and display an inherent light emission, which makes them suitable for multiplex analyses, including in vivo imaging, cell viability.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at 4°C(short term) or -20 °C (long term); once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Luciferase from Photinus pyralis
Immunogen:
Purified Luciferase from Photinus pyralis UniProt: P08659
Applications:
ELISA (ELISA), Indirect Immunofluorescence (IF), Western blot (WB)
This product is intended for use in precipitating and non-precipitating antibody-binding assays; to prepare an insoluble immuno-affinity adsorbent and for labelling with a marker of chosed by the customer.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at 4°C(short time) or -20 °C (log term); once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Aspergillus niger
Immunogen:
Purified Glucose oxidase of Aspergillus niger, UniProt: P13006
Applications:
ELISA (ELISA), Immunofluorescence (IF), Western blot (WB)
Protein L is a 36 kDa immunoglobulin-binding protein isolated from the bacteria Peptostreptococcus magnus. Unlike Protein A and Protein G, which bind to the Fc region of immunoglobulins (antibodies), Protein L binds antibodies through light chain interactions. Protein L binds a wider range of antibody classes than Protein A or G. Protein L binds to representatives of all antibody classes, including IgG, IgM, IgA, IgE and IgD.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Protein L is an immunoglobulin-binding protein isolated from the bacteria Peptostreptococcus magnus. Unlike Protein A and Protein G, which bind to the Fc region of immunoglobulins (antibodies), Protein L binds antibodies through light chain interactions. Protein L binds a wider range of antibody classes than Protein A or G. Protein L binds to representatives of all antibody classes, including IgG, IgM, IgA, IgE and IgD.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Protein L is a 36 kDa immunoglobulin-binding protein isolated from the bacteria Peptostreptococcus magnus. Unlike Protein A and Protein G, which bind to the Fc region of immunoglobulins (antibodies), Protein L binds antibodies through light chain interactions. Protein L binds a wider range of antibody classes than Protein A or G. Protein L binds to representatives of all antibody classes, including IgG, IgM, IgA, IgE and IgD.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Protein G is a bacterial protein derived from the cell wall of certain strains of b-hemolytic Streptococcci. It binds with high affinity to the Fc portion of various classes and subclasses of immunoglobulins from a variety of species. Protein G binds to all IgG subclasses from human, mouse and rat species. It also binds to total IgG from guinea pig, rabbit, goat, cow, sheep, and horse. Protein G binds preferentially to the Fc portion of IgG, but unlike Protein A, can also bind to the Fab region, making it useful for purification of F(ab') fragments of IgG. Due to its affinity for the Fc region of many mammalian immunoglobulins, protein G is considered a universal reagent in biochemistry and immunology.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
Streptococcus sp.
Immunogen:
Recombinant protein G, lacking the albumin binding region,
Protein A is a surface protein of S. aureus which binds IgG molecules by their Fc region. In serum, the bacteria will bind IgG molecules in the wrong orientation on their surface, which hinders opsonization and phagocytosis. Mutants of S. aureus lacking protein A are more efficiently phagocytosed in vitro and mutants in infection models have diminished virulence. Due to its affinity for the Fc region of many mammalian immunoglobulins, protein A is considered a universal reagent in biochemistry and immunology.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Protein A is a surface protein of S. aureus which binds IgG molecules by their Fc region. In serum, the bacteria will bind IgG molecules in the wrong orientation on their surface, which hinders opsonization and phagocytosis. Mutants of S. aureus lacking protein A are more efficiently phagocytosed in vitro and mutants in infection models have diminished virulence. Due to its affinity for the Fc region of many mammalian immunoglobulins, protein A is considered a universal reagent in biochemistry and immunology.
The specific activity of the anti-protein A-agarose was determined, For this lot, 1,1 mg protein A bound per ml agarose
Purity:
Immunogen affinity purified in PBS pH 7.2. Contains 0.075% sodium azide, coupled to immunoprecipiation gel.
Special application note:
Antibodies were isolated from immune eggs, affinity purified on a protein A column and conjugated to N- hydroxysuccinimide (NHS)-activated agarose beads, Beads were washed extensively with after the blocking of the residual NHS sites
Botulinum toxin is a toxin produced by the anaerobic, gram-positive, bacterium of the genus Clostridium (C. botulinum, C. butyricum, C. baratii and C. argentinense). These strains are widely distributed and can be found in soil and dust. Eight types of botulinum toxin are distinguished, named type A–H. Type A and B are capable of causing disease in humans (botulism) and have longest activity in vivo, and are also used commercially (BOTOX) and medically. Types C–G are less common; types E and F can cause disease in humans, while the other types cause disease in other animals. BotB is cleaved into two chains: heavy and light.Alternative name: Bontoxilysin-B
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
Botulinum Neurotoxin B from Clostridium botulinum
Immunogen:
Highly purified Botulinum Neurotoxin Type B (Clostridium botulinum)
Botulinum toxin is a toxin produced by the anaerobic, gram-positive, bacterium of the genus Clostridium (C. botulinum, C. butyricum, C. baratii and C. argentinense). These strains are widely distributed and can be found in soil and dust. Eight types of botulinum toxin are distinguished, named type A–H. Type A and B are capable of causing disease in humans (botulism) and have longest activity in vivo, and are also used commercially (BOTOX) and medically. Types C–G are less common; types E and F can cause disease in humans, while the other types cause disease in other animals. BotB is cleaved into two chains: heavy and light.Alternative name: Bontoxilysin-B
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
Botulinum Neurotoxin B fromClostridium botulinum
Immunogen:
Highly purified Botulinum Neurotoxin Type B (Clostridium botulinum)
Botulinum toxin is a toxin produced by the anaerobic, gram-positive, bacterium of the genus Clostridium (C. botulinum, C. butyricum, C. baratii and C. argentinense). These strains are widely distributed and can be found in soil and dust. Eight types of botulinum toxin are distinguished, named type A–H. Type A and B are capable of causing disease in humans (botulism) and have longest activity in vivo, and are also used commercially (BOTOX) and medically. Types C–G are less common; types E and F can cause disease in humans, while the other types cause disease in other animals. BotA is cleaved into two chains: heavy and light.Alternative name: Bontoxilysin-A
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
Botulinum toxin A heavy chain
Immunogen:
Purified Botulinum Neurotoxin Type A (Heavy Chain Binding Domain)
For direct ELISA coating with 2 g of Botulinium Toxin A is recommended combined with primary antibody dilution of 1: 10 000.For Western blot 0.5 g of non reduced holotoxin or heavy chains is recommended together with 1: 2000 dilution of a primary antibody.
HA-tag is derived from a human influenza hemagglutinin HA-molecule corresponding to amino acids 96-106 and is used as a general epitope tag in expression vectors. An anti-HA antibody can then be used to detect the protein on western blot or to immunoprecipitate the recombinant protein in binding studies with transfected cells.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
HA-tagged proteins
Immunogen:
KLH-conjugated synthetic petide YPYDVPDYA of influenza virus hemagglutinin.
Molar F/P ratio is 3,6 and indicates an average number of FITC molecules/IgY molecule as determined by the extinction values at 495 nm and 280 nm (OD495 and OD280), respectively
HA-tag is derived from a human influenza hemagglutinin HA-molecule corresponding to amino acids 96-106 and is used as a general epitope tag in expression vectors. An anti-HA antibody can then be used to detect the protein on western blot or to immunoprecipitate the recombinant protein in binding studies with transfected cells.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
HA-tagged proteins
Immunogen:
KLH-conjugated synthetic petide YPYDVPDYA of influenza virus hemagglutinin.
Applications:
ELISA (ELISA), Flow cytometry (Flowcyt), Western blot (WB)
Papain (EC=3.4.22.2) is a cysteine protease which belongs to peptidase C1 family. Can cause an allergic reaction in humans. Alternative names: Papaya proteinase I, allergen= Car p 1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Carica papaya
Expected Species:
Carica papaya
Immunogen:
native papain isolated and purified from Carica papaya
Applications:
ELISA (ELISA), Immunofluorescence (IF), Immunohistochemistry (IHC), Western blot (WB)
Biotin/IgG protein molar ration is approximately 6,2, No foreign proteins are added
Application Details:
1 : 1000-1 : 100 000 (ELISA), (IF), (IHC), (WB)
Purity:
Purified IgG in PBS. Contains 0.08% sodium azide.
Reconstitution:
For reconstitution add 0,5 ml of sterile destilled water
Molecular Weight:
38,9 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Antibody is labelled with biotin using N-hydroxysuccinimidobiotin, Antibody potency and purity has been evaluated by immunoelectrophoresis, single radial immunodiffusion (Ouchterlony), ELISA,immunoblotting and enzyme inhibition
Papain (EC=3.4.22.2) is a cysteine protease which belongs to peptidase C1 family. Can cause an allergic reaction in humans. Alternative names: Papaya proteinase I, allergen= Car p 1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Carica papaya
Expected Species:
Carica papaya
Immunogen:
native papain isolated and purified from Carica papaya
Applications:
ELISA (ELISA), Immunofluorescence (IF), Immunohistochemistry (IHC), Western blot (WB)
Biotin/IgG protein molar ration is approximately 6,2, No foreign proteins are added
Application Details:
1 : 1000-1 : 100 000 (ELISA), (IF), (IHC), (WB)
Purity:
Purified IgG in PBS. Contains 0.08% sodium azide.
Reconstitution:
For reconstitution add 0,5 ml of sterile destilled water
Molecular Weight:
38,9 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Antibody is labelled with biotin using N-hydroxysuccinimidobiotin, Antibody potency and purity has been evaluated by immunoelectrophoresis, single radial immunodiffusion (Ouchterlony), ELISA,immunoblotting and enzyme inhibition
His-Tag is a polyhistidine tag which consists of 6 histidine residues introduced on N- or C-terminus of the protein. The polyhistidine-tag can be used for recombinant protein detection using specific antibodies and it is not conjugated to any dye or enzyme.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
APP is an integral membrane protein found in any tissues and concentrated in the synapses of neurons. It is known as the precursor molecule generating amyloid beta (Aβ), and the amyloid fibrillar form is the primary component of amyloid plaques found in the brains of patients with Alzheimer's disease.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Human, mouse, rat
Expected Species:
Chicken, monkey and other species, please inquire.
Immunogen:
Synthetic peptide amino acids: 737-751 of human APP UniProt: P05067 or 85-99 of the C99 generated by secretases.
APP is an integral membrane protein found in many tissues and concentrated in the synapses of neurons. It is known as the precursor molecule generating amyloid beta (Aβ), and the amyloid fibrillar form is the primary component of amyloid plaques found in the brains of patients with Alzheimer's disease.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Human, mouse, rat
Immunogen:
Synthetic peptide (aa 653-662 of human APP) or 1-10 of the 4kDa Amyloid- peptide, The 4 kDa amyloid peptide is a 40 amino acid sequence that is cleaved of from the human amyloid A4 protein precursor (APP) and therefore the amino acids 1-10 of the peptide correspond to amino acids 653-662 of APP,
HA-tag is derived from a human influenza hemagglutinin HA-molecule corresponding to amino acids 96-106 and is used as a general epitope tag in expression vectors. An anti-HA antibody can then be used to detect the protein on western blot or to immunoprecipitate the recombinant protein in binding studies with transfected cells.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
HA-tagged proteins
Immunogen:
9 amono acid long synthetic petide to influenza virus hemagglutinin,
Mouse IgG1 is a negative control for Immunofluorescence staining with FITC, Biotin, PE and APC mouse monoclonal antibodies of the IgG1 subclass. Monitoring the level of non-specific binding of mouse monoclonal antibodies to human cell surgace antigens can be done using this product.
IgG1 immunoglobulin Protein A/G purified in PBS. Contains 0.08% sodium azide.
Special application note:
PBMC: Add 10 l of MAB/10^6 PBMC in100 µl PBS. Mix gently and incubate for 15 minutes at 2 to 8 C. Wash twice with PBS and analyze. Whole blood: Add10 μl of MAB/100 μl of Whole Blood. Mix gently and 1/3incubate for 15 minutes at room temperature 20oC. Lyse the whole blood. Wash once with PBS and analyze. See instrument manufacturer’s instructions for Lysed Whole Blood and Immunofluorescence analysis with a flow cytometer or microscope. Allophycocyanin: (APC) conjugates are analyzed in multi-color flow cytometry with instruments equipped with a second laser and proper filters. Laser excitation is at 633 nm with a Helium Neon (HeNe) laser or a 600-640 nm (633nm) range for a Dye laser. Peak fluorescence emission is at 660 nm. RPE-Cy-5 +: Excites at 488nm and emits at 670nm. Store protected from light. Optimal concentration should be evaluated by serial dilutions.
Mouse immunoglobulin molecules of IgG1 isotype this ready to use Negative Control reagent contains purified non-conjugated mouse immunoglobulin molecules of IgG1 isotype, which have been selected on the basis of their binding characteristics: no specific binding to human cell surface or intracellular antigens
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Stored at 2-8 C, do not freeze.
Host Animal:
Mouse
Species Reactivity:
Calf intestine alkaline phosphatase (no cross reaction with human proteins)
Applications:
Direct Immunofluorescence (IF), Flow Cytometry (Flow cyt), Immunofluoresence (IF)
The clone VI-AP reacts with calf intestine alkaline phosphatase and does not show cross-reactivity with human proteins. The sensitivity of VI-AP mAb is determined by staining well-defined blood samples from representative donors with serial-fold mAb dilutions to obtain a titration curve that allows relating the mAb concentration to the percentage of stained cells and geometric MFI (mean fluorescence intensity). For this purpose, a mAb-concentration range is selected to include both the saturation point and the detection threshold In practice, 50 l of leukocytes containing 10^7 cells/ml are stained with 20 l mAb of various dilutions to obtain a titration curve and to identify the saturation point and detection threshold. The final concentration of the product is then adjusted to be at least 3-fold above the detection threshold.
Soybean (Glycine max) is a plant from legume family with a broad use in food industry.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid working with a stock. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
eIF2-alpha (Eukaryotic translation initiation factor 2 subunit alpha) functions in the early steps of protein synthesis by forming a ternary complex with GTP and initiator tRNA. eIF2 is a heterodimer composed of an alpha, beta and gamma chain.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
BC2 tag is a short and inert peptide-tag for protein studies.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
Protein of interest overexpressed wth BC2-tag
Immunogen:
KLH-conjugated BC2 tag PDRKAAVSHWQQ derived from beta catenin.
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 650.
Selected references:
To be added when available. Antibody released in May 2023.
Special application note:
This antibody is suitable for detection of recombinant proteins with BC2 tag.DyLight 650 has Amax = 652 nm, Emax = 672 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
BC2 tag is a short and inert peptide-tag for protein studies.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
Protein of interest overexpressed wth BC2-tag
Immunogen:
KLH-conjugated BC2 tag PDRKAAVSHWQQ derived from beta catenin.
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 594.
Selected references:
To be added when available. Antibody released in May 2023.
Special application note:
This antibody is suitable for detection of recombinant proteins with BC2 tag.DyLight 594 has Amax = 593 nm, Emax = 618 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
BC2 tag is a short and inert peptide-tag for protein studies.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
Protein of interest overexpressed wth BC2-tag
Immunogen:
KLH-conjugated BC2 tag PDRKAAVSHWQQ derived from beta catenin.
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 488.
Selected references:
To be added when available. Antibody released in May 2023.
Special application note:
This antibody is suitable for detection of recombinant proteins with BC2 tag.DyLight 488 Amax = 493 nm, Emax = 519 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
BC2 tag is a short and inert peptide-tag for protein studies.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Protein of interest overexpressed wth BC2-tag
Immunogen:
KLH-conjugated BC2 tag PDRKAAVSHWQQ derived from beta catenin.
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, prepare small aliquots and store at -20 °C. For storage at 2-8 C, add a preservative to prevent growth of bacteria.This product is used as a blocking reagent or control for
After opening the vial, the lyophilized content is reconstituted by adding 1 ml of sterile distilled water, mixed gently by inversion until complete dissolution is obtained, Allow to stand at ambient temperature for 5-10 minutes to reach equilibrium, Reconstituted serum may be stored frozen
Special application note:
This normal serum can be used as an internal relative standard for quantitative protein assays such as double radial immunodiffusion (Mancini, Fahey), ELISA, Western blot and electroimmunodiffusion (Laurell). The product can be also applied as a blocking or negative control in non-precipitating antibody binding assays as immunofluorescence.Normal pig serum was obtained from healthy animals of European origin.
GFP (Green fluorescent protein) was originally identified in photo organs on jellyfish Aequorea victoria. It is a naturally fluorescent protein which emits green light at a maximum wavelength of 509 nm when excited by blue or UV light. It is extensively used in laboratory as a reporter molecule to label and study cellular and subcellular proteins in living cells using a wide range of applications. Antibodies to GFP protein are used in immunoblotting and ELISA. GFP protein has molecular weight of 27 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
GFP (Green fluorescent protein) was originally identified in photo organs on jellyfish Aequorea victoria. It is a naturally fluorescent protein which emits green light at a maximum wavelength of 509 nm when excited by blue or UV light. It is extensively used in laboratory as a reporter molecule to label and study cellular and subcellular proteins in living cells using a wide range of applications. Antibodies to GFP protein are used in immunoblotting and ELISA. GFP protein has molecular weight of 27 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
GFP (Green fluorescent protein) was originally identified in photo organs on jellyfish Aequorea victoria, It is a naturally fluorescent protein which emits green light at a maximum wavelength of 509 nm when excited by blue or UV light, It is extensively used in laboratory as a reporter molecule to label and study cellular and subcellular proteins in living cells using a wide range of applications, Antibodies to GFP protein are used in immunoblotting and ELISA, GFP protein has molecular weight of 27 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
GFP (Green fluorescent protein) was originally identified in photo organs on jellyfish Aequorea victoria, It is a naturally fluorescent protein which emits green light at a maximum wavelength of 509 nm when excited by blue or UV light, It is extensively used in laboratory as a reporter molecule to label and study cellular and subcellular proteins in living cells using a wide range of applications, Antibodies to GFP protein are used in immunoblotting and ELISA, GFP protein has molecular weight of 27 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
GFP (Green fluorescent protein) was originally identified in photo organs on jellyfish Aequorea victoria, It is a naturally fluorescent protein which emits green light at a maximum wavelength of 509 nm when excited by blue or UV light, It is extensively used in laboratory as a reporter molecule to label and study cellular and subcellular proteins in living cells using a wide range of applications, Antibodies to GFP protein are used in immunoblotting and ELISA, GFP protein has molecular weight of 27 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
GFP (Green fluorescent protein) was originally identified in photo organs on jellyfish Aequorea victoria. It is a naturally fluorescent protein which emits green light at a maximum wavelength of 509 nm when excited by blue or UV light. It is extensively used in laboratory as a reporter molecule to label and study cellular and subcellular proteins in living cells using a wide range of applications. Antibodies to GFP protein are used in immunoblotting and ELISA. GFP protein has molecular weight of 27 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
GFP (Green fluorescent protein) was originally identified in photo organs on jellyfish Aequorea victoria. It is a naturally fluorescent protein which emits green light at a maximum wavelength of 509 nm when excited by blue or UV light. It is extensively used in laboratory as a reporter molecule to label and study cellular and subcellular proteins in living cells using a wide range of applications. Antibodies to GFP protein are used in immunoblotting and ELISA. GFP protein has molecular weight of 27 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Rabbit anti-DYKDDDDK is a primary antibody which binds to DYKDDDDK (Sigma FLAG ).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
DYKDDDDK epitope tag (Sigma FLAG ), fused to proteins in plant cells
Immunogen:
KLH-conjugated synthetic peptide: DYKDDDDK (Sigma FLAG )
His-Tag is a polyhistidine tag which consists of 3 or 6 histidine residues introduced on N- or C-terminus of the protein. The polyhistidine-tag can be used for recombinant protein detection using specific antibodies and it is not conjugated to any dye or enzyme.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
His-Tag is a polyhistidine tag which consists of 3 or 6 histidine residues introduced on N- or C-terminus of the protein. The polyhistidine-tag can be used for recombinant protein detection using specific antibodies and it is not conjugated to any dye or enzyme.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
His-Tag is a polyhistidine tag which consists of 3 or 6 histidine residues introduced on N- or C-terminus of the protein, The polyhistidine-tag can be used for recombinant protein detection using specific antibodies and it is not conjugated to any dye or enzyme.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
His-Tag is a polyhistidine tag which consists of 3 or 6 histidine residues introduced on N- or C-terminus of the protein, The polyhistidine-tag can be used for recombinant protein detection using specific antibodies and it is not conjugated to any dye or enzyme.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
His-Tag is a polyhistidine tag which consists of 3 or 6 histidine residues introduced on N- or C-terminus of the protein, The polyhistidine-tag can be used for recombinant protein detection using specific antibodies and it is not conjugated to any dye or enzyme.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
His-Tag is a polyhistidine tag which consists of 3 or 6 histidine residues introduced on N- or C-terminus of the protein. The polyhistidine-tag can be used for recombinant protein detection using specific antibodies and it is not conjugated to any dye or enzyme.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
His-Tag is a polyhistidine tag which consists of 3 or 6 histidine residues introduced on N- or C-terminus of the protein. The polyhistidine-tag can be used for recombinant protein detection using specific antibodies and it is not conjugated to any dye or enzyme.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Tagging a protein with TurboID allows studying protein interactions in different types of cells and organs and developmental stages. This is a suitable tool for proximity labelling experiments as described in Mair et al. (2019). Proximity labelling of protein complexes and cell-type-specific organellar proteomes in Arabidopsis enabled by TurboID. Elife . 2019 Sep 19;8:e47864. doi: 10.7554/eLife.47864. This tag has MW of 35 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
BirA (mutated/TurboID)
Immunogen:
Recombinant mutated BirA protein from E.coli produced using the following plasmid: TurboID-His6_pET21a, (Plasmid #107177). Expression was done in a vector that allowed for the generation of an untagged protein (without HIS6tag).
Tagging a protein with TurboID allows studying protein interactions in different types of cells and organs and developmental stages. This is a suitable tool for proximity labelling experiments as described in Mair et al. (2019). Proximity labelling of protein complexes and cell-type-specific organellar proteomes in Arabidopsis enabled by TurboID. Elife . 2019 Sep 19;8:e47864. doi: 10.7554/eLife.47864. This tag has MW of 35 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
BirA (mutated/TurboID)
Immunogen:
Recombinant mutated BirA protein from E.coli produced using the following plasmid: TurboID-His6_pET21a, (Plasmid #107177). Expression was done in a vector that allowed for the generation of an untagged protein (without HIS6tag).
Tagging a protein with TurboID allows studying protein interactions in different types of cells and organs and developmental stages, This is a suitable tool for proximity labelling experiments as described in Mair et al, (2019), Proximity labelling of protein complexes and cell-type-specific organellar proteomes in Arabidopsis enabled by TurboID, Elife , 2019 Sep 19;8:e47864, doi: 10,7554/eLife,47864, This tag has MW of 35 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
BirA (mutated/TurboID)
Immunogen:
Recombinant mutated BirA protein from E.coli produced using the following plasmid: TurboID-His6_pET21a, (Plasmid #107177). Expression was done in a vector that allowed for the generation of an untagged protein (without HIS6tag).
Tagging a protein with TurboID allows studying protein interactions in different types of cells and organs and developmental stages, This is a suitable tool for proximity labelling experiments as described in Mair et al, (2019), Proximity labelling of protein complexes and cell-type-specific organellar proteomes in Arabidopsis enabled by TurboID, Elife , 2019 Sep 19;8:e47864, doi: 10,7554/eLife,47864, This tag has MW of 35 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
BirA (mutated/TurboID)
Immunogen:
Recombinant mutated BirA protein from E.coli produced using the following plasmid: TurboID-His6_pET21a, (Plasmid #107177). Expression was done in a vector that allowed for the generation of an untagged protein (without HIS6tag).
Tagging a protein with TurboID allows studying protein interactions in different types of cells and organs and developmental stages, This is a suitable tool for proximity labelling experiments as described in Mair et al, (2019), Proximity labelling of protein complexes and cell-type-specific organellar proteomes in Arabidopsis enabled by TurboID, Elife , 2019 Sep 19;8:e47864, doi: 10,7554/eLife,47864, This tag has MW of 35 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
BirA (mutated/TurboID)
Immunogen:
Recombinant mutated BirA protein from E.coli produced using the following plasmid: TurboID-His6_pET21a, (Plasmid #107177). Expression was done in a vector that allowed for the generation of an untagged protein (without HIS6tag).
Tagging a protein with TurboID allows studying protein interactions in different types of cells and organs and developmental stages. This is a suitable tool for proximity labelling experiments as described in Mair et al. (2019). Proximity labelling of protein complexes and cell-type-specific organellar proteomes in Arabidopsis enabled by TurboID. Elife . 2019 Sep 19;8:e47864. doi: 10.7554/eLife.47864. This tag has MW of 35 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
BirA (mutated/TurboID)
Immunogen:
Recombinant mutated BirA protein from E.coli produced using the following plasmid: TurboID-His6_pET21a, (Plasmid #107177). Expression was done in a vector that allowed for the generation of an untagged protein (without HIS6tag).
Tagging a protein with TurboID allows studying protein interactions in different types of cells and organs and developmental stages. This is a suitable tool for proximity labelling experiments as described in Mair et al. (2019). Proximity labelling of protein complexes and cell-type-specific organellar proteomes in Arabidopsis enabled by TurboID. Elife . 2019 Sep 19;8:e47864. doi: 10.7554/eLife.47864.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
BirA (mutated/TurboID)
Expected Species:
mini TurboID
Immunogen:
Recombinant mutated BirA protein from E.coli produced using the following plasmid: TurboID-His6_pET21a, (Plasmid #107177). Expression was done in a vector that allowed for the generation of an untagged protein (without HIS6tag).
Ferredoxin-NADP reductase, leaf isozyme 1 (L-FNR1) plays a key role in regulating the relative amounts of cyclic and non-cyclic electron flow to meet the demands of the plant for ATP and reducing power. Localised in the chloroplast.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Zea mays
Expected Species:
Hordeum vulgare, Oryza brachyantha, Saccharum sp., Setaria italica, Sorghum bicolorSpecies of your interest not listed? Contact us
Immunogen:
Purified recombinant maize leaf FNR1 protein UniProt: Q9SLP6, sharing homology with maize FNR2, FNR3 and Arabidopsis thaliana FNR1 Q9FKW6
FNR2 | Ferredoxin NADP Reductase, isoprotein 2 (leaf) plays a key role in regulating the relative amounts of cyclic and non-cyclic electron flow to meet the demands of the plant for ATP and reducing power.Alternative names: FNR
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Zea mays
Expected Species:
Dichanthelium oligosanthes, Glycine max, Sorghum bicolorSpecies of your interest not listed? Contact us
Immunogen:
Purified full length, tag cleaved, recombinant maize leaf FNR2, UniProt: Q9SLP5, sharing homology with Arabidopsis thaliana FNR2, UniProt: Q8W493
FNR3 | Ferredoxin NADP Reductase, isoprotein 3 (leaf) (L-FNR1) plays a key role in regulating the relative amounts of cyclic and non-cyclic electron flow to meet the demands of the plant for ATP and reducing power. Localized in chloroplast.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Zea mays
Expected Species:
Dichanthelium oligosanthes, Panicum hallii, Sorghum bicolor Species of your interest not listed? Contact us
Immunogen:
Purified full length, tag cleaved, recombinant maize leaf FNR3, UniProt: B4FUM2
This antibody is also detecting other maize L-FNRs: FNR2 and FNR1 in Zea mays and Arabidopsis thaliana leaf extracts, in the order of reactivity in each species.
Application Details:
1: 1000 (WB)
Purity:
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
40,6 | 34,7 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Okutani et al. (2005). Three Maize Leaf ferredoxin:NADPH Oxidoreductases Vary in Subchloroplast Location, Expression, and Interaction With Ferredoxin. Plant Physiol . 2005 Nov;139(3):1451-9. doi: 10.1104/pp.105.070813.Okutani et al. (2005). Three Maize Leaf ferredoxin:NADPH Oxidoreductases Vary in Subchloroplast Location, Expression, and Interaction With Ferredoxin. Plant Physiol. 2005 Nov;139(3):1451-9. doi: 10.1104/pp.105.070813.
Ferredoxin-NADP reductase (FNR) isoproteins of plant roots play a key role in redox homeostasis of NADPH / NADP + and donation of reducing equivalence to ferredoxin. R-FNR2 is major form of R-FNR and involved in reduction and detoxication of nitrite in root.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Antibody will recognize two root FNR proteins (R-FNR1 and R-FNR2) of Arabidopsis thaliana and Zea mays as well as leaf FNRs.This antibody can be used as a marker of plastids localised in roots.
Application Details:
1: 1000 - 1: 30 000 (WB)
Purity:
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
36,3 kDa | 35,57 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Hachiya et al. (2016). Arabidopsis Root-Type Ferredoxin:NADP(H) Oxidoreductase 2 Is Involved in Detoxification of Nitrite in Roots . Plant Cell Physiol. 57(11):2440-2450. doi: 10.1093/pcp/pcw158.Hachiya et al. (2016). Arabidopsis Root-Type Ferredoxin:NADP(H) Oxidoreductase 2 Is Involved in Detoxification of Nitrite in Roots. Plant Cell Physiol. 57(11):2440-2450. doi: 10.1093/pcp/pcw158.Onda et al. (2000). Differential Interaction of Maize Root ferredoxin:NADP(+) Oxidoreductase With Photosynthetic and Non-Photosynthetic Ferredoxin Isoproteins. Plant Physiol. 123(3):1037-45. doi: 10.1104/pp.123.3.1037. Onda et al. (2000). Differential Interaction of Maize Root ferredoxin:NADP(+) Oxidoreductase With Photosynthetic and Non-Photosynthetic Ferredoxin Isoproteins. Plant Physiol. 123(3):1037-45. doi: 10.1104/pp.123.3.1037.
FNR | Ferredoxin NADP Reductase plays a key role in regulating the relative amounts of cyclic and non-cyclic electron flow to meet the demands of the plant for ATP and reducing power. The human malaria parasite (Plasmodium falciparum) possesses a plastid-derived organelle called the apicoplast, which is believed to employ metabolisms crucial for the parasite's survival.Alternative name: Fd:NADPH oxidoreducatase (FNR)
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 4 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Plasmodium falciparum
Immunogen:
Purified full length, tag cleaved, recombinant Plasmodium falciparum FNR, UniProt: C6KT68
For western blot apicoplast fraction from Plasmodium falciparum is recommended, not a total cell extract.
Application Details:
1: 500 - 1: 2000 (WB)
Purity:
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
43,8 | 38 kDa (transit peptide removed)
Selected references:
Kimata-Ariga et al. (2007). Cloning and Characterization of Ferredoxin and ferredoxin-NADP+ Reductase From Human Malaria Parasite. J Biochem. 2007 Mar;141(3):421-8. doi: 10.1093/jb/mvm046.Kimata-Ariga et al. (2007). Cloning and Characterization of Ferredoxin and ferredoxin-NADP+ Reductase From Human Malaria Parasite. J Biochem. 141(3):421-8. doi: 10.1093/jb/mvm046.
Ferredoxins are iron-sulfur proteins that transfer electrons in a wide variety of metabolic reactions. It occupies a key position both for transferring the photoreducing power to Fd-NADP+ oxidoreductase (FNR), hence the formation of NADPH, and for mediating the cyclic electron flow around photosystem I (PSI).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Zea mays
Expected Species:
Brassica napus, Brassica oleracea, Eutrema salsugineum, Raphanus sativusSpecies of your interest not listed? Contact us
Immunogen:
Purified full length, tag cleaved, recombinant maize Fd1, UniProt: P27787
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
12 | 15 kDa
Not reactive in:
Nicotiana benthamiana
Selected references:
Hanke and Hase (2008). Variable Photosynthetic Roles of Two Leaf-Type Ferredoxins in Arabidopsis, as Revealed by RNA Interference. Photochem Photobiol. 84(6):1302-9. doi: 10.1111/j.1751-1097.2008.00411.x.Kimata and Hase (1989). Localization of Ferredoxin Isoproteins in Mesophyll and Bundle Sheath Cells in Maize Leaf. Plant Physiol. 89(4):1193-7. doi: 10.1104/pp.89.4.1193.
Ferredoxins are iron-sulfur proteins that transfer electrons in a wide variety of metabolic reactions. Occupies a key position both for transferring the photoreducing power to Fd-NADP+ oxidoreductase (FNR), hence the formation of NADPH, and for mediating the cyclic electron flow around photosystem I (PSI). Fd2 is most abundant Fd isoprotein expressed in plant leaves.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
15 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Ramirez et al. (2013). Glutathione and ascorbic acid protect Arabidopsis plants against detrimental effects of iron deficiency.Hanke et al. (2004). A post genomic characterizationof Arabidopsis ferredoxins. Plant Physiol. 2004 Jan;134(1):255-64. Epub 2003 Dec 18 (Western blot, Arabidopsis thaliana)
Ferredoxins are iron-sulfur proteins that transfer electrons in a wide variety of metabolic reactions. Fd3 is non-photosynthetic Fd expressed more in root than in leaf. Fd3 is localised in chloroplast and plastids.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Zea mays
Expected Species:
Brachypodium distachyon, Dichanthelium oligosanthes, Hordeum vulgare, Oryza sativa, Panicum hallii, Saccharum sp. , Setaria italicaSpecies of your interest not listed? Contact us
Immunogen:
Purified full length, tag cleaved, recombinant maize Fd3, UniProt: P27788
Antibody reacts weakly with other ferredoxins: Arabidopsis thaliana and Zea mays Fd2 and Zea mays Fd6.
Application Details:
1: 2000 - 1: 10 000 (WB)
Purity:
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
16 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Hanke and Hase (2008). Variable Photosynthetic Roles of Two Leaf-Type Ferredoxins in Arabidopsis, as Revealed by RNA Interference. Photochem Photobiol. 84(6):1302-9. doi: 10.1111/j.1751-1097.2008.00411.x. Hanke et al. (2003). A Post Genomic Characterization of Arabidopsis Ferredoxins. Plant Physiol. 134(1):255-64. doi: 10.1104/pp.103.032755. Matsumura et al. (1997). A Nitrate-Inducible Ferredoxin in Maize Roots. Genomic Organization and Differential Expression of Two Nonphotosynthetic Ferredoxin Isoproteins. Plant Physiol. 114(2):653-60. doi: 10.1104/pp.114.2.653.
Ferredoxins are iron-sulfur proteins that transfer electrons in a wide variety of metabolic reactions. Occupies a key position both for transferring the photoreducing power to Fd-NADP+ oxidoreductase (FNR), hence the formation of NADPH, and for mediating the cyclic electron flow around photosystem I (PSI).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Zea mays
Expected Species:
plant ferredoxin isoformsSpecies of your interest not listed? Contact us
Immunogen:
Native, chromafography purified ferredoxin mixture: Fd1, Fd2, Fd3 and Fd4 from Zea mays, UniProt: P27787 (Fd1), P27787(Fd2), P27788 (Fd3), accesion number not known for Fd4
Following processing MW of plant ferredoxins is around 12 kDa, However, due to a strong acidic nature, they migrate at 16 to 17 kDa
Application Details:
1: 1000 - 1: 10 000 (WB)
Purity:
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
12 | 16-17 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Hase et al. (1991). Molecular Cloning and Differential Expression of the Maize Ferredoxin Gene Family. Plant Physiol. 96(1):77-83. doi: 10.1104/pp.96.1.77.
Ferredoxins are iron-sulfur proteins that transfer electrons in a wide variety of metabolic reactions. Higher plants also possess genes for significantly different, as yet uncharacterized Fd proteins, with extended C termini (FdCs). Whether these FdC proteins function as photosynthetic electron transfer proteins is not known. It has been suggested that FdC1 has a specific function in conditions of acceptor limitation at PSI, and channels electrons away from NADP(+) photoreduction.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Zea mays
Expected Species:
Brassica rapa, Cannabis sativa, Theobroma cacao Species of your interest not listed? Contact us
Immunogen:
Purified full length, tag cleaved, recombinant Arabidopsis thaliana Ferredoxin C-1, UniProt: O23344 , TAIR: At4g14890
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
16,7 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Voss et al. (2011). FdC1, a Novel Ferredoxin Protein Capable of Alternative Electron Partitioning, Increases in Conditions of Acceptor Limitation at Photosystem I. J Biol Chem. 2011 Jan 7;286(1):50-9. doi: 10.1074/jbc.M110.161562.
Ferredoxins are iron-sulfur proteins that transfer electrons in a wide variety of metabolic reactions.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 4 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Plasmodium falciparum
Immunogen:
Ferredoxin purified from Malaria parasite, Plasmodium falciparum, UniProt:Q8IED5
Applications:
ELISA (ELISA), Immunofluorescence (IF), Western blot (WB)
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
18 kDa
Selected references:
Kimata and Ariga et al. (2007). Cloning and Characterization of Ferredoxin and ferredoxin-NADP+ Reductase From Human Malaria Parasite. J Biochem. 141(3):421-8. doi: 10.1093/jb/mvm046. Kabayashi et al. (2007). Mitochondria and Apicoplast of Plasmodium Falciparum: Behaviour on Subcellular Fractionation and the Implication. Mitochondrion 7(1-2):125-32. doi: 10.1016/j.mito.2006.11.021.
Glutamine oxoglutarate aminotransferase (GOGAT) is an enzyme involved in synthesis of glutamate from glutamine and alpha-ketoglutarate. GOGAT has two forms in plants: ferredoxin-dependent GOGAT (Fd-GOGAT) and NADH-dependent GOGAT (NADH-GOGAT). 95% of GOGAT found in plants is the Fd-GOGAT type. Fd-GOGAT is encoded by two genes, glu1 and glu2 in Arabidopsis. Fd-GOGAT (both forms) is highly conserved among plants, red algae, and cyanobacteria. Ferredoxin-dependent glutamate synthase, chloroplastic (Fd-GOGAT) is involved in glutamate biosynthesis in leaf. This protein required for the reassimilation of ammonium ions generated during photorespiration. Gene name is GlsF.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Ariga and Hase (2014). Multiple complexes of nitrogen assimilatory enzymes in spinach chloroplasts: possible mechanisms for the regulation of enzyme function. PLoS One. Oct 1;9(10):e108965. doi: 10.1371/journal.pone.0108965.Sakaibara et al. (1991). Molecular cloning and characterization of complementary DNA encoding for ferredoxin-dependent glutamate synthase in maize leaf. J Biol Chem. Feb 5;266(4):2028-35.
NADH-dependent glutamate synthase (GltBD) is involved in glutamate biosynthesis and consists of large subunit (GltB, 168 kDa) and small subunit (GltD, 54 kDa). It is required for non-photorespiratory ammonium assimilation.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 4 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Synechocystis sp. strain PCC6803
Expected Species:
cyanobacteria Species of your interest not listed? Contact us
Immunogen:
Purified full length, tag cleaved, recombinant cyanobacterium, Leptolyngbya boryana (Plectonema boryanum) , glutamate synthase, UniProt: Q51583 (gltB, large subunit L.boryanum), Q51584 (gltD, small subunit L.boryanum)
Glutamine synthetase plays a role in the flow of nitrogen into nitrogenous organic compounds. There are five root types of GS isoproteis (GS1-1~ GS1-5) and one chloroplastic GS isoprotein (GS2/GLN2) are known. The sequence identity between GS1-1 and GS2 is 65%.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Spinacia oleracea, Zea mays
Expected Species:
Brachypodium distachyon, Cucurbita moschata, Glycine max, Medicago truncatula, Oryza sativa, Panicum hallii, Pontederia crassipes, Populus tremula x Populus alba, Prunus persica, Raphanus sativus, Saccharum officinarum, Setaria italica, Sorghum bicolor, Triticum aestivumSpecies of your interest not listed? Contact us
Immunogen:
Purified full length, tag cleaved, recombinant Zea mays GS-1 (Glutamine synthetase, root isozyme 1) UniProt: P38559
No confirmed exceptions from predicted reactivity are currently known
Application Details:
assay dependent (ELISA), 1: 1000 - 1: 5000 (WB)
Purity:
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
39 kDa | 43 kDa (chloroplast isoform)
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Kimata-Ariga and Hase (2014). Multiple complexes of nitrogen assimilatory enzymes in spinach chloroplasts: possible mechanisms for the regulation of enzyme function. PLoS One . 2014 Oct 1;9(10):e108965. doi: 10.1371/journal.pone.0108965. Sakaibara et al. (1996). Molecular identification and characterization of cytosolic isoforms of glutamine synthetase in maize roots. J Biol Chem. 1996 Nov 22;271(47):29561-8. doi: 10.1074/jbc.271.47.29561.
Special application note:
This antibody reactis with all glutamine synthetase isotypes from leaf and root
ASN (Glutamine-dependent asparagine synthetase) is essential for nitrogen assimilation, distribution and remobilization within the plant via the phloem. ASN2 is expressed in leaf and ASN1 is expressed in floral organs. The amino acid sequences of Arabidopsis thaliana ASN1 and ASN2 are 76% identical. The amino acid sequences of Arabidopsis thaliana and Zea mays ASN2 are 73.6% identical.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Zea mays
Expected Species:
Brassica rapa, Camelina sativa, Capsella rubella, Eutrema salsugineum, Punica granatumSpecies of your interest not listed? Contact us
Immunogen:
Purified full length, tag cleaved, recombinant Arabidopsis thaliana ASN2, UniProt: Q9LV77 , TAIR: AT5G65010
Applications:
ELISA (ELISA), Immunohistochemistry (IHC), Western blot (WB)
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
65 | 65 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Gaufichon et al. (2017). ASN1-encoded asparagine synthetase in floral organs contributes to nitrogen filling in Arabidopsis seeds. Plant J. 2017 Aug;91(3):371-393. doi: 10.1111/tpj.13567.Gaufichon et al. (2013). Arabidopsis thaliana ASN2 encoding asparagine synthetase is involved in the control of nitrogen assimilation and export during vegetative growth. Plant Cell Environ. 2013 Feb;36(2):328-42. doi: 10.1111/j.1365-3040.2012.02576.x.
Special application note:
This antibody reacts with both isoforms: ASN1 and ASN2
Sulfite reductase (SiR) is an essential protein with sulfite reductase activity required in assimilatory sulfate reduction pathway during both primary and secondary metabolism and thus involved in development and growth. It is known as a DNA-binding protein that binds to both double-stranded and single-stranded DNA without significant sequence specificity to reversibly repress the transcriptional activity of chloroplast nucleoids by promoting DNA compaction and possibly regulate DNA replication. The sequence identity between maize and Arabidopsis SiR is 77%.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 4 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Pisum sativum, Zea mays
Expected Species:
Dichanthelium oligosanthes, Panicum hallii, Setaria viridis, Sorghum bicolorSpecies of your interest not listed? Contact us
Immunogen:
Purified full length, tag cleaved, recombinant Zea mays SiR, UniProt: O23813
This antibody is also recognizing recombinant SiR protein from Zea mays.
Application Details:
assay dependent (ELISA), 1: 1000 - 1: 5000 (WB)
Purity:
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
70 kDa (Zea mays), 72 kDa (Arabidopsis thaliana)
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Sato et al. (2001). The 70-kDa major DNA-compacting protein of the chloroplast nucleoid is sulfite reductase. FEBS Lett. 2001 Jan 5;487(3):347-50.doi: 10.1016/s0014-5793(00)02342-5. (Western blot, pea)Sakibara et al. (2000). Analysis of reductant supply systems for ferredoxin-dependent sulfite reductase in photosynthetic and nonphotosynthetic organs of maize. Plant Physiol. 2000 Mar;122(3):887-94.doi: 10.1104/pp.122.3.887. (Western blot, maize)
MEB1 (Membrane protein of ER body 1) displays iron ion transmembrane transporter activity and may sequester excess cytosolic iron and manganese into endoplasmic reticulum to reduce metal ion toxicity. Not essential for the accumulation of ER body components.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Purified recombinant MEB1 of Arabidopsis thaliana, residues 271-502 with a His tag, UniProt: Q8W4P8, TAIR: AT4G27860
Applications:
ELISA (ELISA), Immunoprecipitation (IP), Western blot (WB)
MEB2 (Membrane protein of ER body 2) may sequester excess cytosolic iron and manganese into endoplasmic reticulum to reduce metal ion toxicity. Not essential for the accumulation of ER body components, including PYK10.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Purified recombinant MEB2 of Arabidopsis thaliana, residues 1-325 with a His tag, UniProt: F4KFS7 , TAIR: At5g24290
NAI2 TSA1-like protein is responsible for the ER body formation. Regulates the number and shape of the ER bodies and the accumulation of PYK10 in ER bodies, but is not involved in the expression of PYK10. Interacts directly or indirectly with MEB1 and MEB2. Expressed in roots. Detected in shoot apex. Induced by NAI1. The protein is localising to ER lumen.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Purified recombinant NAI2 of Arabidopsis thaliana, residues 272-502 with a His tag, UniProt: Q9LSB4, TAIR: At3g15950
Signal peptide of 24 amino acids is removed from the mature protein
Application Details:
1: 1000 - 1: 3000 (IF), 1: 2000 - 1: 4000 (WB)
Purity:
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
85 | 120 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Ueda et al. (2018).Endoplasmic Reticulum (ER) Membrane Proteins (LUNAPARKs) are Required for Proper Configuration of the Cortical ER Network in Plant Cells. Plant Cell Physiol. 2018 Oct 1;59(10):1931-1941. doi: 10.1093/pcp/pcy137. Yamada et al. (2013). Identification of two novel endoplasmic reticulum body-specific integral membrane proteins. Plant Physiol. 2013 Jan;161(1):108-20. doi: 10.1104/pp.112.207654. Yamada et al. (2008). NAI2 is an endoplasmic reticulum body component that enables ER body formation in Arabidopsis thaliana. Plant Cell . 2008 Sep;20(9):2529-40. doi: 10.1105/tpc.108.059345.
NAI2 TSA1-like protein, C-terminal is responsible for the ER body formation. Regulates the number and shape of the ER bodies and the accumulation of PYK10 in ER bodies, but is not involved in the expression of PYK10. Interacts directly or indirectly with MEB1 and MEB2. Expressed in roots. Detected in shoot apex. Localised to ER lumen.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Purified recombinant C-terminal part of NAI2 of Arabidopsis thaliana, residues 636-772 with a His tag, UniProt: Q9LSB4, TAIR: At3g15950
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
85 | 120 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Yamada et al. (2008). NAI2 is an endoplasmic reticulum body component that enables ER body formation in Arabidopsis thaliana. Plant Cell . 2008 Sep;20(9):2529-40. doi: 10.1105/tpc.108.059345.
Special application note:
Signal peptide of 24 amino acids is removed from the mature protein
BG1 (Beta-glucosidase 1) hydrolyzes abscisic acid glucose ester (ABA-GE) which represents the predominant form of conjugated ABA (biologically inactive). No activity with beta-D-glucopyranosyl zeatin. The hydrolysis of ABA-GE in the endoplasmic reticulum (ER) forms free ABA and contributes to increase its cellular levels under dehydration conditions. ABA-GE hydrolyzing activity is enhanced by dehydration stress-induced polymerization into higher molecular weight forms. The ABA produced by BGLU18 contributes to the initiation of intracellular signaling as well as the increase in the extracellular ABA level. Localised to ER lumen.Alternative names: AtBG1, Beta-glucosidase 18, Beta-glucosidase homolog 1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Purified recombinant BG1 of Arabidopsis thaliana, residues 27-528 with a His6-thioredoxin tagged, UniProt: Q9SE50, TAIR: At1g52400
Applications:
Immunolocalization (IL) using electron microscopy, Western blot (WB)
Caleosin3 encodes a calcium binding protein whose mRNA is induced upon treatment with NaCl, ABA and in response to desiccation. mRNA expression under drought conditions is apparent particularly in leaves and flowers. Isoform of caleosin with a role as a peroxygenase involved in oxylipin metabolism during biotic and abiotic stress. Involved in the production of 2-hydroxyoctadecatrienoic acid. The peroxygenase has a narrow substrate specificity thus acting as a fatty acid hydroperoxide reductase in vivo. Protective role to fungus pathogen has been indicaed. Expression is very low in young leaves and high in senescent leaves.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica napus, Camelina sativa, Capsella rubella, Raphanus sativus Species of your interest not listed? Contact us
Immunogen:
BSA-conjugated peptide, derived from N-terminus of Arabidopsis thaliana Caleosin 3, UniProt: O22788, TAIR: At2g33380
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
26,6 | 30 kDa
Not reactive in:
Poppulus sp.
Selected references:
Shimada et al. (2014). Leaf oil body functions as a subcellular factory for the production of a phytoalexin in Arabidopsis. Plant Physiol. 2014 Jan;164(1):105-18. doi: 10.1104/pp.113.230185.Shimada et al. (2010). A rapid and non-destructive screenable marker, FAST, for identifying transformed seeds of Arabidopsis thaliana. Plant J. 2010 Feb 1;61(3):519-28. doi: 10.1111/j.1365-313X.2009.04060.x
RHD3 (Protein Root Hair Defective 3) protein is probable GTP-binding protein involved in cell wall expansion. Required for appropriate root and root hair cells enlargement. May inhibit vacuole enlargement during root hair cell expansion. Plays a role in cell wall biosynthesis and actin organization. Seems to act independently from auxin and ethylene pathways. May regulate membrane traffic from the Golgi apparatus towards the endoplasmic reticulum (ER). Localized in Golgi and ER membrane.Alternative names: Fragile Fiber 4, Portein SEY1 homolog 1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Apostasia shenzhenica, Artemisia annua, Brassica rapa, Capsicum annuum, Dichanthelium oligosanthes, Hibiscus syriacus, Mucuna pruriens, Panicum hallii, Phoenix dactylifera, Tanacetum cinerariifolium, Triticum urartu, Zea mays, Vitis vinifera Species of your interest not listed? Contact us
Immunogen:
BSA-conjugated peptide, derived from N-terminus of Arabidopsis thaliana RHD3, UniProt: P93042, TAIR: At3g13870
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
89 | 90 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Ueda et al. (2016). Phosphorylation of the C Terminus of RHD3 Has a Critical Role in Homotypic ER Membrane Fusion in Arabidopsis. Plant Physiol. 2016 Feb;170(2):867-80. doi: 10.1104/pp.15.01172.
In Brassicaceae, the enzyme myrosinase (beta-thioglucoside glucohydrolase, TGG) degrades glucosinolates to produce toxins like thiocyanates, isothiocyanates, nitriles, epithionitriles or oxazolidine- 2-thiones that deter herbivory. There are two TGG enzymes, TGG1 and TGG2, which have a redundant function. Cellular localization: vacuole.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
BSA-conjugated peptide, derived from N-terminus of Arabidopsis thaliana TGG1, UniProt: P37702, TAIR: At5g26000
Applications:
ELISA (ELISA), Immunogold (IG), Immunohistochemistry (IHC), Western blot (WB)
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
61 | 77 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Farid et al. (2011). Arabidopsis thaliana alpha1,2-glucosyltransferase (ALG10) is required for efficient N-glycosylation and leaf growth. Plant J. 2011 Oct;68(2):314-25.doi: 10.1111/j.1365-313X.2011.04688.x. (Western blot)Shirakawa et al. (2010). Arabidopsis Qa-SNARE SYP2 proteins localized to different subcellular regions function redundantly in vacuolar protein sorting and plant development. Plant J. 2010 Dec;64(6):924-35.doi: 10.1111/j.1365-313X.2010.04394.x. (Western blot)Ueda et al. (2006). AtVAM3 is required for normal specification of idioblasts, myrosin cells. Plant Cell Physiol. 2006 Jan;47(1):164-75. doi: 10.1093/pcp/pci232. (Immunlocalization, Western blot).
TGG2 | Myrosinase 2 ( BGL37) may degrade glucosinolates (glucose residue linked by a thioglucoside bound to an amino acid derivative) to glucose, sulfate and any of the products: thiocyanates, isothiocyanates, nitriles, epithionitriles or oxazolidine-2-thiones. These toxic degradation products can deter insect herbivores. Seems to function in abscisic acid (ABA) and methyl jasmonate (MeJA) signaling in guard cells. Functionally redundant with TGG1. Cellular localisation: vacuole. Alternative names: Beta-glucosidase 37, AtBGLU37, Sinigrinase 2, Thioglucosidase 2.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
BSA-conjugated peptide, derived from N-terminus of Arabidopsis thaliana TGG2, UniProt: Q9C5C2 , TAIR: At5g25980
Applications:
ELISA (ELISA), Immunolocalisation (IL), Western blot (WB)
Signal peptide of 28 amino acids is removed from N-termins. Three glycosylation sites were identified in the mature form of the protein.Antibody specificity has been confirmed using wild-type and tgg2-1 mutant Ueda et al. (2006).
Application Details:
assay dependent (ELISA), (IL), 1: 1000 (WB)
Purity:
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
63 | 70 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Liebminger et al. (2012). Myrosinases TGG1 and TGG2 from Arabidopsis thaliana contain exclusively oligomannosidic N-glycans. Phytochemistry. 2012 Dec;84(21):24-30.doi: 10.1016/j.phytochem.2012.08.023. (Western blot)Shirakava et al. (2010). Arabidopsis Qa-SNARE SYP2 proteins localized to different subcellular regions function redundantly in vacuolar protein sorting and plant development. Plant J. 2010 Dec;64(6):924-35.doi: 10.1111/j.1365-313X.2010.04394.x. (Western blot)Ueda et al. (2006). AtVAM3 is required for normal specification of idioblasts, myrosin cells. Plant Cell Physiol. 2006 Jan;47(1):164-75. doi: 10.1093/pcp/pci232. (Immunolocalisation, Western blot)
PBP1 (PYK10-binding protein 1) is inhibitor-type lectin that may regulate the correct polymerization of BGLU23/PYK10 upon tissue damage. Activates BGLU21, BGLU22 and BGLU23. PBP1 is localised to cytoplasm.Alternative names: Jacalin-related lectin 30, Jasmonic acid-induced protein.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica rapa, Raphanus sativusSpecies of your interest not listed? Contact us
Immunogen:
Conjugated peptide, derived from N-terminus of Arabidopsis thaliana PBP1, UniProt: O04314, TAIR: At3g16420
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
32 | 35 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Nagano et al. (2005). Activation of an ER-body-localized beta-glucosidase via a cytosolic binding partner in damaged tissues of Arabidopsis thaliana. Plant Cell Physiol. 2005 Jul;46(7):1140-8. doi: 10.1093/pcp/pci126. (Immunofluorescence, Western blot, Arabidopsis thaliana)Matsushima et al. (2004). NAI1 gene encodes a basic-helix-loop-helix-type putative transcription factor that regulates the formation of an endoplasmic reticulum-derived structure, the ER body. Plant Cell. 2004 Jun;16(6):1536-49. doi: 10.1105/tpc.021154. (Western blot, Arabidopsis thaliana)
PBP1 (PYK10-binding protein 1) is inhibitor-type lectin that may regulate the correct polymerization of BGLU23/PYK10 upon tissue damage. Activates BGLU21, BGLU22 and BGLU23. PBP1 is localised to cytoplasm.Alternative names: Jacalin-related lectin 30, Jasmonic acid-induced protein.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Conjugated peptide, derived from C-terminus of Arabidopsis thaliana PBP1, UniProt: O04314, TAIR: At3g16420
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
32 | 35 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Nagano et al. (2005). Activation of an ER-body-localized beta-glucosidase via a cytosolic binding partner in damaged tissues of Arabidopsis thaliana. Plant Cell Physiol. 2005 Jul;46(7):1140-8. doi: 10.1093/pcp/pci126. (Immunofluorescence, Western Blot, Arabidopsis thaliana)
Oleosins may have a structural role to stabilize the lipid body during desiccation of the seed by preventing coalescence of the oil. Probably interacts with both lipid and phospholipid moieties of lipid bodies. May also provide recognition signals for specific lipase anchorage in lipolysis during seedling growth. Oleosins also increase the viability of over-wintering oilseeds by preventing abnormal fusion of oil bodies during imbibition in the spring. Cellular localisation: surface of oil bodies.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica oleracea, Raphanus sativusSpecies of your interest not listed? Contact us
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
18,5 | 17 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Shimada et al. (2010). A rapid and non-destructive screenable marker, FAST, for identifying transformed seeds of Arabidopsis thaliana. (Immunolocalisation)Shimada et al. (2008). A novel role for oleosins in freezing tolerance of oilseeds in Arabidopsis thaliana. Plant J. 2008 Sep;55(5):798-809. doi: 10.1111/j.1365-313X.2008.03553.x. (Western blot)
Donkey anti-Mouse IgG (H&L), F(ab)'2 fragment, Biotin conjugate, min. cross-reactivity to bovine, chicken, goat, guinea pig, hamster, horse, human, rabbit, rat or sheep IgG is a secondary antibody conjugated to biotin, which binds to mouse IgG (H&L), F(ab)'2 Fragment in immunological assays.
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum immunoglobulins • IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, rabbit, rat or sheep .
Goat anti-Mouse IgG (H&L), F(ab)'2 Fragment, ALP conjugated, min. cross-reactivity to bovine, goat, human, rabbit, or rat IgG (highly absorbed against rat IgG) is a secondary antibody conjugated to ALP, which binds to mouse IgG (H&L), F(ab)'2 Fragment in immunological assays.
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 30 mM Triethanolamine, pH 7.2, 5 mM Magnesium Chloride, 0.1 mM Zinc Chloride, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins • bovine, goat, human, rabbit or rat IgG Based on ELISA, this antibody has <1% reactivity to: • rat IgG .
Modify item, properties / Goat anti-Mouse IgG (H&L), F(ab)'2 fragment, ALP conjugated, min. cross-reactivity to bovine, goat, human, rabbit, or rat IgG is a secondary antibody conjugated to ALP, which binds to mouse IgG (H&L), F(ab)'2 Fragment in immunological assays.
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 30 mM Triethanolamine, pH 7.2, 5 mM Magnesium Chloride, 0.1 mM Zinc Chloride, 1 % (w/v) BSA, Protease/IgG free.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin human serum immunoglobulins • bovine, goat, human, rabbit or rat IgG .
Goat anti-Mouse IgG (H&L), F(ab)'2 fragment, ALP conjugated min. cross-reactivity to bovine, horse, human, pig or rabbit serum protein is a secondary antibody conjugated to ALP, which binds to mouse IgG (H&L), F(ab)'2 Fragment in immunological assays.
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 30 mM Triethanolamine, pH 7.2, 5 mM Magnesium Chloride, 0.1 mM Zinc Chloride, 1 % (w/v) BSA, Protease/IgG free.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum immunoglobulins • serum proteins from bovine, horse, human rabbit or swine .
Donkey anti-Mouse IgG (H&L), F(ab)'2 fragment, ALP conjugate, min. cross-reactivity to bovine, chicken, goat, guinea pig, hamster, horse, human, rabbit, rat or sheep IgG is a secondary antibody conjugated to ALP, which binds to mouse IgG (H&L), F(ab)'2 Fragment in immunological assays.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store non-diluted antibody at 2-8°C. For storage at -20 C, dilute with an equal volume of glycerol to prevent loss of enzymatic activity. Prepare working dilutions prior to use and then discard.
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 30 mM Triethanolamine, pH 7.2, 5 mM Magnesium Chloride, 0.1 mM Zinc Chloride, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum immunoglobulins • IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, rabbit, rat or sheep .
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified donkey IgG.
Special application note:
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum immunoglobulins .
Goat anti-Mouse IgG (H&L), TRITC conjugated, min. cross-reactivity to bovine, goat, human, rabbit or rat IgG is a secondary antibody conjugated to TRITC, which binds to mouse IgG (H&L) in immunological assays
For reconstitution add 1,1 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins • bovine, goat, human, rabbit or rat IgG Based on ELISA, this antibody has <1% reactivity to: • rat IgG .
Chicken anti-Mouse IgG (H&L), min. cross-reactivity to human or rabbit IgG/serum proteins is a secondary antibody which binds to mouse IgG (H&L) in immunological assays.
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified chicken IgY.
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum immunoglobulins • IgG/serum from human or rabbit .
Goat anti-Mouse IgG (H&L), HRP conjugated, min. cross-reactivity to human IgG or serum proteins is a secondary antibody conjugated to HRP, which binds to mouse IgG (H&L) in immunological assays.
For reconstitution add 1,1 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.1% (v/v) Kathon CG is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum immunoglobulins • human IgG or serum proteins .
Goat anti-Mouse IgG (H&L), HRP conjugated, min. cross-reactivity to bovine, goat, human, rabbit or rat IgG is a secondary antibody conjugated to HRP, which binds to mouse IgG (H&L) in immunological assays.
For reconstitution add 1,1 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.1% (v/v) Kathon CG is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins • bovine, goat, human, rabbit or rat IgG Based on ELISA, this antibody has <1% reactivity to: • rat IgG .
Goat anti-Mouse IgG (H&L), DyLight 680 conjugated is a secondary antibody conjugated to DyLight 680, which binds to mouse IgG (H&L) in immunological assays.DyLight 680 has Amax = 682 nm, Emax = 715 nm.DyLight is a registered trade mark of Thermofisher Inc., and its subsidaries.
For reconstitution add 1,1 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum immunoglobulins .
Goat anti-Mouse IgG (H&L), DyLight 650 conjugated, min. cross-reactivity to bovine, goat, human, rabbit, rat IgG (highly absorbed against rat IgG) is a secondary antibody conjugated to DyLight 650, which binds to mouse IgG (H&L) in immunological assays.DyLight 650 has Amax = 652 nm, Emax = 672 nm.DyLight is a registered trade mark of Thermofisher Inc., and its subsidaries.
For reconstitution add 1,1 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins • bovine, goat, human, rabbit or rat IgG Based on ELISA, this antibody has <1% reactivity to: • rat IgG .
Goat anti-Mouse IgG (H&L), DyLight 488 conjugated, min. cross-reactivity to bovine, horse, human, pig or rabbit serum proteins is a secondary antibody conjugated to DyLight 488, which binds to mouse IgG (H&L) in immunological assays.DyLight 488 has Amax = 493 nm, Emax = 518 nm.DyLight is a registered trade mark of Thermofisher Inc., and its subsidaries.
For reconstitution add 1,1 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum immunoglobulins • serum proteins from bovine, horse, human rabbit or swine .
Goat anti-Mouse IgG (H&L), DyLight 488 conjugated, min. cross-reactivity to bovine, goat, human, rabbit, rat IgG (higly absorbed against rat IgG) is a secondary antibody conjugated to DyLight 488, which binds to mouse IgG (H&L) in immunological assays.DyLight 488 has Amax = 493 nm, Emax = 518 nm.DyLight is a registered trade mark of Thermofisher Inc., and its subsidaries.
For reconstitution add 1,1 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins • bovine, goat, human, rabbit or rat IgG Based on ELISA, this antibody has <1% reactivity to: • rat IgG .
Goat anti-Mouse IgG (H&L), DyLight 405 conjugated, min. cross-reactivity to human IgG or serum proteins is a secondary antibody conjugated to DyLight 405, which binds to mouse IgG (H&L) in immunological assays.DyLight 405 has Amax = 400 nm, Emax = 420 nm.DyLight is a registered trade mark of Thermofisher Inc., and its subsidaries.
For reconstitution add 1,1 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum immunoglobulins • human IgG or serum proteins .
Goat anti-Mouse IgG (H&L), DyLight 405 conjugated is a secondary antibody conjugated to DyLight 405, which binds to mouse IgG (H&L) in immunological assays.DyLight 405 has Amax = 400 nm, Emax = 420 nm.DyLight is a registered trade mark of Thermofisher Inc., and its subsidaries.
For reconstitution add 1,1 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum immunoglobulins .
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins • bovine, goat, human, rabbit or rat IgG Based on ELISA, this antibody has <1% reactivity to: • rat IgG .
For use as a standard or control in most immunoassay formats
Purity:
Immunogen affinity purified donkey IgG.
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2. Based on IEP, this antibody reacts with: heavy (γ) chains on mouse IgG light chains on all mouse immunoglobulins . Based on IEP, no reactivity is observed to: non-immunoglobulin mouse serum immunoglobulins .
Goat anti-Human IgM ( chain), F(ab)'2 Fragment, min. cross-reactivity to IgG from human or mouse is a secondary antibody, which binds to human IgM ( chain) in immunological assays.
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified goat IgG.
Special application note:
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Human IgM.Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on human IgM .Based on IEP, no reactivity is observed to: • non-immunoglobulin human serum proteins • light chains on all human immunoglobulins • IgG from human or mouse .
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified rabbit IgG.
Reconstitution:
For reconstitution add 1,1 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 90 % based on SDS-PAGE. Small amounts of intact IgG may be present.Affinity purified using solid phase Human IgM. F(ab)’2 fragment was prepared by pepsin digestion.Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2.Based on IEP, this antibody reacts with: • heavy ( ) chains on Human IgM.Based on IEP, no reactivity is observed to: • light chains on all Human immunoglobulins • non-immunoglobulin Human serum proteins • Mouse IgG or serum proteins.
Goat anti-Human IgM ( chain), TRITC conjugated, min. cross-reactivity to human IgG; bovine, goat, mouse or rabbit serum proteins is a secondary antibody, conjugated to TRITC, which binds to human IgM ( chain) in immunological assays.
For reconstitution add 1,1 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Human IgM.Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on human IgM .Based on IEP, no reactivity is observed to: • non-immunoglobulin human serum proteins • light chains on all human immunoglobulins • human IgG • bovine, goat, mouse, or rabbit serum proteins .
Goat anti-Human IgM ( chain), min. cross-reactivity to human IgG; bovine, goat, mouse or rabbit serum proteins is a secondary antibody, which binds to human IgM ( chain) in immunological assays.
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified goat IgG.
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Human IgM.Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on human IgM .Based on IEP, no reactivity is observed to: • non-immunoglobulin human serum proteins • light chains on all human immunoglobulins • human IgG • bovine, goat, mouse, or rabbit serum proteins .
Goat anti-Human IgM ( chain), HRP conjugated, min. cross-reactivity to human IgG; bovine, goat, mouse or rabbit serum proteins, is a secondary antibody, conjugated to HRP, which binds to human IgM ( chain) in immunological assays.
For reconstitution add 1,1 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Human IgM.Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.1% (v/v) Kathon CG is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on human IgM .Based on IEP, no reactivity is observed to: • non-immunoglobulin human serum proteins • light chains on all human immunoglobulins • human IgG • bovine, goat, mouse, or rabbit serum proteins .
Goat anti-Human IgM ( chain), Biotin conjugated, min. cross-reactivity to human IgG; bovine, goat, mouse or rabbit serum proteins is a secondary antibody, conjugated to biotin, which binds to human IgM ( chain) in immunological assays
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Human IgM.Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on human IgM .Based on IEP, no reactivity is observed to: • non-immunoglobulin human serum proteins • light chains on all human immunoglobulins • human IgG • bovine, goat, mouse, or rabbit serum proteins .
Goat anti-Human IgM ( chain), biotin conjugated, is a secondary antibody, conjugated to biotin, which binds to human IgM ( chain) in immunological assays
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Human IgM.Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on human IgM .Based on IEP, no reactivity is observed to: • non-immunoglobulin human serum proteins • light chains on all human immunoglobulins .
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified rabbit IgG.
Special application note:
Antibody purity is > 95 % based on SDS-PAGE.Affinity purified using solid phase Human IgM.Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2. 0.05 % (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: heavy (γ) chains on Human IgM .Based on IEP, no reactivity is observed to: light chains on all Human immunoglobulins, non-immunoglobulin Human serum proteins, Mouse IgG or serum proteins.
Goat anti-Human IgG Fc, F(ab)'2 Fragment, TRITC conjugated, min. cross-reactivity to bovine, horse, mouse or rabbit serum proteins, mouse IgG1 is a secondary antibody, conjugated to TRITC, which binds to human IgG Fc, F(ab)'2 Fragment in immunological assays.
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Human IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on human IgG .Based on IEP, no reactivity is observed to: • non-immunoglobulin human serum immunoglobulins • light chains on all human immunoglobulins • human IgG F(ab)'2 fragment • mouse IgG1 • serum proteins from bovine, horse, mouse, or rabbit .
Goat anti-Human IgG Fc, F(ab)'2 Fragment, min. cross-reactivity to bovine, horse, mouse or rabbit serum proteins, mouse IgG1 is a secondary antibody, which binds to human IgG Fc, F(ab)'2 Fragment in immunological assays.
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified goat IgG.
Special application note:
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Human IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on human IgG .Based on IEP, no reactivity is observed to: • non-immunoglobulin human serum immunoglobulins • light chains on all human immunoglobulins • human IgG F(ab)'2 fragment • mouse IgG1 • serum proteins from bovine, horse, mouse, or rabbit .
Goat anti-Human IgG Fc, F(ab)'2 Fragment, HRP conjugated, min. cross-reactivity to bovine, horse, mouse or rabbit serum proteins, mouse IgG1 is a secondary antibody, conjugated to HRP, which binds to human IgG Fc, F(ab)'2 Fragment in immunological assays.
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Human IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.1% (v/v) Kathon CG is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on human IgG .Based on IEP, no reactivity is observed to: • non-immunoglobulin human serum immunoglobulins • light chains on all human immunoglobulins • human IgG F(ab)'2 fragment • mouse IgG1 • serum proteins from bovine, horse, mouse, or rabbit .
Goat anti-Human IgG Fc, F(ab)'2 Fragment, FITC conjugated, min. cross-reactivity to bovine, horse, mouse or rabbit serum proteins, mouse IgG1 is a secondary antibody, conjugated to FITC, which binds to human IgG Fc, F(ab)'2 Fragment in immunological assays.
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Human IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on human IgG .Based on IEP, no reactivity is observed to: • non-immunoglobulin human serum immunoglobulins • light chains on all human immunoglobulins • human IgG F(ab)'2 fragment • mouse IgG1 • serum proteins from bovine, horse, mouse, or rabbit .
Goat anti-Human IgG Fc, F(ab)'2 Fragment, DyLight 488 conjugated, min. cross-reactivity to human IgA, IgM or IgG F(ab)'2 fragment is a secondary antibody conjugated to DyLight 488, which binds to human IgG Fc, F(ab)'2 Fragment in immunological assays.DyLight 488 has Amax = 493 nm, Emax = 518 nm.DyLight is a registered trade mark of Thermofisher Inc., and its subsidaries.
For reconstitution add 0,55 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Human IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on human IgG .Based on IEP, no reactivity is observed to: • non-immunoglobulin human serum immunoglobulins • light chains on all human immunoglobulins • human IgA or IgM .
Goat anti-Human IgG Fc, F(ab)'2 Fragment, min. cross-reactivity to Human IgA/IgM, Bovine, Horse, Mouse, Rabbit Serum is a secondary antibody, which binds to human IgG Fc, F(ab)'2 Fragment in immunological assays.
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified goat IgG.
Special application note:
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Human IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on human IgG .Based on IEP, no reactivity is observed to: • non-immunoglobulin human serum immunoglobulins • light chains on all human immunoglobulins • human IgA or IgM • serum proteins from bovine, mouse, or rabbit .
Goat anti-Human IgG Fc, TRITC conjugated, min. cross-reactivity to human IgA + IgM, bovine, horse, mouse or rabbit serum proteins is a secondary antibody conjugated to TRITC, which binds to human IgG Fc in immunological assays.
For reconstitution add 1,1 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Human IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on human IgG .Based on IEP, no reactivity is observed to: • non-immunoglobulin human serum immunoglobulins • light chains on all human immunoglobulins • human IgA or IgM • serum proteins from bovine, mouse, or rabbit .
Goat anti-Human IgG Fc, TRITC conjugated, min. cross-reactivity to bovine, horse, mouse or rabbit serum proteins or mouse IgG1 is a secondary antibody conjugated to TRITC, which binds to human IgG Fc in immunological assays.
For reconstitution add 1,1 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Human IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on human IgG .Based on IEP, no reactivity is observed to: • non-immunoglobulin human serum immunoglobulins • light chains on all human immunoglobulins • human IgG F(ab)'2 fragment • mouse IgG1 • serum proteins from bovine, horse, mouse, or rabbit .
Goat anti-Human IgG Fc, min. cross-reactivity to bovine, horse, mouse or rabbit serum proteins or mouse IgG1 is a secondary antibody which binds to human IgG Fc in immunological assays.
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified goat IgG.
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Human IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on human IgG .Based on IEP, no reactivity is observed to: • non-immunoglobulin human serum immunoglobulins • light chains on all human immunoglobulins • human IgA or IgM • serum proteins from bovine, horse, mouse, or rabbit .
Goat anti-Human IgG Fc, min. cross-reactivity to bovine, horse, mouse or rabbit serum proteins or mouse IgG1 is a secondary antibody which binds to human IgG Fc in immunological assays.
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified goat IgG.
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Human IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on human IgG .Based on IEP, no reactivity is observed to: • non-immunoglobulin human serum immunoglobulins • light chains on all human immunoglobulins • human IgG F(ab)'2 fragment • mouse IgG1 • serum proteins from bovine, horse, mouse, or rabbit .
Goat anti-Human IgG Fc, HRP conjugated, min. cross-reactivity to bovine, horse, mouse or rabbit serum proteins or mouse IgG1 is a secondary antibody conjugated to HRP, which binds to human IgG Fc in immunological assays.
For reconstitution add 1,1 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Human IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.1% (v/v) Kathon CG is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on human IgG .Based on IEP, no reactivity is observed to: • non-immunoglobulin human serum immunoglobulins • light chains on all human immunoglobulins • human IgG F(ab)'2 fragment • mouse IgG1 • serum proteins from bovine, horse, mouse, or rabbit .
Goat anti-Human IgG Fc, FITC conjugated, min. cross-reactivity to human IgA + IgM, bovine, horse, mouse, or rabbit serum proteins is a secondary antibody conjugated to FITC, which binds to human IgG Fc in immunological assays.
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Human IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on human IgG .Based on IEP, no reactivity is observed to: • non-immunoglobulin human serum immunoglobulins • light chains on all human immunoglobulins • human IgA or IgM • serum proteins from bovine, horse, mouse, or rabbit .
Goat anti-Human IgG Fc, Biotin conjugated, min. cross-reactivity to human IgA + IgM, bovine, horse, mouse or rabbit serum proteins is a secondary antibody conjugated to biotin, which binds to human IgG Fc in immunological assays.
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Human IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on human IgG .Based on IEP, no reactivity is observed to: • non-immunoglobulin human serum immunoglobulins • light chains on all human immunoglobulins • human IgA or IgM • serum proteins from bovine, mouse, or rabbit .
Goat anti-Human IgG Fc, Biotin conjugated, min. cross-reactivity to bovine, horse, mouse or rabbit serum proteins or mouse IgG1 is a secondary antibody conjugated to biotin, which binds to human IgG Fc in immunological assays.
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Human IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on human IgG .Based on IEP, no reactivity is observed to: • non-immunoglobulin human serum immunoglobulins • light chains on all human immunoglobulins • human IgG F(ab)'2 fragment • mouse IgG1 • serum proteins from bovine, horse, mouse, or rabbit .
Goat anti-Human IgG Fc, ALP conjugated, min. cross-reactivity to human IgA + IgM, bovine, horse, mouse or rabbit serum proteins is a secondary antibody conjugated to ALP, which binds to human IgG Fc in immunological assays.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store non-diluted antibody at 2-8°C. For storage at -20 C, dilute with an equal volume of glycerol to prevent loss of enzymatic activity. Prepare working dilutions prior to use and then discard.
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Human IgG .Antibody is supplied in 30 mM Triethanolamine, pH 7.2, 5 mM Magnesium Chloride, 0.1 mM Zinc Chloride, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on human IgG .Based on IEP, no reactivity is observed to: • non-immunoglobulin human serum immunoglobulins • light chains on all human immunoglobulins • human IgA or IgM • serum proteins from bovine, mouse, or rabbit .
Goat anti-Human IgG (H&L), TRITC conjugated, min. cross-reactivity to rat IgG is a secondary antibody conjugated to TRITC, which binds to human IgG (H&L) in immunological assays.
For reconstitution add 1,1 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Human IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on human IgG • light chains on all human immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin human serum immunoglobulins • rat IgG .
Goat anti-Human IgG (H&L), TRITC conjugated, min. cross-reactivity to bovine, goat, mouse or rabbit serum proteins is a secondary antibody conjugated to FITC, which binds to human IgG (H&L) in immunological assays.
For reconstitution add 1,1 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Human IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on human IgG • light chains on all human immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin human serum immunoglobulins • serum proteins from bovine, goat, mouse or rabbit .
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified goat IgG.
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Human IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on human IgG • light chains on all human immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin human serum immunoglobulins • rat IgG .
Goat anti-Human IgG (H&L), min. cross-reactivity to bovine, goat, mouse or rabbit serum proteins is a secondary antibody which binds to human IgG (H&L) in immunological assays.
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified goat IgG.
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Human IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on human IgG • light chains on all human immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin human serum immunoglobulins • serum proteins from bovine, goat, mouse or rabbit .
Goat anti-Human IgG (H&L), HRP conjugated, min. cross-reactivity to rat IgG is a secondary antibody conjugated to HRP, which binds to human IgG (H&L) in immunological assays.
For reconstitution add 1,1 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Human IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.1% (v/v) Kathon CG is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on human IgG • light chains on all human immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin human serum immunoglobulins • rat IgG .
Goat anti-Human IgG (H&L), HRP conjugated, min. cross-reactivity to bovine, goat, mouse or rabbit serum proteins is a secondary antibody conjugated to HRP, which binds to human IgG (H&L) in immunological assays.
For reconstitution add 1,1 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Human IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.1% (v/v) Kathon CG is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on human IgG • light chains on all human immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin human serum immunoglobulins • serum proteins from bovine, goat, mouse or rabbit .
Goat anti-Human IgG (H&L), FITC conjugated, min. cross-reactivity to rat IgG is a secondary antibody conjugated to FITC, which binds to human IgG (H&L) in immunological assays.
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Human IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on human IgG • light chains on all human immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin human serum immunoglobulins • rat IgG .
Goat anti-Human IgG (H&L), FITC conjugated, min. cross-reactivity to bovine, goat, mouse or rabbit serum proteins is a secondary antibody conjugated to FITC, which binds to human IgG (H&L) in immunological assays.
Antibody purity is > 95% based on SDS-PAGE.Affinity purified using solid phase Human IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on human IgG • light chains on all human immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin human serum immunoglobulins • serum proteins from bovine, goat, mouse or rabbit .
NodGS (Nodulin/glutamate-ammonia ligase-like protein) shares homology with nodulins and self-assembles into oligomers which are present in response to flagellin treatment. It contains a C-terminal domain of a prokaryotic glutamine synthetase type I. Protein is mainly localized to cytoplasm and is present in a oligomeric form of ca. 700 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Medicago truncatula, Theobroma cacao Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from a C-terminal of Arabidopsis thaliana NodGS, UniProt: Q8W473 , TAIR: AT3G53180
Applications:
Immunoprecipitation (IP), Immunofluorescence (IF), Western blot (WB)
Immunogen affinity purified serum in PBS pH 7.4. with glycerol at 50 %.
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
94 | 90 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Doskocilova et al. (2011). A nodulin/glutamine synthetase-like fusion protein is implicated in the regulation of root morphogenesis and in signalling triggered by flagellin. Planta 234, 459–476. doi: 10.1007/s00425-011-1419-7
NodGS (Nodulin/glutamate-ammonia ligase-like protein) shares homology with nodulins and self-assembles into oligomers which are present in response to flagellin treatment. It contains a C-terminal domain of a prokaryotic glutamine synthetase type I. Protein is mainly localized to cytoplasm and is present in a oligomeric form of ca. 700 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Medicago truncatula, Theobroma cacao Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from a C-terminal of Arabidopsis thaliana NodGS, UniProt: Q8W473 , TAIR: AT3G53180
Applications:
Immunoprecipitation (IP), Immunofluorescence (IF), Western blot (WB)
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Doskocilova et al. (2011). A nodulin/glutamine synthetase-like fusion protein is implicated in the regulation of root morphogenesis and in signalling triggered by flagellin. Planta 234, 459–476. doi: 10.1007/s00425-011-1419-7
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
recombinant sHSP with ACD domain
Expected Species:
ACD domain of sHSP
Immunogen:
KLH-conjugated peptide derived from sequences of ACD domain
Antibody is purified on Protein A.Sensitivity: WB (with ECL): 1-10 ng of purified RFP or RFP fusion proteins. Primary antibody should be incubated for one hour at room temperature.
Application Details:
1 : 1000-3000 (WB)
Conjugation:
IgG1
Isotype:
IgG1
Purity:
Total IgG1. Protein A purified in 1mg/mL in 10mM PBS, pH 7.2. Contains 0.05% sodium azide.
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Cecchini et al. (2020). Kinases and protein motifs required for AZI1 plastid localization and trafficking during plant defense induction. Plant J. 2020 Dec 20. doi: 10.1111/tpj.15137. Epub ahead of print. PMID: 33342031.
Special application note:
Exact working dilution for Dot Blot, ELISA and IP needs to be determined experimentally
V5-tag is a tag that can be added to a protein of interest as a fusion protein to enable purification and detection.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to 3 years. Re-constituted antibody can be stored at 4°Cfor several days to weeks. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Antibody is purified on Protein A.For western blot incubate antibody for one hour at room temperature.
Application Details:
1 : 500-1 :2000 (IHC) , 1 : 1000-1: 3000 (WB)
Conjugation:
IgG1
Isotype:
IgG1
Purity:
Total IgG. Protein A purified from culture supernatant of hybridoma cells grown in a bioreactor. Provided in 10 mM PBS, pH 7.2, with 1% BSA and 0.05% sodium azide.
Reconstitution:
For reconstitution add 50 l of sterile water
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Exact working dilution for Dot Blot, ELISA and IP needs to be determined experimentally
Methylated Lysine is involved in post-translational modifications of proteins which play a critical role in the regulation and function of many known biological processes. Proteins can be post-translationally modified in many different ways, and a common post-transcriptional modification of Lysine involves methylation.This antibody is conjugated to FITC.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C for 1 year; make aliquots to avoid repeated freeze-thaw cycles.
Host Animal:
Rabbit
Species Reactivity:
Detects proteins containing methylated lysine residues in all specias
Immunogen:
KLH-conjugated methylated lysine
Applications:
ELISA (ELISA), Immunohistochemistry (IHC), Immunoprecipitation (IP), Western blot (WB)
Methylated Lysine is involved in post-translational modifications of proteins which play a critical role in the regulation and function of many known biological processes. Proteins can be post-translationally modified in many different ways, and a common post-transcriptional modification of Lysine involves methylation.This antibody is conjugated to APC (allophycocyanin).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C for 1 year; make aliquots to avoid repeated freeze-thaw cycles.
Host Animal:
Rabbit
Species Reactivity:
Detects proteins containing methylated lysine residues in all specias
Immunogen:
KLH-conjugated methylated lysine
Applications:
ELISA (ELISA), Immunohistochemistry (IHC), Immunoprecipitation (IP), Western blot (WB)
Methylated Lysine is involved in post-translational modifications of proteins which play a critical role in the regulation and function of many known biological processes. Proteins can be post-translationally modified in many different ways, and a common post-transcriptional modification of Lysine involves methylation.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C for 1 year; make aliquots to avoid repeated freeze-thaw cycles.
Host Animal:
Rabbit
Species Reactivity:
Detects proteins containing methylated lysine residues in all specias
Immunogen:
KLH-conjugated methylated lysine
Applications:
ELISA (ELISA), Immunohistochemistry (IHC), Immunoprecipitation (IP), Western blot (WB)
Acetylated Lysine is involved in post-translational modifications of proteins which play a critical role in the regulation and function of many known biological processes. Proteins can be post-translationally modified in many different ways, and a common post-transcriptional modification of Lysine involves acetylation.This antibody is conjugated to FITC.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°C.
Host Animal:
Rabbit
Species Reactivity:
Detects proteins containing acetylated lysine residues in all specias
Immunogen:
chemically modified KLH allowing acetylation of all lysines of this carrier protein
Applications:
ELISA (ELISA), Immunohistochemistry (IHC), Immunofluorescence (IF), Western blot (WB)
Acetylated Lysine is involved in post-translational modifications of proteins which play a critical role in the regulation and function of many known biological processes. Proteins can be post-translationally modified in many different ways, and a common post-transcriptional modification of Lysine involves acetylation.This antibody is conjugated to Alkaline phosphatase (ALP).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°C.
Host Animal:
Rabbit
Species Reactivity:
Detects proteins containing acetylated lysine residues in all specias
Immunogen:
chemically modified KLH allowing acetylation of all lysines of this carrier protein
Applications:
ELISA (ELISA), Immunohistochemistry (IHC), Immunoprecipitation (IP), Western blot (WB)
Acetylated Lysine is involved in post-translational modifications of proteins which play a critical role in the regulation and function of many known biological processes. Proteins can be post-translationally modified in many different ways, and a common post-transcriptional modification of lysine involves acetylation.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C for 1 year; make aliquots to avoid repeated freeze-thaw cycles.
Host Animal:
Rabbit
Species Reactivity:
Detects proteins containing acetylated lysine residues in all specias, No reaction to non-acetylated proteins
Immunogen:
chemically modified KLH allowing acetylation of all lysines of this carrier protein
Applications:
ELISA (ELISA), Immunohistochemistry (ICC), Immunofluorescence (IF), Immunoprecipitation (IP), Western blot (WB)
GFP (Green fluorescent protein) was originally identified in photo organs on jellyfish Aequorea victoria. It is a naturally fluorescent protein which emits green light at a maximum wavelength of 509 nm when excited by blue or UV light. It is extensively used in laboratory as a reporter molecule to label and study cellular and subcellular proteins in living cells using a wide range of applications. GFP protein has molecular weight of 27 kDa.Source of GFP standard: Wild type recombinant GFP from A. victoria was expressed in E. coli.
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store in undiluted aliquots at -20 °C; to avoid repeated freeze-thaw cycles. Store up to 24 months.
GFP (Green fluorescent protein) was originally identified in photo organs on jellyfish Aequorea victoria. It is a naturally fluorescent protein which emits green light at a maximum wavelength of 509 nm when excited by blue or UV light. It is extensively used in laboratory as a reporter molecule to label and study cellular and subcellular proteins in living cells using a wide range of applications. Antibodies to GFP protein are used in immunoblotting and ELISA. GFP protein has molecular weight of 27 kDa. This antibody is directly conjugated to soyabean peroxidase.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cor in small aliquotes at -20 °C; avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Native GFP, Recombinant GFP (E,coli), all variants of GFP
Immunogen:
highly purified native GFP protein derived from Aequorea victoria, UniProt: P42212
Applications:
ELISA (ELISA), Immunogold (IG), Immunohistochemistry (IHC), Western blot (WB)
GFP (Green fluorescent protein) was originally identified in photo organs on jellyfish Aequorea victoria. It is a naturally fluorescent protein which emits green light at a maximum wavelength of 509 nm when excited by blue or UV light. It is extensively used in laboratory as a reporter molecule to label and study cellular and subcellular proteins in living cells using a wide range of applications. Antibodies to GFP protein are used in immunoblotting and ELISA. GFP protein has molecular weight of 27 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Native GFP, Recombinant GFP (E.coli), all variants of GFP and EGFP
Immunogen:
highly purified native GFP protein derived from Aequorea victoria, UniProt: P42212
Wieczorek et al. (2020) Development of a New Tomato Torrado Virus-Based Vector Tagged with GFP for Monitoring Virus Movement in Plants. Viruses. 2020 Oct 20;12(10):1195. doi: 10.3390/v12101195. PMID: 33092281; PMCID: PMC7588970.
GFP (Green fluorescent protein) was originally identified in photo organs on jellyfish Aequorea victoria. It is a naturally fluorescent protein which emits green light at a maximum wavelength of 509 nm when excited by blue or UV light. It is extensively used in laboratory as a reporter molecule to label and study cellular and subcellular proteins in living cells using a wide range of applications. Antibodies to GFP protein are used in immunoblotting and ELISA. GFP protein has molecular weight of 27 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4 C; make aliquots to avoid working with a stock. Or Store in small aliquots at -20 °C, Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
Native GFP, Recombinant GFP (E,coli), all variants of GFP
Immunogen:
highly purified native GFP protein derived from Aequorea victoria, UniProt: P42212
SPSC is a protein involved in the photosynthetic sucrose synthesis, as a catalyst of the rate-limiting step of from UDP-glucose and fructose- 6-phosphate. It is also a part of the regulation of carbon partioning in plant leaves.Alternative names: SPS4, SPS4F, Sucrose phosphate synthase 4F, UDP-glucose-fructose-phosphate glucosyltransferase
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Phaseolus vulgaris
Expected Species:
Corchorus olitorius (A0A1R3I4K1), Gossypium hirsutum (A0A1U8K702)Species of your interest not listed? Contact us
SPSA1 catalyzes the rate-limiting step of sucrose biosynthesis from UDP-glucose and fructose-6-phosphate. It plays a role in regulation of carbon partitioning in the leaves of plants. Furthermore, it is important for sucrose availability which is essential for plant growth and fiber elongation. SPSA1 is also necessary for nectar secretion.Alternative names: Sucrose-phosphate synthase 1, SPS1, Sucrose-phosphate synthase 1F, SPS1F, Sucrose-phosphate synthase 5.1, SPS5.1, UDP-glucose-fructose-phosphate glucosyltransferase
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Arabidopsis alpina, Brassica napus, Eutremas alsugineum, Glycine max, Glycine soja Species of your interest not listed? Contact us
APX plays a key role in plant antioxidant system by reducing hydrogen peroxide to water.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii
Expected Species:
Coccomyxa subellipsoidea C-169,yanidioschyzon merolae, Micromonas pusilla (strain CCMP1545), Nannochloropsis gaditana, Ostreococcus lucimarinus (strain CCE9901), Ulva fasciata, Volvox carteriSpecies of your interest not listed? Contact us
Catalase is an enzyme found in most living organisms which is catalazying decomposition of hydrogen peroxide to water and oxygen.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii, Scenedesmus sp.
Expected Species:
Coccomyxa subellipsoidea C-169, Nannochloropsis gaditana, Ulva prolifera, Zosteria marina Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide chosen from Chlamydomonas reinhardtii catalase sequence, UniProt: A8J537
KUA1 (MYB transcription factor) involved in regulation of hypocotyl elongation in response to darkness by enhancing auxin accumulation in a phytochrome-interacting factor (PIF) proteins-dependent manner. Promotes lateral roots formation and place a critical role in in developmentally regulated and dark-induced onset of leaf senescence by repressing the transcription of several genes involved in chloroplast function and responses to light and auxin. Promotes responses to auxin, abscisic acid (ABA), and ethylene. Alternative names: Myb-related protein H, AtMYBH, AtMYBS3, MYBS3-homolg protein, Protein KUODA1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Beta vulgaris
Expected Species:
Capsicum annuum, Cephalotus follicularis, Cicer arietinum, Glycine max, Glycine soja, Gossypium arboretum, Cucumis melo, Medicago truncatula, Nelumbo nucifera, Nicotiana tabacum, Nicotiana sylvestris, Theobroma cacao, Vigna radiata var. radiata Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana KUA1 protein sequence, UniProt: Q9LVS0, TAIR:AT5G47390 .The peptide used to elicit this antibody is also conserved in MYB1R1 of Triticum urartu UniProt:M7YW99 and MYBS3 of Oryza sativa subsp. japonica, UniProt: Q7XC57-2
The antibody was used in tissue printing on German sugar beet and was found in vascular bundles
Application Details:
1 : 5000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
39,6 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Pandey et al. (2019). Epigenetic control of UV-B-induced flavonoid accumulation in Artemisia annua L. Planta. 2019 Feb;249(2):497-514. doi: 10.1007/s00425-018-3022-7.
GFP (Green fluorescent protein) was originally identified in photo organs on jellyfish Aequorea victoria. It is a naturally fluorescent protein which emits green light at a maximum wavelength of 509 nm when excited by blue or UV light. It is extensively used in laboratory as a reporter molecule to label and study cellular and subcellular proteins in living cells using a wide range of applications. Antibodies to GFP protein are used in immunoblotting and ELISA. GFP protein has molecular weight of 27 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Native GFP, Recombinant GFP (E,coli), all variants of GFP, including EGFP
Immunogen:
Highly purified native GFP protein derived from Aequorea victoria, UniProt: P42212
Applications:
ELISA (ELISA), Immunofluorescence (IF), Immunoprecipitation (IP), Western blot (WB)
Sun et al. (2021) The epigenetic factor FVE orchestrates cytoplasmic SGS3-DRB4-DCL4 activities to promote transgene silencing in Arabidopsis. Sci Adv. 2021 Aug 4;7(32):eabf3898. doi: 10.1126/sciadv.abf3898. PMID: 34348894; PMCID: PMC8336953.Stelate et al. (2021) Correlative Light-Environmental Scanning Electron Microscopy of Plasma Membrane Efflux Carriers of Plant Hormone Auxin. Biomolecules. 2021 Sep 26;11(10):1407. doi: 10.3390/biom11101407. PMID: 34680040; PMCID: PMC8533460.Wieczorek et al. (2020) Development of a New Tomato Torrado Virus-Based Vector Tagged with GFP for Monitoring Virus Movement in Plants. Viruses. 2020 Oct 20;12(10):1195. doi: 10.3390/v12101195. PMID: 33092281; PMCID: PMC7588970.Kulich et al. (2018). Deubiquitinase OTU5 affects Root Responses to Phosphate Starvation. Plant Physiol. 2018 Jan 4. pii: pp.01693.2017. doi: 10.1104/pp.17.01693.
Special application note:
10 mM TRIS buffer pH 8,0 containing 0,02% sodium azide
Rabbit anti-T7 is a primary antibody which binds to T7 and is directly conjugated to DyLight 550. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Rabbit anti-T7 is a primary antibody which binds to T7 and is directly conjugated to DyLight 488. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Rabbit anti-T7 is a primary antibody which binds to T7 and is directly conjugated to SureLight R-Phycoerythrin (R-PE).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
HSP26.5 | heat shock protein 26.5 (mitochondrial) belongs to small heat shock protein family and is localized in mitochondria.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Glycine soja Species of your interest not listed? Contact us
Please, note that there might be no HSPs accumulation below temperature of 32-34 C. HSPs are induced when the plant experience temperatures higher than the growing temperature with around 10 C. So, the HSPs induction temperatures for plants grown at 18C differ from these for plants grown at 24C.Another very effective parameter is the humidity. When using low humidity the plant has a chance to cool down through transpiration. In this case the HSPs induction requires higher temperatures.
Application Details:
1 : 1000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 25 l of sterile water
Molecular Weight:
26,5 | 23 kDa
Special application note:
Detection on total extracts needs to be optimized.Antibody is recognizing HSP23.6 synthesized in vitro using the PURExpress in Vitro Protein Synthesis Kt (NEB).
HSP23.6 (heat shock protein 23.6 (mitochondrial)) belongs to small heat shock protein family and is localized in mitochondria. Short name: AtHsp23.6.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Please, note that there might be no HSPs accumulation below temperature of 32-34 C. HSPs are induced when the plant experience temperatures higher than the growing temperature with around 10 C. So, the HSPs induction temperatures for plants grown at 18C differ from these for plants grown at 24C.Another very effective parameter is the humidity. When using low humidity the plant has a chance to cool down through transpiration. In this case the HSPs induction requires higher temperatures.
Application Details:
1 : 1000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
23,6 | 18 kDa
Selected references:
Cha et al. (2020). Humic acid enhances heat stress tolerance via transcriptional activation of Heat-Shock Proteins in Arabidopsis. Sci Rep. 2020 Sep 14;10(1):15042.doi: 10.1038/s41598-020-71701-8.
Special application note:
Detection on total extracts needs to be optimized.Antibody is recognizing HSP23.6 synthesized in vitro using the PURExpress in Vitro Protein Synthesis Kt (NEB).Antibody is not cross reacting with cytosolic HSPs.
Rabbit anti-T7 is a primary antibody which binds to T7 and is directly conjugated to DyLight 650. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Rabbit anti-T7 is a primary antibody which binds to T7 and is directly conjugated to Biotin.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Rabbit anti-T7 is a primary antibody which binds to T7 and is directly conjugated to ALP, Alkaline Phosphatase. This is of advantage to shorten assay time by no need to use a secondary antibody to T7.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Rabbit anti-S is a primary antibody which binds to S and is directly conjugated to Biotin. This is of advantage to shorten assay time by no need to use a secondary antibody to S.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Rabbit anti-S is a primary antibody which binds to S and is directly conjugated to ALP, Alkaline Phosphatase. This is of advantage to shorten assay time by no need to use a secondary antibody to S.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Rabbit anti-S is a primary antibody which binds to S and is directly conjugated to DyLight 550. This is of advantage to shorten assay time by no need to use a secondary antibody to S. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Rabbit anti-S is a primary antibody which binds to S and is directly conjugated to DyLight 488. This is of advantage to shorten assay time by no need to use a secondary antibody to S. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Rabbit anti-S is a primary antibody which binds to S and is directly conjugated to SureLight R-Phycoerythrin (R-PE). This is of advantage to shorten assay time by no need to use a secondary antibody to S.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Rabbit anti-S is a primary antibody which binds to S and is directly conjugated to DyLight 650. This is of advantage to shorten assay time by no need to use a secondary antibody to S. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Rabbit anti-V5 is a primary antibody which binds to V5 and is directly conjugated to SureLight R-Phycoerythrin (R-PE).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Rabbit anti-V5 is a primary antibody which binds to V5 and is directly conjugated to DyLight 650. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Rabbit anti-V5 is a primary antibody which binds to V5 and is directly conjugated to DyLight 550. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Rabbit anti-V5 is a primary antibody which binds to V5 and is directly conjugated to DyLight 488. This is of advantage to shorten assay time by no need to use a secondary antibody to V5. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Rabbit anti-V5 is a primary antibody which binds to V5 and is directly conjugated to ALP, Alkaline Phosphatase.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Rabbit anti-HA is a primary antibody which binds to HA and is directly conjugated to DyLight 650. This is of advantage to shorten assay time by no need to use a secondary antibody to HA. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
RBOHD (Respiratory burst oxidase homolog protein D) is a Calcium-dependent NADPH oxidase that generates superoxide. Is involved in the generation of reactive oxygen species (ROS) during incompatible interactions with pathogens and in UV-B and abscisic acid ROS-dependent signaling.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
For solubilization we recommend 65 C for 5 min, Sample boiling is not recommended
Application Details:
1 : 1000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
104 kDa
Not reactive in:
Marchantia polymorpha, Medicago sativa
Selected references:
Wang et al. (2021) Arabidopsis PUB2 and PUB4 connect signaling components of pattern-triggered immunity. New Phytol. 2021 Dec 17. doi: 10.1111/nph.17922. Epub ahead of print. PMID: 34918346Lee et al. (2020). Regulation of reactive oxygen species during plant immunity through phosphorylation and ubiquitination of RBOHD. Nat Commun. 2020 Apr 15;11(1):1838. doi: 10.1038/s41467-020-15601-5.Jedelsk et al. (2019). Tomato Root Growth Inhibition by Salinity and Cadmium Is Mediated By S-Nitrosative Modifications of ROS Metabolic Enzymes Controlled by S-Nitrosoglutathione Reductase. Biomolecules. 2019 Aug 21;9(9). pii: E393. doi: 10.3390/biom9090393.Otulak-Kozie? et al. (2019). The Respiratory Burst Oxidase Homolog D (RbohD) Cell and Tissue Distribution in Potato–Potato Virus Y (PVYNTN) Hypersensitive and Susceptible Reactions. Int. J. Mol. Sci. 2019, 20(11), 2741. (innunofluorescence)
Rabbit anti-HA is a primary antibody which binds to HA and is directly conjugated to DyLight 550. This is of advantage to shorten assay time by no need to use a secondary antibody to HA. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Rabbit anti-HA is a primary antibody which binds to HA and is directly conjugated to DyLight 488. This is of advantage to shorten assay time by no need to use a secondary antibody to HA. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Rabbit anti-HA is a primary antibody which binds to HA and is directly conjugated to SureLight R-Phycoerythrin. This is of advantage to shorten assay time by no need to use a secondary antibody to HA.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Rubisco (Ribulose-1,5-bisphosphate carboxylase/oxygenase) catalyzes the rate-limiting step of CO2 fixation in photosynthetic organisms. Form II Rubisco is present in many photosynthetic bacteria and archaea and in some photosynthetic dinoflagellates.Source of Rubisco standard: Overexpressed RbcL form II protein
Product Type:
Antibody
Format:
Lyophilized in glycerol.
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Concentration: after re-constitution with sterile milliQ water final concentration of the standard is 0.15 pmoles/ lProtein standard buffer composition: Glycerol 10%, Tris Base 141 mM, Tris HCl 106 mM, LDS 2%, EDTA 0.51 mM, SERVA Blue G250 0.22 mM, Phenol Red 0.175 mM, pH 8.5, 0.1mg/ml PefaBloc protease inhibitor (Roche), 50 mM DTT.This standard is ready-to-load and does not require any additions or heating. It needs to be fully thawed and thoroughly mixed prior to using. Avoid vigorous vortexing, as buffers contain detergent. Following mixing, briefly pulse in a microcentrifuge to collect material from cap.This standard is stabilized and ready and does not require heating before loading on the gel. Please note that this product contains 10% glycerol and might appear as liquid but is provided lyophilized. Allow the product several minutes to solubilize after adding water. Mix thoroughly but gently Take extra care to mix thoroughly before each use, as the proteins tend to settle with the more dense layer after freezing.Please, use the 55 kDa size of RbcL for calculations. The pmoles in the standard refer to pmoles of rbcL monomers.
Application Details:
Standard curve: 3 loads are recommended (0.5, 2 and 4μl).For most applications a sample load of 0.2 μg of chlorophyll/well will give a RbcL signal in this range.Positive control: a 2 μl load per well is optimal for most chemiluminescent detection systems. Higher standard concentration needs to be used to allow detection by Coomasie stains. Such gels with higher standard concentration can not be used for quantitation using chemiluminescence.This standard is stabilized and ready and does not require heating before loading on the gel.Please note that this product contains 10% glycerol and might appear as liquid but is provided lyophilized. Allow the product several minutes to solubilize after adding water. Mix thoroughly but gently Take extra care to mix thoroughly before each use, as the proteins tend to settle with the more dense layer after freezing.
Reconstitution:
For reconstitution add 90 μl of sterile water, Please notice that this product contains 10% glycerol and might appear as liquid but is provided lyophilized
Molecular Weight:
52,7 kDa
Selected references:
Bausch et al. (2019). Combined effects of simulated acidification and hypoxia on the harmful dinoflagellate Amphidinium carterae. Mar Biol 166: 80. https://doi.org/10.1007/s00227-019-3528-y.
Special application note:
The RbcL protein standard can be used in a combination with Agrisera global antibiodies (AS15 2955 from rabbit) to quantitate RbcL from a wide range of species. Global antibodies are raised against highly conserved amino acid sequence. This standard is also included in following kits: Educational antibody kit - photosynthesis, Photosynthesis Tool Kit - quantitation, Rubico quantitation kit,Quantitative western blot: detailed method description, video tutorial
Rubisco (Ribulose-1,5-bisphosphate carboxylase/oxygenase) catalyzes the rate-limiting step of CO2 fixation in photosynthetic organisms. Form II Rubisco is present in many photosynthetic bacteria and archaea and in some photosynthetic dinoflagellates. The large subunit (LSU) of form I Rubisco is encoded by the RbcL/cbbL gene, while form II LSU is encoded by cbbM.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Acidithiobacillus ferrooxidans, Dechloromonas aromatica, Gonyaulax polyedra, Leptothrix cholodnii, Magnetovibrio blakemorei, Rhodobacter sphaeroides, Thiobacillus denitrificans, Rhodopseudomonas palustrisand with a signle mismatch in one amino acid: Gallionella capsiferriformans, Mariprofundus ferrooxydans, Thioalkalicoccus limnaeus, Methanomethylovorans hollandica, Methanococcoides burtonii, Methanosaeta concili, Methanolobus tindarius, Methanohalophilus mahii, and the dinoflagellate Symbiodinium sp. (ex Stylophora pistillata)Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide conserved in known RbcL form II protein sequences
Protein extraction from diatoms protocol can be found here.
Application Details:
1:10 000 (IF), (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
51,7 kDa
Not reactive in:
Burkholderi, Cyanobium sp.
Selected references:
Cho et al. (2021). SxtA localizes to chloroplasts and changes to its 3'UTR may reduce toxin biosynthesis in non-toxic Alexandrium catenella (Group I). Harmful Algae, 2021,101972,ISSN 1568-9883, https://doi.org/10.1016/j.hal.2020.101972. ImmunolocalizationBausch et al. (2019). Combined effects of simulated acidification and hypoxia on the harmful dinoflagellate Amphidinium carterae. Marine Biology, June 2019, 166:80.Long et al. (2018). Carboxysome encapsulation of the CO2-fixing enzyme Rubisco in tobacco chloroplasts. Nat Commun. 2018 Sep 3;9(1):3570. doi: 10.1038/s41467-018-06044-0.
Mouse anti-DYKDDDDK is a primary antibody which binds to DYKDDDDK (Sigma FLAG ) and is directly conjugated to DyLight 488. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. Shelf life: 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Mouse anti-DYKDDDDK is a primary antibody which binds to DYKDDDDK (binds to Sigma FLAG ) and is directly conjugated to SureLight R-Phycoerythrin.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Mouse anti-DYKDDDDK is a primary antibody which binds to DYKDDDDK (Sigma FLAG ) and is directly conjugated to DyLight 650. This is of advantage to shorten assay time by no need to use a secondary antibody.DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Mouse anti-c-myc is a primary antibody which binds to c-myc tag and is directly conjugated to DyLight 550. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Host Animal:
Mouse
Immunogen:
epitope EQKLISEEDL sequence from the human c-myc protein
Mouse anti-c-myc is a primary antibody which binds to c-myc tag and is directly conjugated to DyLight 488. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Host Animal:
Mouse
Immunogen:
epitope EQKLISEEDL sequence from the human c-myc protein
Mouse anti-c-myc is a primary antibody which binds to c-myc tag and is directly conjugated to SureLight R-Phycoerythrin.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20 °C.
Host Animal:
Mouse
Immunogen:
epitope EQKLISEEDL sequence from the human c-myc protein
Mouse anti-c-myc is a primary antibody which binds to c-myc tag which is directly conjugated to DyLight 650. This is of advantage to shorten assay time. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Host Animal:
Mouse
Immunogen:
epitope EQKLISEEDL sequence from the human c-myc protein
Mouse anti-c-myc is a primary antibody which binds to c-myc and is directly conjugated to ALP, Alkaline Phosphatase. This is of advantage to shorten assay time by no need to use a secondary antibody.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Host Animal:
Mouse
Immunogen:
epitope EQKLISEEDL sequence from the human c-myc protein
His-Tag is a polyhistidine tag which consists of 6 histidine residues introduced on N- or C-terminus of the protein. The polyhistidine-tag can be used for recombinant protein detection using specific antibodies and it is not conjugated to any dye or enzyme.
Mouse anti-6x Histidine is a primary antibody which binds to 6x Histidine and is directly conjugated to ALP, Alkaline Phosphatase. This is of advantage to shorten assay time by no need to use a secondary antibody to 6x Histidine tag.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Final primary antibody dilution, depend upon amount of Hisx6 tagged protein in analyzed sample.
Application Details:
1: 5000 - 10 000 (WB)
Purity:
Immunogen affinity purified in 25 mM Tris, 150 mM NaCl, 5 mM MgCl2, 0.12 mM ZnCl2, pH 7.4. with 2 mM sodium azide.
Reconstitution:
For reconstitution add 100 µl of sterile water
Molecular Weight:
depends upon fusion partner
Special application note:
Antibody is provided in: 25 mM Tris, 150 mM Sodium Chloride, 5 mM Magnesium Chloride, 0.12 mM Zinc Chloride, 2 mM Sodium Azide (pH 7.4)Concentration: 0.1mg/ml
Mouse anti-6x Histidine is a primary antibody which binds to 6x Histidine tag and is directly conjugated to Biotin. This is of advantage to shorten assay time by no need to use a secondary antibody to 6x Histidine tag.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Mouse anti-6x Histidine is a primary antibody which binds to 6x Histidine tag and is directly conjugated to DyLight 650. This is of advantage to shorten assay time by no need to use a secondary antibody to 6x Histidine tag. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Host Animal:
Mouse
Immunogen:
Polyhistidine (HHHHHH) tagged polypeptide
Applications:
High throughput screening (HTS), Immunofluorescence (IF), Immunohistochemisty (IHC), Western blot (WB)
Mouse anti-6x Histidine is a primary antibody which binds to 6x Histidine tag and is directly conjugated to Europium. This is of advantage to shorten assay time by no need to use a secondary antibody to 6x Histidine tag.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Mouse anti-6x Histidine is a primary antibody which binds to 6x Histidine tag and is directly conjugated to SureLight R-Phycoerythrin. This is of advantage to shorten assay time by no need to use a secondary antibody to 6x Histidine tag.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Mouse anti-6x Histidine is a primary antibody which binds to 6x Histidine tag and is directly conjugated to HRP. This is of advantage to shorten assay time by no need to use a secondary antibody to 6x Histidine tag.
Mouse anti-6x Histidine is a primary antibody which binds to 6x Histidine tag and is directly conjugated to DyLight 550. This is of advantage to shorten assay time by no need to use a secondary antibody to 6x Histidine tag. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Mouse anti-6x Histidine is a primary antibody which binds to 6x Histidine tag and is directly conjugated to DyLight 488. This is of advantage to shorten assay time by no need to use a secondary antibody to 6x Histidine tag. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
NAD6 (NADH-ubiquinone oxidoreductase chain 6) is involved in cellular respiration, oxidation-reduction process. Protein is a part of mitochondrial respiratory chain complex I and displays NADH dehydrogenase activity.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Wei et al. (2019). Arabidopsis mtHSC70-1 plays important roles in the establishment of COX-dependent respiration and redox homeostasis. J Exp Bot. 2019 Aug 6. pii: erz357. doi: 10.1093/jxb/erz357.Colas des Francs-Small et al. (2018). Targeted cleavage of nad6 mRNA induced by a modified pentatricopeptide repeat protein in plant mitochondria. Commun Biol. 2018 Oct 11;1:166. doi: 10.1038/s42003-018-0166-8.
Mouse anti-HA is a primary antibody which binds to HA and is directly conjugated toDyLight 650. This is of advantage to shorten assay time by no need to use a secondary antibody to HA. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Host Animal:
Mouse
Immunogen:
HA-tag:YPYDVPDYA
Applications:
Flow cytometry (Flow cyt) and Cell Based Assays (CBA)(CBA)
Mouse anti-HA is a primary antibody which binds to HA and is directly conjugated to HRP. This is of advantage to shorten assay time by no need to use a secondary antibody to HA.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized. Reconstitute in 1 ml of distilled, deionized water. Vortex gently and let sit on ice for 20 minutes.
Mouse anti-HA is a primary antibody which binds to HA and is directly conjugated to biotin. This is of advantage to shorten assay time since there is no need to use a secondary antibody to HA.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Mouse anti-HA is a primary antibody which binds to HA and is directly conjugated to Alkaline Phosphatase . This is of advantage to shorten assay time when no need to use a secondary antibody to HA.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified in 25 mM Tris, 150 mM NaCl, 5 mM MgCl2, 0.12 mM ZnCl2, pH 7.4. with 2 mM sodium azide.
Selected references:
Wang et al. (2017). The inhibition of protein translation mediated by AtGCN1 is essential for cold tolerance in Arabidopsis thaliana. Plant Cell Environ. 2017 Jan;40(1):56-68. doi: 10.1111/pce.12826.
Special application note:
Antibody is provided in: 25 mM Tris, 150 mM Sodium Chloride, 5 mM Magnesium Chloride, 0,12 mM Zinc Chloride, pH 7,4 with 2 mM Sodium Azide
Mouse anti-HA is a primary antibody which binds to HA and is directly conjugated toDyLight 550. This is of advantage to shorten assay time by no need to use a secondary antibody to HA. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Mouse anti-HA is a primary antibody which binds to HA and is directly conjugated toDyLight 488. This is of advantage to shorten assay time by no need to use a secondary antibody to HA. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Mouse anti-HA is a primary antibody which binds to HA and is directly conjugated to SureLight R-Phycoerythrin. This is of advantage to shorten assay time by no need to use a secondary antibody to HA.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Host Animal:
Mouse
Immunogen:
HA-tag: YPYDVPDYA
Applications:
Flow Cytometry (FL), Cell Based Assays (CBA)(CBA), Microarrays (MA), and Microplate applications (MPl)
Goat anti-GST is a primary antibody which binds to GST which is directly conjugated to DyLight 550. This is of advantage to shorten assay time by no need to use a secondary antibody to GST. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Goat anti-GST is a primary antibody which binds to GST and is directly conjugated to DyLight 488. This is of advantage to shorten assay time by no need to use a secondary antibody to GST. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Goat anti-GST is a primary antibody to GST directly conjugated to SureLight R-Phycoerythrin.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Host Animal:
Goat
Immunogen:
Glutathione-S-transferase from S. japonicum
Applications:
Flow cytometry (Flow cyt), Cell Based Assays (CBA)(CBA), Microarrays (MA), and Microplate applications (MPl)
Goat anti-GST IgG is a primary antibody which binds to GST and is directly conjugated to DyLight 650. This is of advantage to shorten assay time by no need to use a secondary antibody to GST. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C.; Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
PntA (Slr1239) (Pyridine nucleotide transhydrogenase alpha-subunit) is an integral mambrane protein complex which participates in the regulation of ion of NAD(P)+:NAD(P)H redox homeostasis. Functional enzyme is a dimer of PntA and PntB.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Synechocystis sp. PCC6803
Expected Species:
Bacillus subtilis, Cyanothece sp. PCC 7822, Desulfobulbaceae bacterium BRH_c16a, Elusimicrobia bacterium, Fischerella sp. JSC-11, Hapalosiphon sp. MRB220, Magnetococcus marinus, Moorea producens JHB , Pleurocapsa sp. PCC 7327, Stanieria cyanosphaera Species of your interest not listed? Contact us
K m r inen et al. (2017). Pyridine nucleotide transhydrogenase PntAB is essential for optimal growth and photosynthetic integrity under low-light mixotrophic conditions in Synechocystis sp. PCC 6803. New Phytol. 2017 Apr;214(1):194-204. doi: 10.1111/nph.14353.
FNR (ferredoxin-NADP+-oxidoreductase) catalyzes reduction of NADP+ using Fd that has accepted electrons from photosystem II in the final step of linear photosynthetic electron transport. In higher plants FNRs are encoded by a small multiple gene family (two chloroplast-targeted FNR in Arabidopsis and rice and three isoenzymes in maize). All forms are evenly distributed between the thylakoids and stroma.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
For detection in Chlorella sorokiniana, Synechococcus PCC 6803 higher load per well needs to be applied.This antibody recognizes all Arabidopsis thaliana FNR isoforms.This product can be sold with ProClin if requested
Application Details:
1 : 1000-1 : 3000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
35 kDa
Not reactive in:
Oryza sativa, Spinacia oleracea, Zea mays
Selected references:
Zhang et al. (2020). Enhanced Relative Electron Transport Rate Contributes To Increased Photosynthetic Capacity In Autotetraploid Pak Choi. Plant Cell Physiol. 2020 Jan 6. pii: pcz238. doi: 10.1093/pcp/pcz238.
Special application note:
Arabidopsis has four FNR proteins, two of them are found in leaves (LFNR1 and LFNR2) while the other two in roots (RFNR1 and RFNR2). Absence of one of leaf FNR results in a decrease in the amount of FNR while absence of both of them is lethal.
MKK2 (Mitogen-activated protein kinase kinase 2) together with MKK2 and MKK4 function in a signaling pathway that modulates the expression of genes responding to biotic and abiotic stresses as well as pathogen defense by negative relugation of innate immunity.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana (protoplasts)
Immunogen:
KLH-conjugated synthetic peptide derived from Arabidopsis thaliana sequence of MKK2, UniProt: Q9S7U9, TAIR: AT4G29810
TKL-1 (Transketolase-1, chloroplastic) is involved in the pathway of Calvin cycle. This enzyme is catalyzing the reversible transfer of a two-carbon ketol group from fructose-6-phopshate or sedoheptuloze-7-phosphate to glyceraldehyde-3-phosphate to yield xylulose-5-phosphate and erythrose-4-phosphate or ribose-5-phosphate. AtTKL1 is expressed in highest levels in photosynthetic tissue, while AtTKL2 is expressed mainly during embryo development. Alternative name: TK.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Pisum sativum
Expected Species:
Cucumis sativus, Synechococcus elongatus sp PCC 7942 Species of your interest not listed? Contact us
TKL1 has MW of 79.28 kDa with and 73.45 kDa without presequence; about 72 kDa on SDS gelAntibody works on whole leaf extracts and isolated chloroplasts and is also recognizing recombinant TKL protein.This product contains 10% glycerol and might appear as liquid but is provided lyophilized.
Application Details:
1 : 2000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 45 l of sterile water
Molecular Weight:
72 kDa
Selected references:
Rocha et al. (2014). Phosphorylation of Arabidopsis transketolase at Ser428 provides a potential paradigm for the metabolic control of chloroplast carbon metabolism. Biochem J. 2014 Mar 1;458(2):313-22. doi: 10.1042/BJ20130631.
TOM9 (Mitochondrial import receptor subunit TOM9) is a central component of the receptor complex responsible for recognition and translocation of cytosolically synthesized mitochondrial preproteins. Alternative names: Mitochondrial import receptor subunit TOM22 homolog 2, Translocase of outer membrane 22 kDa subunit homolog 2, Translocase of outer membrane 9 kDa subunit TOM9-2
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Hordeum vulgare, Musa sp., Oryza sativa, Phaseolus vulgaris, Physcomitrium patens, Ricinus communis, Solanum tuberosum, Triticum aestivum, Zea mays Species of your interest not listed? Contact us
Immunogen:
Recombinant full length protein (coding region) of Tom9.2 Arabidopsis thaliana UniProt: Q9FNC9 TAIR: AT5G43970
Antibody works on whole leaf extracts and isolated mitochondria; requires Tricine gels for sharp bands due to the small MW
Application Details:
1 : 1000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
10 | 9 kDa
Not reactive in:
Ostreococcus tauri
Selected references:
Kolodziejczak et al. (2018). m-AAA Complexes Are Not Crucial for the Survival of Arabidopsis Under Optimal Growth Conditions Despite Their Importance for Mitochondrial Translation. Plant Cell Physiol. 2018 May 1;59(5):1006-1016. doi: 10.1093/pcp/pcy041.
Rhodanese/cell cycle control phosphatase superfamily protein is localized in chloroplasts.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica napus, Gossypium arboreum Species of your interest not listed? Contact us
Lysine-tRNA ligase is located in chloroplast and involved in circadian rhytm.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
KLH-conjugated synthetic peptide derived from Lysine-tRNA ligase protein sequence of Arabidopsis thaliana UniProt: Q39101, TAIR: AT3G01060
This protein is present in very low levels, therefore western blot conditions need to be adjusted by higher protein load/well and usage of a very sensitive detection system
Ferritin forms a 24-subunit cage for storage of mineral iron. In plants, ferritin is predominantly localized in the plastids, and its expression is upregulated in response to iron or oxidative stress.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Purified ferritin from dried peas, Pisum sativum L. After extraction from pea flour, the ferritin was further purified by gel filtration chromatography to >95% purity as estimated from a Coomassie-stained gel.Antibody is most likely to bind to all ferritin isoforms from pea however it has not been confirmed as yet.
Note, the calculated molecular weight of pea ferritin is 28 kDa. Removal of the N-terminal targeting sequence upon protein import into plastids results in a protein with an apparent mol weight of ~23 kDa.This antibody is also recognizing horse ferritin (above 100 ng in Western blot).
Application Details:
1 : 5000-10 000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
23 kDa in legumes, 24 kDa (Arabidopsis thaliana)
Selected references:
Jiang et al. (2022) Reactive effects of pre-sowing magnetic field exposure on morphological characteristics and antioxidant ability of Brassica juncea in phytoextraction. Chemosphere. 2022 Sep;303(Pt 1):135046. doi: 10.1016/j.chemosphere.2022.135046. Epub 2022 May 23. PMID: 35618056.Bastow et al. (2018). Vacuolar Iron Stores Gated by NRAMP3 and NRAMP4 Are the Primary Source of Iron in Germinating Seeds. Plant Physiol. 2018 Jul;177(3):1267-1276. doi: 10.1104/pp.18.00478.
Beta amylase (EC 3.2.1.2) is an enzyme involved in the hydrolysis fo starch into sugars. Can play a minor role in the starch degradation and maltose metabolism in chloroplasts during the night.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
The mature length protein of Arabidopsis thaliana BAM1 overexpressed in E.coli, UniProt:Q9LIR6, TAIR: AT3G23920., lacking the transit peptide that is cleaved upon entry to the chloroplast. Recombinant protein had an N-terminal S-tag.
Glyceraldehyde-3-phosphate dehydrogenase is an enzyme that catalyzes the first step in glycolysis by converting D-glyceraldehyde 3-phosphate (G3P) into 3-phospho-D-glyceroyl phosphate. This enzyme is essential for the carbohydrate metabolism and the maintenance of cellular ATP levels. Synonyme gene names: GAPC, GAPDH.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store at 4 C; make aliquots to avoid working with a stock. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Use of this antibody as a loading control should be supported with specific experimental data
Application Details:
1 : 1000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
37 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Zhu et al. (2020). The RALF1-FERONIA Complex Phosphorylates eIF4E1 to Promote Protein Synthesis and Polar Root Hair Growth. Mol Plant. 2020 May 4;13(5):698-716. doi: 10.1016/j.molp.2019.12.014..
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Olea europaea L.
Immunogen:
KLH-conjugated synthetic peptide chosen from available beta-conglutin sequences.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Zafra et al. (2018). Histological features of the olive seed and presence of 7S-type seed storage proteins as hallmarks of the olive fruit development. Front. Plant Sci., 12 October 2018 |
8-hydroxy-2-deoxy Guanosine (8-OHdG) is produced by the oxidative damage of DNA by reactive oxygen and nitrogen species and serves as an established marker of oxidative stress. 1-4 Hydroxylation of guanosine occurs in response to both normal metabolic processes and a variety of environmental factors (i.e., anything that increases reactive oxygen and nitrogen species). Increased levels of 8-OHdG are associated with the aging process as well as with a number of pathological conditions including cancer, diabetes, and hypertension.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 4°C. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Mouse
Species Reactivity:
8-OHdG in cell culture, plasma, urine or other samples
Bassey et al. (2020). Cardiovascular disease risk factors and markers of oxidative stress and DNA damage in leprosy patients in Southern Nigeria. PLoS Negl Trop Dis. 2020 Oct 12;14(10):e0008749. doi: 10.1371/journal.pntd.0008749. PMID: 33044965; PMCID: PMC7580906.
Llama anti-Mouse IgG (H&L), HRP Conjugated is a secondary antibody which binds to heavy (γ) chains chains on mouse IgG light chains on all mouse immunoglobulins
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized material at 2-8°C. For long time storage after reconstitution, dilute the antibody solution with glycerol to a final concentration of 50% glycerol and store as liquid at -20 °C, to prevent loss of enzymatic activity. For example, if you have reconstituted 1 mg of antibody in 1,1 ml of sterile water add 1,1 ml of glycerol. Such solution will not freeze in -20 °C. If you are using a 1:5000 dilution prior to diluting with glycerol, then you would need to use a 1:2500 dilution after adding glycerol. Prepare working dilution prior to use and then discard, Be sure to mix well but without foaming.
Host Animal:
Llama
Species Reactivity:
Reacts with: heavy (?) chains chains on mouse IgG light chains on all on all mouse immunoglobulins
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified llama IgG.
Reconstitution:
For reconstitution add 1,1 ml of sterile water, Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Not reactive in:
Based on IEP, no reactivity is observed to:˖ non-immunoglobulin mouse serum proteins
Special application note:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free, 0.1% (v/v) Kathon CGBased on IEP, this antibody reacts with: heavy (γ) chains chains on mouse IgG light chains on all on all mouse immunoglobulins.Based on IEP, no reactivity is observed to:˖ non-immunoglobulin mouse serum proteins
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified mouse IgG.
Not reactive in:
Based on IEP, no reactivity is observed to:˖ non-immunoglobulin mouse serum proteins
Special application note:
Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 0.05 % (w/v) of Sodium azide as preservative.Antibody reacts with: heavy (γ) chains chains on mouse IgG light chains on all on all mouse immunoglobulinsBased on IEP, no reactivity is observed to:˖ non-immunoglobulin mouse serum proteins
Glutathione-S-transferase (GST1) is an enzyme which belongs to GST superfamily and has a transferase activity. It is coded by a gene GSTS1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii
Expected Species:
Volvox carteri Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from Glutathione-S-transferase protein sequence from Chlamydomonas reinhardtii, UniProt: A8JBA7
Roach et al. (2018). Distress and eustress of reactive electrophiles and relevance to light stress acclimation via stimulation of thiol/disulphide-based redox defences. Free Radic Biol Med. 2018 Mar 18. pii: S0891-5849(18)30134-5. doi: 10.1016/j.freeradbiomed.2018.03.030.Kumar and Chattopadhyay (2018). Glutathione modulates the expression of heat shock proteins via the transcription factors BZIP10 and MYB21 in Arabidopsis. J Exp Bot. 2018 Jun 27;69(15):3729-3743. doi: 10.1093/jxb/ery166.
Glutathione peroxidase (GPXh) is an enzyme from glutathione peroxidase family.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii
Expected Species:
Volvox carteri Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from glutathione peroxidase protein sequence from Chlamydomonas reinhardtii, UniProt: O22448
SBPase (Sedoheptulose-1,7-bis phosphatase) is a chloroplast enzyme involved in the carbon reduction of the Calvin cycle, part of carbohydrate metabolism.Source of SBPase standard: SBPase standard source is Sphingomonas wittichii strain RW1, overexpressed in E.coli bearing an N-terminal his6 tag.
Product Type:
Antibody
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Concentration: after re-constitution with sterile milliQ water final concentration of the standard is 0.15 pmoles/ lProtein standard buffer composition: Glycerol 10%, Tris Base 141 mM, Tris HCl 106 mM, LDS 2%, EDTA 0.51 mM, SERVA Blue G250 0.22 mM, Phenol Red 0.175 mM, pH 8.5, 0.1mg/ml PefaBloc protease inhibitor (Roche), 50 mM DTT.This standard is ready-to-load and does not require any additions or heating. It needs to be fully thawed and thoroughly mixed prior to using. Avoid vigorous vortexing, as buffers contain detergent. Following mixing, briefly pulse in a microcentrifuge to collect material from cap.This standard is stabilized and ready and does not require heating before loading on the gel. Please note that this product contains 10% glycerol and might appear as liquid but is provided lyophilized. Allow the product several minutes to solubilize after adding water. Mix thoroughly but gently Take extra care to mix thoroughly before each use, as the proteins tend to settle with the more dense layer after freezing.
Application Details:
Standard curve: 3 loads are recommended (0.5, 2 and 4μl).For most applications a sample load of 0.2 μg of chlorophyll/well will give a RbcL signal in this range.Positive control: a 2 μl load per well is optimal for most chemiluminescent detection systems. Higher standard concentration needs to be used to allow detection by Coomasie stains. Such gels with higher standard concentration can not be used for quantitation using chemiluminescence.This standard is stabilized and ready and does not require heating before loading on the gel.Please note that this product contains 10% glycerol and might appear as liquid but is provided lyophilized. Allow the product several minutes to solubilize after adding water. Mix thoroughly but gently Take extra care to mix thoroughly before each use, as the proteins tend to settle with the more dense layer after freezing.
Reconstitution:
For reconstitution add 85 l of sterile water, Please note that this product contains glycerol and might appear as liquid but is provided lyophilized
Molecular Weight:
27 kDa
Special application note:
The SBPase calibrated protein standard can be used in combination with Agrisera global anti-SBPase antibiodies (AS15 2873) to quantitate SBPase from a wide range of species. Global antibodies are raised against highly conserved amino acid sequence. Quantitative western blot: detailed method description and video tutorial.
SBPase (Sedoheptulose-1,7-bis phosphatase) is a chloroplast enzyme involved in the carbon reduction of the Calvin cycle, part of carbohydrate metabolism.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Li et al. (2021) Did breeding alter the light environment, photosynthetic apparatus and photosynthetic capacity of wheat leaves? J Exp Bot. 2021 Nov 10:erab495. doi: 10.1093/jxb/erab495. Epub ahead of print. PMID: 34758079.Hammel et al. (2020) Photosynthesis in Chlamydomonas reinhardtii and Has No Effect on the Abundance of Other Calvin-Benson Cycle Enzymes. Front Plant Sci. 2020 Jun 23;11:868. doi: 10.3389/fpls.2020.00868. PMID: 32655601; PMCID: PMC7324757.Fukayama et al. (2018). Expression level of Rubisco activase negatively correlates with Rubisco content in transgenic rice. Photosynth Res. 2018 May 30. doi: 10.1007/s11120-018-0525-9.Li et al. (2018). Comparative proteomic analysis of key proteins during abscisic acid-hydrogen peroxide-induced adventitious rooting in cucumber (Cucumis sativus L.) under drought stress. Journal of Plant Physiology Volume 229, October 2018, Pages 185-194.
PSA3 (Photosystem I Assembly 3) is involved in promotion of photosystem I biogenesis in angiosperms. It is a nucleus-encoded protein.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles,Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Zea mays
Immunogen:
Recombinant PSA3, amino acids 110 to 269 derived from Zea mays Zm00001d013295
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Shen J, Williams-Carrier R, and Barkan A. (2017) PSA3, a protein on the stromal face of the thylakoid membrane, promotes photosystem I accumulation in cooperation with the assembly factor PYG7. Plant Physiol. 2017 Jul;174(3):1850-1862. doi: 10.1104/pp.17.00524.
FLAG-tag is a tag that can be added to a protein sequence motif DYKXXD. It can be used for affinity chromatography, to separate recombinant protein from wt proteins. It can also be used to isolate protein complexes with multiple subunits.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C for up to 2 years.
Host Animal:
Mouse
Species Reactivity:
N-terminal, C-terminal or internal DYKDDDDK-tagged fusion proteins
Immunogen:
KLH-conjugated DYKDDDDK (FLAG) synthetic peptide
Applications:
Dot blot (Dot), ELISA (ELISA), Immunohistochemistry (IHC), Immunoprecipitation (IP), Western blot (WB)
1 : 1000-5000 (1-5ng) (WB) (incubate for one hour at room temperature), 1 : 500-1 :2000 (IS) For best results with other assays (Dot, ELISA, IP), please determine optimal working dilution by end user
Conjugation:
IgG1
Isotype:
IgG1
Purity:
Total IgG. Protein A purified in 10mM PBS, pH 7.2, with 1% BSA and 0.05% sodium azide.
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Working dilution for Dot Blot, ELISA and IP needs to be determined experimentally.Antibody is purified on Protein A.
IFN alpha (interferon alpha) is produced by macrophages and have antiviral activities. It stimulated production of protein kinase and an oligoadenulate synthetase.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Immunogen affinity purified in a carbonate buffer pH 8-8.5 with NaCl and 0.02 % sodium azide.
Reconstitution:
For reconstitution add 100 µl of sterile water
Molecular Weight:
19-27 kDa (in reduced conditions)
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Antibodies are purified on a leukocyte IFN affinity column and resulting purity is >95 %, analyzed by coomassie stained SDS-PAGE gels. The antibodies react with 12 different commercially available recombinant subtypes of human IFN-alpha, with lowest reactivity to interferon alpha-17.
RpoC1 (RNA polymerase beta' subunit (chloroplast)) is a DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
RpoB (RNA polymerase beta subunit (chloroplast)) is a DNA-dependent RNA polymerase which catalyzes the transcription of DNA into RNA using the four ribonuceloside triphosphates as substrates.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Zea mays
Expected Species:
Alloteropsis semialata, Coleataenia prionitis, Digitaria exilis, Echinochloa crus-galli var. crus-galli , Eragrostis tef, Microlaena stipoides, Hordeum vulgare, Miscanthus sacchariflorus, Oryza sativa, Phragmites australis, Potamophila parviflora, Rhynchoryza subulata, Saccharum officinarum, Setaria italica, Sorghum bicolor, Stipa lipskyi, Sporobolus michauxianus, Triticum aestivum Species of your interest not listed? Contact us
Immunogen:
His-tagged, highly conserved fragment of Zea mays RpoB gi|540067377|gb|AGV02730.1| RNA polymerase beta subunit (chloroplast) [Zea mays subsp. mays], UniProt: A0A059Q6W3
RpoB (RNA polymerase beta subunit (chloroplast)) is a DNA-dependent RNA polymerase which catalyzes the transcription of DNA into RNA using the four ribonuceloside triphosphates as substrates.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Alloteropsis semialata, Cannabis sativa, Coleataenia prionitis, Digitaria exilis, Echinochloa crus-galli var. crus-galli , Eragrostis tef, Microlaena stipoides, Miscanthus sacchariflorus, Oryza sativa, Phragmites australis, Potamophila parviflora, Rhynchoryza subulata, Saccharum officinarum, Setaria italica, Sorghum bicolor, Stipa lipskyi, Sporobolus michauxianus, Triticum aestivum Species of your interest not listed? Contact us
Immunogen:
His-tagged, highly conserved fragment of Zea mays RpoB gi|540067377|gb|AGV02730.1| RNA polymerase beta subunit (chloroplast) [Zea mays subsp. mays], UniProt: A0A059Q6W3
RpoA | RNA polymerase alpha subunit (chloroplast) is a DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Zea maysSpecies of your interest not listed? Contact us
Immunogen:
His-tagged, highly conserved fragment of Zea mays RpoA UniProt: P09562
Ji et al. (2020). A fully assembled PEP complex detected in etioplasts and proplastids in Arabidopsis. Physiol Plant. 2020 Nov 5. doi: 10.1111/ppl.13256.
Protein belongs to DNA photolyases and functions in DNA repair.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to 3 years. Re-constituted antibody can be stored at 4°Cfor several days to weeks. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Mucuna pruriens (A0A371HBY0), Noccaea caerulescens (A0A1J3JTQ8) Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana DNA photolyase, UniProt: F4JSJ6, TAIR: AT4G25290, located towards C-terminal part of this protein
Protein belongs to DNA photolyases and functions in DNA repair.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana DNA photolyase, UniProt: F4JSJ6, TAIR: AT4G25290, loacted in the N-terminal part of the protein
Lyophilized antibody can be stored at -20 °C for up to 3 years. Re-constituted antibody can be stored at 4°Cfor several days to weeks. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Manihot esculenta
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from Manihot esculenta linamarase protein sequence, UniProt: O24524
Streptavidin HRP conjugate is designed to be used in the detection of biotinylated primary antibodies.This product is ELISA grade.
Product Type:
Antibody
Storage Temp:
Store freeze-dried (lyophilized) powder at 2-8°C. Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. Centrifuge to remove any particulates. Prepare fresh working dilution daily prior to use and then discard.Shelf life of this product is 1 year from date of receipt.
Applications:
ELISA (ELISA), Immunohistochemistry (IHC), Western blot (WB)
Buffer composition: 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.1 % Kathon CG (v/v) is included as preservative. Streptavidin was overexpressed in bacterial culture, purified and conjugated to horse radish peroxidase (HRP).
AKIN 3 (SNF1-related protein kinase regulatory subunit beta-3) is a regulatory subunit of the probable trimeric SNF1-related protein kinase (SnRK) complex, which may play a role in a signal transduction cascade regulating gene expression and carbohydrate metabolism in higher plants.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brasica rapa, Capsella rubella, Ricinus communis, Vitis vinifera Species of your interest not listed? Contact us
SUN1,2 (nuclear envelope protein) is a member of the Sad1/UNC-84 (SUN)-domain proteins.SUN domain proteins are part of the cytoskeletal-nucleoskeletal bridging complexes. These proteins are localized to the nuclear envelope and are present as homomers and heteromers in vivo. Involved in maintaining the elongated nuclear shape of epidermal cells.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Arabidopsis thaliana
Immunogen:
KLH-conjugated synthetic peptide derived from SUN1,2 sequences of Arabidopsis thaliana SUN1 UniProt: Q9FF75, TAIR: AT5G04990, SUN2, UniProt: Q9SG79, TAIR: AT3G10730
For other species use product AS15 2857This antibody is not suitable for immunolocalization.
Application Details:
1 : 1000 (WB), 1 : 200 (ICC)
Purity:
Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
51,5 kDa (SUN1); 49,9 kDa (SUN2)
Selected references:
Wang et al. (2019) OPENER Is a Nuclear Envelope and Mitochondria Localized Protein Required for Cell Cycle Progression in Arabidopsis. Plant Cell. 2019 Jul;31(7):1446-1465. doi: 10.1105/tpc.19.00033
Histone 3 (H3) located in nuclei, incorporated into chromatin. Present in nucleosome together with H2A, H2B and H4.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°C. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Proteasome-dependent degradation serves an essential role in the removal of a wide variety of key nuclear and cytosolic proteins. Substrates are targeted for proteolysis by the ubiquitin pathway before being degraded by the 26 S proteasome. RPN6 associates with an ATPase subunit of the 19S proteasome regulatory complex, AtS6A. Alternative names: 19S proteosome subunit 9, 26S proteasome non-ATPase regulatory subunit 11 homolog, AtRPN6.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Llama IgG Purified contains Protein G purified llama IgG from normal serum, e.g. serum of non immunized animals and is excellent for use as blocking reagent in immunoassays.
Total IgG. Protein G purified in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2.
Special application note:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2> 4.5 mg/ml (E 1% at 280 nm = 13.0)This antibody is suitable for all immunoassay applications. The optimal working dilution should be determined by the investigator.
Llama IgG - AffinityPrep Resin is a resin suitable for removal of proteins recognizing Llama IgG from liquid solutions, including traditional Immunoabsorptions and Immunoprecipitation protocols.
Product Type:
Antibody
Format:
Liquid
Storage Temp:
2-8 °C, this product should not be frozen. The shelf lite is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Purified Llama IgG coupled to 4% agarose beads in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2. Contains 0.05 % sodium azide.
Special application note:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 0.05% (w/v) Sodium Azide.This resin is suitable for removal of proteins recognizing Llama IgG from liquid solutions, including traditional Immunoabsorptions and Immunoprecipitation protocols.8-10 mg protein/ml resin
Llama Ig Fraction contains total llama Ig from normal serum, e.g. serum of non immunized animals and is excellent for use as blocking reagent in immunoassays.
Llama anti-Rabbit IgG (H&L), HRP Conjugated is a secondary antibody which binds to heavy (γ) chains chains on rabbit IgG light chains on all rabbit immunoglobulins
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized material at 2-8°C. For long time storage after reconstitution, dilute the antibody solution with glycerol to a final concentration of 50% glycerol and store as liquid at -20 °C, to prevent loss of enzymatic activity. For example, if you have reconstituted 1 mg of antibody in 1,1 ml of sterile water add 1,1 ml of glycerol. Such solution will not freeze in -20 °C. If you are using a 1:5000 dilution prior to diluting with glycerol, then you would need to use a 1:2500 dilution after adding glycerol. Prepare working dilution prior to use and then discard, Be sure to mix well but without foaming.
Host Animal:
Llama
Species Reactivity:
reacts with: heavy (?) chains chains on rabbit IgG light chains on all on all rabbit immunoglobulins
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified rabbit IgG.
Reconstitution:
For reconstitution add 1,1 ml of sterile water, Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Not reactive in:
Based on IEP, no reactivity is observed to:˖ non-immunoglobulin rabbit serum proteins
Special application note:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free, 0.1% (v/v) Kathon CGBased on IEP, this antibody reacts with: heavy (γ) chains chains on rabbit IgG light chains on all on all rabbit immunoglobulins.Based on IEP, no reactivity is observed to non-immunoglobulin rabbit serum proteins
Llama anti-Rabbit IgG (H&L), DyLight 488 Conjugate is a secondary antibody which binds to heavy (γ) chains chains on rabbit IgG light chains on all rabbit immunoglobulins.DyLight 488 Amax = 493 nm, Emax = 518 nm. Antibodies are purified using solid phase Rabbit IgG (H&L).DyLight is a registered trade mark of Thermofisher Inc., and its subsidaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized material at 2-8°C. Product is stable for 4 weeks at 2-8°Cafter rehydration. For long time storage after reconstitution, dilute the antibody solution with glycerol to a final concentration of 50% glycerol and store as liquid at -20 °C, to prevent loss of enzymatic activity. For example, if you have reconstituted 1 mg of antibody in 1,1 ml of sterile water add 1,1 ml of glycerol. Such solution will not freeze in -20 °C, If you are using a 1:5000 dilution prior to diluting with glycerol, then you would need to use a 1:2500 dilution after adding glycerol. Prepare working dilution prior to use and then discard. Be sure to mix well but without foaming.
Host Animal:
Llama
Species Reactivity:
reacts with: heavy (?) chains chains on rabbit IgG light chains on all on all rabbit immunoglobulins
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified rabbit IgG.
Reconstitution:
For reconstitution add 1,1 ml of sterile water, Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Not reactive in:
Based on IEP, no reactivity is observed to:˖ non-immunoglobulin rabbit serum proteins
Special application note:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free, 0.05 % (w/v) of Sodium azide as preservative.Based on IEP, this antibody reacts with: heavy (γ) chains chains on rabbit IgG light chains on all on all rabbit immunoglobulins Based on IEP, no reactivity is observed to non-immunoglobulin rabbit serum proteins
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified rabbit IgG.
Not reactive in:
Based on IEP, no reactivity is observed to:˖ non-immunoglobulin rabbit serum proteins
Special application note:
Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 0.05 % (w/v) of Sodium azide as preservative.Antibody reacts with: heavy (γ) chains chains on rabbit IgG light chains on all on all rabbit immunoglobulinsBased on IEP, no reactivity is observed to non-immunoglobulin rabbit serum proteins
Serrate RNA effector molecule is required for proper processing of primary miRNAs to miRNA. Also critical for the accumulation of the trans-acting small interfering RNA (ta-siRNA).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Malus domestica, Nicotiana benthamina, Nicotiana tabacum, Saccharum hybrid cultivar NCo 376, Zea mays Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide chosen from Arabidopsis thaliana serrate protein sequence UniProt: Q9ZVD0,TAIR: At2g27100
RIQ1 is involved in regulation of thylakoid structure. This protein has a ubiquinone oxidoreductase domain and have an electron transfer motif.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Higher plants Species of your interest not listed? Contact us
At2g21960 is an integral component of thylakoid membrane.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Higher plants Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide, derived from Arabidopsis thaliana, UniProt: Q9SJ03, TAIR: AT2G21960
PAB (protein in chloroplast atpase biogenesis) acts as an assembly chaperone that functions downstream of chaperonin 60 in the assembly of chloroplast ATP synthase coupling factor 1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidiopsis thaliana, Zea mays
Expected Species:
Brachypodium distachyon, Gossypium raimondii, Hordeum vulgare, Oryza sp., Saccharum hybrid cultivar R570, Setaria italica, Sorghum bicolor, Theobroma cacao, Triticum aestivum Species of your interest not listed? Contact us
Proteasome-dependent degradation serves an essential role in the removal of a wide variety of key nuclear and cytosolic proteins. Substrates are targeted for proteolysis by the ubiquitin pathway before being degraded by the 26 S proteasome. RPN6 associates with an ATPase subunit of the 19S proteasome regulatory complex, AtS6A. Alternative names: 26S proteasome non-ATPase regulatory subunit 11 homolog, 19S proteosome subunit 9, AtS9 26S proteasome regulatory subunit RPN6, AtRPN6, 26S proteasome regulatory subunit S9 homolog.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Glycne soja , Gossypium arboreum, Medicago truncatula, Ornithogalum saundersiae, Oryza sativa, Populus trichocarpa, Ricinus communis, Solanum chacoense, Theobroma caco, Triticum urartu, Zea mays, Zostera marina Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from known sequences of RPN6 including Arabidopsis thaliana RPN6 sequence, UniProt: Q9LP45, TAIR: AT1G29150
ATG4 (Autophagy protein 4) is a protein with cyteine-type endopeptidase activity involved in autophagy process.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Technical details how to work with this antibody are provided here: P rez-P rez et al. (2016). Control of Autophagy in Chlamydomonas Is Mediated through Redox-Dependent Inactivation of the ATG4 Protease. Plant Physiol. 2016 Dec;172(4):2219-2234.
Chen et al. (2016). The role of nitric oxide signalling in response to salt stress in Chlamydomonas reinhardtii. Planta. 2016 Sep;244(3):651-69. doi: 10.1007/s00425-016-2528-0. Epub 2016 Apr 26.P rez-P rez et al. (2016). Control of Autophagy in Chlamydomonas Is Mediated through Redox-Dependent Inactivation of the ATG4 Protease. Plant Physiol. 2016 Dec;172(4):2219-2234.
Special application note:
This antibody is recognizing 25 ng of recombinant CrATG4This product can be sold containing ProClin if requested.
SUS1 (Sucrose synthase 1) is a sucrose-cleaving enzyme that provides UDP-glucose and fructose for various metabolic pathways. Alternative names: ASUS1, ATSUS1. SUS1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Bilska-Kos et al. (2020). Sucrose phosphate synthase (SPS), sucrose synthase (SUS) and their products in the leaves of Miscanthus giganteus and Zea mays at low temperature. Planta . 2020 Jul 16;252(2):23. doi: 10.1007/s00425-020-03421-2. Kleczkowski LA & Decker DD (2015) Sugar activation for production of nucleotide sugars as substrates for glycosyltransferases in plants. J. Appl. Glycosci. (in press).
Aflatoxins are naturally occurring mycotoxins that are produced by many species of Aspergillus. Aflatoxins are toxic and among the most carcinogenic substances known. Crops which are frequently affected by Asperiillus include cereals (maize, sorghum, pearl millet, rice, wheat), oilseeds (peanut, soybean, sunflower, cotton), spices (chile peppers, black pepper, coriander, turmeric, ginger), and tree nuts (almond, pistachio, walnut, coconut, brazil nut).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Antibodies are in a format of total IgG purified on protein G
Application Details:
The optimal working dilution should be determined by the investigator
Purity:
Total IgG. Protein G purified in PBS pH 7.4.
Reconstitution:
For reconstitution add 0,5 ml of sterile water
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Indyk et al. (2019). Development and Application of an Optical Biosensor Immunoassay for Aflatoxin M1 in Bovine Milk. Food Anal. Methods (2019). https://doi.org/10.1007/s12161-019-01621-5. Mohamadi Sani et al. (2018). Aflatoxin M1 contamination and antibiotic residue in milk in Khorasan province, Iran. Food Chem Toxicol. 2010 Aug-Sep;48(8-9):2130-2. doi: 10.1016/j.fct.2010.05.015.
Aflatoxins are naturally occurring mycotoxins that are produced by many species of Aspergillus. Aflatoxins are toxic and among the most carcinogenic substances known. Crops which are frequently affected by Asperiillus include cereals (maize, sorghum, pearl millet, rice, wheat), oilseeds (peanut, soybean, sunflower, cotton), spices (chile peppers, black pepper, coriander, turmeric, ginger), and tree nuts (almond, pistachio, walnut, coconut, brazil nut).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
MIP1 (Aquaporin, glycerol transport activity) is localized to the contractile vacuole, which in most freshwater flagellates is used to expel excess water.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii (strains CC3395, and UVM4 from Neupert et al., 2009. (Generation of Chlamydomonas Strains that Efficiently Express Nuclear Transgenes.)
Expected Species:
Chlamydomonas reinhardtii
Immunogen:
KLH-conjugated synthetic peptide, derived from Chlamydomonas reinhardtii MIP1, UniProt: Q5VLJ9
As MIP1 is a membrane protein please use a high redox potential in your lysis buffer
Application Details:
1 : 200 (IG), 1 : 10 000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
31,5 | 43 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Komsic-Buchmann et al. (2014). The Contractile Vacuole as a Key Regulator of Cellular Water Flow in Chlamydomonas reinhardtii. Eukaryotic cell (13), Issue 11: 1421-30.
UAGPase (UDP-GlcNAc pyrophosphorylase) is involved in the biosynthesis of UDP-glucosamine, an essential precursor for glycoprotein and glycolipid synthesis and is also used for regulatory protein modification in signaling pathways. The enzyme is localized in a cytoplasm. Alternative names: N-acetylglucosamine-1-phosphate uridylyltransferase 2, UDP-N-acetylgalactosamine diphosphorylase 2, UTP--glucose-1-phosphate uridylyltransferase 2, AGX.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Glycne soja, Medicago truncatula, Morus notabilis, Populus trichocarpa, Theobroma cacao, Zea mays, for more species, please inquire Species of your interest not listed? Contact us
Immunogen:
His-tagged full length recombinant UAGPase of Arabidopsis thaliana, overexpressed and purified from E.coli, UniProt:O64765,, TAIR:AT2G35020. Sequence used for immunization is conserved in both isoforms: UDP-N-acetylglucosamine diphosphorylase 1 (Q940S3) and (O64765)
This antibody is recognizing recombinant UAGPase at 0,25 pmol
Application Details:
1 : 10 000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
55,76 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Fern ndez-San Mill n et al. (2018). Physiological Performance of Transplastomic Tobacco Plants Overexpressing Aquaporin AQP1 into Chloroplast Membranes. J Exp. Bot. ery148, https://doi.org/10.1093/jxb/ery148.Kleczkowski LA & Decker DD (2015) Sugar activation for production of nucleotide sugars as substrates for glycosyltransferases in plants. J. Appl. Glycosci. 2015 Volume 62 Issue 2 Pages 25-36.
The PsbO protein is an extrinisic subunit of the water splitting photosystem II (PSII) complex. The protein is exposed on the luminal side of the thylakoid membrane, and is hihgly conserved in all known oxygenic photosynthetic organisms. Alternative names of PsbO1 include 33 kDa subunit of oxygen evolving system of photosystem II, OEC 33 kDa subunit, 33 kDa thylakoid membrane protein, manganese-stabilizing protein 1 and for PsbO2 33 kDa subunit of oxygen evolving system of photosystem II, OEC 33 kDa subunit, 33 kDa thylakoid membrane protein, manganese-stabilizing protein 2.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica napus, Capsella rubella, dinoflagellate, Triticum aestivum Species of your interest not listed? Contact us
This antibody is specific to PsbO2 and does not react with PsbO1 as confirmed on deletion mutant
Application Details:
1 : 1000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
33 | 30 kDa
Selected references:
Pipitone et al. (2021). A multifaceted analysis reveals two distinct phases of chloroplast biogenesis during de-etiolation in Arabidopsis. Elife. 2021 Feb 25;10:e62709. doi: 10.7554/eLife.62709. PMID: 33629953; PMCID: PMC7906606.Pralon et al. (2019). Plastoquinone homoeostasis by Arabidopsis proton gradient regulation 6 is essential for photosynthetic efficiency. Commun Biol. 2019 Jun 20;2:220. doi: 10.1038/s42003-019-0477-4.
The PsbO protein is an extrinisic subunit of the water splitting photosystem II (PSII) complex. The protein is exposed on the luminal side of the thylakoid membrane, and is hihgly conserved in all known oxygenic photosynthetic organisms. Alternative names of PsbO1 include 33 kDa subunit of oxygen evolving system of photosystem II, OEC 33 kDa subunit, 33 kDa thylakoid membrane protein, manganese-stabilizing protein 1 and for PsbO2 33 kDa subunit of oxygen evolving system of photosystem II, OEC 33 kDa subunit, 33 kDa thylakoid membrane protein, manganese-stabilizing protein 2.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica napus, Capsella rubella, Triticum aestivum Species of your interest not listed? Contact us
This antibody is specific to PsbO1 and does not react with PsbO2 as confirmed on a deletion mutant
Application Details:
1 : 1000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
33 | 30 kDa
Not reactive in:
Oryza sativa
Selected references:
Shanmugabalaji et al. (2018). Chloroplast Biogenesis Controlled by DELLA-TOC159 Interaction in Early Plant Development. Curr Biol. 2018 Aug 20;28(16):2616-2623.e5. doi: 10.1016/j.cub.2018.06.006.
V-ATPase subunit VHA-a1 is a subunit of the membrane-integral Vo subunit. VHA-a1 target the V-ATPase enzyme to the trans-golgi network/earl endosome (TGN/EE) in Arabidopsis thaliana. This enzyme is involved in acidification process of various compartements of eucaryotic cells. The protein is coded by VHA-a1 gene AT2G28520. Alternative names: vacuolar H(+)-ATPase subunit a1, V-ATPase 93 kDa subunit.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Capsella rubella, Cucumis sativus, Erythranthe guttata , Glycine soja, Lupinus angustifolius, Morus notabilis, Phaseolus vulgaris , Vitis vinifera Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from Arabidopsis thaliana V-ATPase subunit A, UniProt: Q8RWZ7-1, TAIR: AT2G28520
RBP40 (38 kDa RNA-binding protein) binds to the psbD 5'UTR in a Nac2-dependent fashion both in vitro and in vivo and specifically affects the initiation of D2 synthesis. Alternative name: Chloroplast-targeted RNA-binding protein.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Schwarz at al.. (2007). Synthesis of the D2 protein of photosystem II in Chlamydomonas is controlled by a high molecular mass complex containing the RNA stabilization factor Nac2 and the translational activator RBP40. Plant Cell, 19, 3627��3639.
LHCSR1 (Stress-related chlorophyll a/b binding protein 1) plays a role in an efficient enery dissipation process, called non-photochemical quenching (NPQ), in Chlamydomonas reinhardtii.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
This antibody is also recognizing recombinant LHCSR1 overexpressed in E.coli as described in Perozeni et al. (2020).
Application Details:
1 : 1000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
27 kDa
Not reactive in:
Lobosphaera incisa, Phaeodactylum tricornutum
Selected references:
Cazzaniga et al. (2022). Engineering astaxanthin accumulation reduces photoinhibition and increases biomass productivity under high light in Chlamydomonas reinhardtii. Biotechnol Biofuels Bioprod. 2022 Jul 11;15(1):77. doi: 10.1186/s13068-022-02173-3. PMID: 35820961; PMCID: PMC9277849.Redekop et al. (2020). PsbS Contributes to Photoprotection in Chlamydomonas Reinhardtii Independently of Energy Dissipation . Biochim Biophys Acta Bioenerg . 2020 Jun 1;1861(5-6):148183.doi: 10.1016Lammermann et al. (2020). Ubiquitin ligase component LRS1 and transcription factor CrHy5 act as a light switch for photoprotection in Chlamydomonas. doi.org/10.1101/2020.02.10.942334 bioRxivRoach et al. (2020). The non-photochemical quenching protein LHCSR3 prevents oxygen-dependent photoinhibition in Chlamydomonas reinhardtii. J Exp Bot. 2020 Jan 16. pii: eraa022. doi: 10.1093/jxb/eraa022.Gabilly et al. (2019). Regulation of photoprotection gene expression in Chlamydomonas by a putative E3 ubiquitin ligase complex and a homolog of CONSTANS. Proc Natl Acad Sci U S A. 2019 Aug 12. pii: 201821689. doi: 10.1073/pnas.1821689116.
Histone-lysine N-methyltransferase ash1 is a Trithorax group (TrxG) protein that has histone methyltransferase activity. Specifically trimethylates 'Lys-4' of histone H3, a specific tag for epigenetic transcriptional activation.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Drosophila melanogaster
Expected Species:
Drosophila melanogaster
Immunogen:
N-terminal GST-fusion of the peptide containing amino acids 1756-1855 of the Drosophila melanogaster Ash1protein, UniProt: Q9VW15
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Kahn et al. (2016). Interdependence of PRC1 and PRC2 for recruitment to Polycomb Response Elements. Nucleic Acids Res. 2016 Aug 23. pii: gkw701. [Epub ahead of print].Lee et al. (2015). Genome-wide activities of Polycomb complexes control pervasive transcription. Genome Res. 2015 Aug;25(8):1170-81. doi: 10.1101/gr.188920.114. Epub 2015 May 18.
UDP-glucose pyrophosphorylase (UGPase, UDPGP) E.C=2.7.7.9. is a key enzyme of synthesis of sucrose, cellulose and other saccharides. There are two cytoplasmic isoforms of UGPase-A (which share 94 % identity on amino acid level) and one chloroplastic UGPase-B isoform in Arabidopsis thaliana which share ca. 10-11 % of identity (Kleczkowski et al. 2011). Alternative name: UTP--glucose-1-phosphate uridylyltransferase.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Hordeum vulgare, Zea mays
Expected Species:
Bambusa oldhamii, Brassica pekinensis, Brassica rapa, Capsicum annuum, Cucumis sativus, Dendrobium catenatum, Dendrocalamus sinicus, Glycine max, Gossipium hirsutum, Lycopersicum esculentum, Lycopersicum chilense, Marchantia polymorpha, Oryza sativa, Picea glauca, Populus sp., Solanum tuberosum, Populus tremula, Ricinus communis, Saccharum officinarum, Vitis vinifera, for more species, please Species of your interest not listed? inquire Species of your interest not listed? Contact us
Immunogen:
His-tagged, full length Hordeum vulgare UGPase, overexpressed and purified from E.coli, UniProt: Q43772.1
This antibody is also recognizing recombinant UGPase, below 0,5 pmol
Application Details:
1 : 10 000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
52 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Kleczkowski LA & Decker DD (2015) Sugar activation for production of nucleotide sugars as substrates for glycosyltransferases in plants. J. Appl. Glycosci. (in press).
Special application note:
Cellular [compartment marker] of cytoplasm, UGPse is a cytoplasmic protein Martz et al, (2002)
ATG8 (Autophagy-related protein) involved in degradation and recycling of intracellular components in a process of autophagy.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Recombinant ATG8 A-I of Arabidopsis thaliana
Immunogen:
Part of recombinant ATG8A from Arabidopsis thaliana, UniProt:Q8LEM4,TAIR:AT4G21980
TrxM1/M2 (Thioredoxin M1/M2, chloroplasticT) is a thiol-disulfide oxidoreductase involved in the redox regulation of enzymes of both reductive pentose phosphate pathway (Calvin-Benson cycle) and oxidative pentose phosphate pathway. Under reducing conditions, activates the glyceraldehyde-3-phosphate dehydrogenase and the phosphoribulokinase, and inhibits. the glucose-6-phosphate dehydrogenase. Activates NADP-malate dehydrogenase.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica napus, Chlamydomonas reinhardtii, Hordeum vulgare, Oryza sativa, Populus balsamifera, Solanum lycopersicum, Solanum tuberosum, Triticum aestivum, Theobroma cacao, Zea mays, Viola bifloraSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide, derived from Arabidopsis thaliana TrxM1 UniProt: O48737, TAIR: AT1G03680 and TrxM2 UniProt:Q9SEU8, TAIR: AT4G03520
5 mM DTT in extraction buffer and 5% B-ME in L mmli buffer are recommended to use. Samples should be heated at 95 C for 2 min before loading as TRXs proteins have a tendency to oligomerize.To work with this antibody chloroplast fraction has to be used.
Trxf1/2 (Thioredoxin F1/F2, chloroplastic) involved in the redox regulation of enzymes of Calvin-Benson cycle and oxidative pentose phosphate pathway. Alternative names: Thioredoxin F1, F2 AtTrxf1, AtTrxf2
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Aegilops tauschii, Brassica napus, Chlamydmonas reinhardtii, Fragaria ananassa, Glycine max, Glycine soja, Hyacinthus orientalis, Medicago truncatula, Mesembryanthemum crystallinum, Morus notabilis, Nicotiana tabacum, Oryza sativa, Pisum sativum, Populus trichocarpa, Ricinus communis, Spinacia oleracea, Theobroma cacao, Triticum urartu, Zea maysSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide, derived from Arabidopsis thaliana Trxf1 UniProt: Q9XFH9, TAIR: AT5G16400 and Trxf2 UniProt: Q9XFH8, TAIR: AT3G02730
5 mM DTT in extraction buffer and 5% B-ME in L mmli buffer are recommended to use, Samples should be heated at 95 C for 2 min before loading as TRXs proteins have a tendency to oligomerize
Application Details:
1 : 1000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
19,9 | 12 kDa
Not reactive in:
Marchantia polymorpha, Physcomitrella patens
Selected references:
Nikkanen et al. (2016). Crosstalk between chloroplast thioredoxin systems in regulation of photosynthesis. Plant Cell Environ. 2016 Aug;39(8):1691-705. doi: 10.1111/pce.12718.
NBR1 (Autophagy substrate NBR1) is involved in selective autophagy process of damaged organelles, intracellular microbes, protein aggregates, cellular structures and specific soluble proteins. NBR1 mediates the process as an autophagic adapter. The protein has two UBA domains but only the C-terminal UBA domain bound ubiquitin. Alternative names: At4g24690, Putative uncharacterized protein F22K18.110.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassicaceae family, Solanum lycopersicumSpecies of your interest not listed? Contact us
Immunogen:
UNA2 domain of NBR1 of Arabidopsis thaliana, fused with GST, UniProt:Q9SB64, TAIR:AT4G24690
A specific extraction method and tissue type needs to be used as described in Minina et al, (2013), Dilution in western blot depends upon amount of NBR1 in the sample
NBR1 (Autophagy substrate NBR1) is involved in selective autophagy process of damaged organelles, intracellular microbes, protein aggregates, cellular structures and specific soluble proteins. NBR1 mediates the process as an autophagic adapter. The protein has two UBA domains but only the C-terminal UBA domain bound ubiquitin. Alternative names: At4g24690, Putative uncharacterized protein F22K18.110.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Physcomitrium patens
Expected Species:
Brassicaceae familySpecies of your interest not listed? Contact us
Immunogen:
UBA2 domain of NBR1 of Arabidopsis thaliana, fused with GST, UniProt:Q9SB64, TAIR:AT4G24690
Specific extraction method and tissue type needs to be used as described in Minina et al, (2013), Dilution in western blot depends upon amount of NBR1 in the sample
Application Details:
1: 1000 (IL), 1 : 500-1 : 5000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
75 | 100 kDa
Not reactive in:
Nicotiana tabacum
Selected references:
Rodriguez et al. (2020). Autophagy mediates temporary reprogramming and dedifferentiation in plant somatic cells. bioRxiv doi.org/10.1101/747410Calero-Mu ?±oz et al. (2019). Cadmium induces reactive oxygen species-dependent pexophagy in Arabidopsis leaves. Plant Cell Environ. 2019 Sep;42(9):2696-2714. doi: 10.1111/pce.13597.Jia et al. (2019). Noncanonical ATG8-ABS3 interaction controls senescence in plants. Nat Plants. 2019 Feb;5(2):212-224. doi: 10.1038/s41477-018-0348-x.Hackenberg et al. (2013). Catalase and NO CATALASE ACTIVITY1 promote autophagy-dependent cell death in Arabidopsis. Plant Cell. 2013 Nov;25(11):4616-26. doi: 10.1105/tpc.113.117192. Epub 2013 Nov 27.Minina et al. (2013). Autophagy mediates caloric restriction-induced lifespan extension in Arabidopsis. Aging Cell. 2013 Apr;12(2):327-9. doi: 10.1111/acel.12048. Epub 2013 Feb 28. (method description in supplemental materials)Katsiarimpa et al. (2013). The Deubiquitinating Enzyme AMSH1 and the ESCRT-III Subunit VPS2.1 Are Required for Autophagic Degradation in Arabidopsis.Svenning et al. (2011). Plant NBR1 is a selective autophagy substrate and a functional hybrid of the mammalian autophagic adapters NBR1 and p62/SQSTM1. Autophagy. 2011 Sep;7(9):993-1010. Epub 2011 Sep 1. (original reference)
GID1c (Gibberellin receptor GID1C) is a gibberellin (GA) receptor ortholog of the rice GA receptor OsGID1 which binds to GA and shows affinity to GA4 and interacts with DELLA proteins in vivo in the presence of GA4. Alternative names: AtCXE19, Carboxylesterase 19, GID1-like protein 3, Protein GA INSENSITIVE DWARF 1C.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Arabidopsis alpina, Ricinus communis Species of your interest not listed? Contact us
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Hauvermale et al. (2015). Loss of Arabidopsis thaliana seed dormancy is associated with increased accumulation of the GID1 GA hormone receptors. Plant Cell Physiol. 2015 Jul 1. pii: pcv084.
Argonaute 3(AGO3) of Chlamydmonas reinhardii is cytoplasmic enriched and associated with polysomes and miRNAs (Chung et al. 2019).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii
Immunogen:
KLH-conjugated peptide derived from C-terminal of AGO3 protein of Chlamydomonas reinhardtii
Chung et al. (2019) Distinct roles of Argonaute in the green alga Chlamydomonas reveal evolutionary conserved mode of miRNA-mediated gene expression. Sci Rep. 2019 Jul 31;9(1):11091. doi: 10.1038/s41598-019-47415-x.
AGO1 belongs to a group of argonaute proteins which are catalytic component of the RNA-incudes silencing complex (RISC). This protein complex is responsible for the gene silencing (RNAi).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii
Immunogen:
KLH-conjugated peptide derived from AGO1-PAZ domain of Chlamydomonas reinhardtii Cre02.g141050.t1.1
GORK (Potassium channel GORK) is a multi-pass membrane protein outward-rectifying potassium channel located in the guard cell membrane. Up-regulated by stress conditions and ABA treatment in roots and shoots. Alternative names: Guard cell outward rectifying K(+) channel, AtGORK.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Microsomal fraction is recommended to use with this antibody
Application Details:
1 : 100 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
95 | 80 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Eisenach et al. (2014). Clustering of the K+ channel GORK of Arabidopsis parallels its gating by extracellular K+. Plant J. 2014 Apr;78(2):203-14. doi: 10.1111/tpj.12471. Epub 2014 Apr 2.
PRN2 (PIRIN) belongs to a functionally diverse cupin protein superfamily with four family members of Arabidopsis thaliana PRN proteins.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Zhang et al. (2014). PIRIN2 stabilizes cysteine protease XCP2 and increases susceptibility to the vascular pathogen Ralstonia solanacearum in Arabidopsis. Plant J. 2014 Jun 20. doi: 10.1111/tpj.12602.
G4 (Chlorophyll synthase) is an enzyme which performs estrification of chlorophyllide (a and b), which is the last step of chlorophyll biosynthesis. Alternative names: polyprenyl transferase, protein G4.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Hordeum vulgare
Expected Species:
Avena sativa, Camelia sinensis, Cocomyxa subellipsoidea, Gossypium hirsutum, Micromonas pusilla, Nicotiana tabacum, Oryza sativa, Populus trichocarpa, Ricinus communis, Triticum urartu, cyanobacteriaSpecies of your interest not listed? Contact us
HDA6 (histone deacetylase 6) is an enzyme (EC=3.5.1.98) responsible for deacetylation of lysine residues on the N-terminal part of the core histones (H2A, H2B, H3 and H4). Involved in transcriptional regulation, cell cycle progression and developmental events. Not detected in leaves, stems, flowers and young siliques. Induced by jasmonic acid and ethylene.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica rapa, Capsella rubella, Citrus clementina, Chlamydomonas reinhardii, Glycine max, Hordeum vulgare, Medicago truncatula, Oryza sativa, Phaseolus vulgaris, Populus trichocarpa, Physcomitrium patens, Ricinus communis, Setaria italica, Solanum lycopersicum, Solanum tuberosum, Sorghum bicolor, Triticum aestivum, Zea mays, Vitis viniferaSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide chosen from HDA6 protein of Arabidopsis thaliana Uniprot: Q9FML2, TAIR: At5g63110. Peptide used for immunization is not conserved in HDA9 of Arabidopsis thaliana.
Applications:
Chromatin Immunoprecipitation (ChIP), Western blot (WB)
The PsbN protein is chloroplast-encoded, low molecular weight protein annotated as a photosystem II subunit however it seems that it is not a constituent subunit of PSII but is required for PSII repair from photoinhibition.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Nicotiana tabacum
Expected Species:
Arabis alpina, Camelia sp., Canna indica, Cannabis sativa, Costus pulverulentus, Glycine max, Helianthus tuberosus, Hordeum vulgare, Lactuca sativa, Lilium sp., Manihot esculenta, Oryza sativa, Phaseolus vulgaris, Pisum sativum, Populus trichocarpa, Saccharum officinarum, Solanum tuberosum, Sorghum timorense, Spinacia oleracea, Tricitum aestivum, Thaumatococcus daniellii, Vitis vinifera Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide chosen from PsbN protein of Arabidopsis thaliana Uniprot: P62113, TAIR: AtCg00700
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Torabi et al. (2014). PsbN Is Required for Assembly of the Photosystem II Reaction Center in Nicotiana tabacum. Plant Cell. 2014 Mar;26(3):1183-99. doi: 10.1105/tpc.113.120444. Epub 2014 Mar 11.
PRP40B (pre-mRNA-processing protein 40B) protein that binds the carboxyl-terminal domain (CTD) of the largest subunit of RNA polymerase II and functions as a scaffold for RNA processing machineries. Ubiquitously expressed and localized to the nucleus.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica rapa Species of your interest not listed? Contact us
PRP39a (pre-mRNA-processing factor 39) is involved in RNA processing, mRNA 5'-splice site recognition, regulation of timing of transition from vegetative to reproductive phase.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica rapa Species of your interest not listed? Contact us
Immunogen:
Recombinant, full length PRP39a of Arabidopsis thaliana , UniProt: F4I448, TAIR: At1g04080
SnRK2.2, SnRK2.3, SnRK2.6 are members of SNF1-related protein kinases whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Involved in ABA signalling pathway. Alternative names: OST1-kinase-like 2, Protein ATHPROKIN B, SNF1-related kinase 2.3, SnRK2.3, Protein OPEN STOMATA 1SNF1-related kinase 2.6, SnRK2.6, Serine/threonine-protein kinase OST1, OST1-kinase-like 3, Protein ATHPROKIN A, SNF1-related kinase 2.2, SnRK2.2
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica oleracea, Glycine max, Medicago sativa, Morsu notabilis, Oryza sativa, Phaseolus vulgaris, Populus sp., Triticum sp., Vicia fabaSpecies of your interest not listed? Contact us
Belda-Palaz n et al. (2020) A dual function of SnRK2 kinases in the regulation of SnRK1 and plant growth. Nat Plants. 2020 Nov;6(11):1345-1353. doi: 10.1038/s41477-020-00778-w. Epub 2020 Oct 19. PMID: 33077877.Wawer et al. (2018) mRNA Decapping and 5'-3' Decay Contribute to the Regulation of ABA Signaling in Arabidopsis thaliana. Front Plant Sci. 2018 Mar 12;9:312. doi: 10.3389/fpls.2018.00312.
Special application note:
This product can be sold containing proclin if requested
EPSP synthase (3-phosphoshikimate 1-carboxyvinyltransferase, chloroplastic) is an enzyme (EC:2.5.1.19)which is involved in glyphosate metabolic process. Localized in chloroplast stroma. Catalyzes the transfer of the enolpyruvyl moiety of phosphoenolpyruvate (PEP) to the 5-hydroxyl of shikimate-3-phosphate (S3P) to produce enolpyruvyl shikimate-3-phosphate and inorganic phosphate. Alternative name: 5-enolpyruvylshikimate-3-phosphate synthase.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Arachis hypogaea, Cannabis sativa, Coffea arabica, Cucumis sativus, Glycine max, Glycine soja, Malus domestica, Nicotiana tabacum, Zea mays, Vitis vinifera Species of your interest not listed? Contact us
RPS15 (30S ribosomal protein S15, chloroplastic) is a structural component of the small subunit of the ribosome, localized in the chloroplast.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Nicotiana tabacum
Expected Species:
Arabidopsis thaliana, Solanum lycopersicum, Solanum tuburosum, Oryza sativa, Zea maysSpecies of your interest not listed? Contact us
U1 snRNP protein A (U1 small nuclear ribonucleoprotein A) is involved in mRNA splicing by spliceosome where it is associated with snRNP U1. Involved in response to salt stress.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
AGO1 belongs to a group of argonaute proteins which are catalytic component of the RNA-incudes silencing complex (RISC). This protein complex is responsible for the gene silencing (RNAi).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
V-ATPase, subunit B is a non-catalytic subunit of the peripheral V1 complex of vacuolar ATPase. Alternative names: Vacuolar proton pump subunit B1, vacuolar H+-ATPase subunit B, V-ATPase 57 kDa subunit.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Protein or membrane sample should be treated at 70 C for 10 min before loading on the gel
Application Details:
1 : 1000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
53 | 57 kDa (Vigna radiata)
Not reactive in:
Thermatoga neapolitana
Special application note:
Antibodies will detect target protein in a few g of a crude preparation loaded per well, If purified preparations of vacuolar and plasma membranes are used, one g load per well should be sufficient
1-aminocyclopropane-1-carboxylate synthase (ACS) enzymes catalyze the conversion of S-adenosyl-L-methionine (SAM) into 1-aminocyclopropane-1-carboxylate (ACC), a direct precursor of ethylene. (EC:4.4.1.14). Synonymes: S-adenosyl-L-methionine methylthioadenosine-lyase 7.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Glycolate oxidase (GOX) is an enzyme which modulates reactive oxygen species-mediated signal transduction during nonhost resistance. There are three GOX isoforms in Arabidopsis thaliana: GOX1,2,3. Alternative name: Peroxisomal (S)-2-hydroxy-acid oxidase GLO.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Glycine max, Hordeum vulgare, Medicago truncatula, Nicotiana tabacum, Phaseolus vulgaris, Populus alba x tremula, Solanum lycopersicum, Solanum tuberosum, Spinacia oleracea, Triticum sp. Zea mays, Vitis viniferaSpecies of your interest not listed? Contact us
Bapatla et al. (2021). Modulation of Photorespiratory Enzymes by Oxidative and Photo-Oxidative Stress Induced by Menadione in Leaves of Pea (Pisum sativum). Plants 10, no. 5: 987. https://doi.org/10.3390/plants10050987Umnajkitikorn et al. (2020). Silencing of OsCV (chloroplast vesiculation) maintained photorespiration and N assimilation in rice plants grown under elevated CO2. Plant Cell Environ . 2020 Apr;43(4):920-933. doi: 10.1111/pce.13723.
Aflatoxins are naturally occurring mycotoxins that are produced by many species of Aspergillus. Aflatoxins are toxic and among the most carcinogenic substances known. Crops which are frequently affected by Asperiillus include cereals (maize, sorghum, pearl millet, rice, wheat), oilseeds (peanut, soybean, sunflower, cotton), spices (chile peppers, black pepper, coriander, turmeric, ginger), and tree nuts (almond, pistachio, walnut, coconut, brazil nut).
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Lyophilized powder is stable for a minimum of 2 years at -20 °C. Reconstitute in distilled water before use. Store reconstituted antibodies at 4°Cfor up to a month and make aliquots for extended storage.
Aflatoxins are naturally occurring mycotoxins that are produced by many species of Aspergillus. Aflatoxins are toxic and among the most carcinogenic substances known. Crops which are frequently affected by Asperiillus include cereals (maize, sorghum, pearl millet, rice, wheat), oilseeds (peanut, soybean, sunflower, cotton), spices (chile peppers, black pepper, coriander, turmeric, ginger), and tree nuts (almond, pistachio, walnut, coconut, brazil nut).
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Lyophilized powder is stable for a minimum of 2 years at -20 °C. Reconstitute in distilled water before use. Store reconstituted antibodies at 4°Cfor up to a month and make aliquots for extended storage.
MBP (Maltose binding protein) is encoded by the malE gene of E.coli and is a commonly used tag when studying protein expression using a wide range of applications. MBP tag enables easy purification of proteins from bacterial extracts under mild conditions.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Lyophilized powder is stable for a minimum of 2 years at -20 °C. Reconstitute in distilled water before use. Store reconstituted antibodies at 4°Cfor up to a month and make aliquots for extended storage.
Host Animal:
Mouse
Species Reactivity:
MBP maltose binding protein epitope tag
Immunogen:
MBP epitope tag protein.
Applications:
ELISA (ELISA), Immunocytochemistry (ICC), Immunofluorescence (IF), Western blot (WB)
Keyhole limpet hemocyanin (KLH) is a large cooper-containing protein consisting of subunits with MW of 400 kDa. It is found in the hemolymph of the sea mollusk Megathura crenulata. This extracellular respiratory protein has many immunostimulatory properties, including the ability to enhance the host’s immune response by interacting with T cells, monocytes, macrophages, and polymorphonuclear lymphocytes. Since its discovery, KLH has been used primarily as a carrier for vaccines and antigens and as adjuvant treatment in regimens such as antimicrobial therapy.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Lyophilized powder is stable for a minimum of 2 years at -20 °C. Reconstitute in distilled water before use. Store reconstituted antibodies at 4°Cfor up to a month and make aliquots for extended storage.
Host Animal:
Mouse
Species Reactivity:
Reacts with Keyhole Limpet 8-9 kDa Hemocyanin protein.
Protein present in plant vascular tissue (xylem and vascular cambium) is detected by anti-KLH antibodies (H glund et al. 2002) which might lead to false results in IL when using anti-peptide antibodies generated to KLH-conjugated peptide.
Zearalenone is a RAL and F-2 mycotoxin produced by some Fusarium and Gibberella species. It is a potent estrogenic metabolite and is the primary toxin causing infertility, abortion or other breeding problems, especially in swine. Zearalenone is found in a many cereal crops, such as maize, barley, oats, wheat, rice, sorghum as well as in bread all over the world.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Lyophilized powder is stable for a minimum of 2 years at -20 °C. Reconstitute in distilled water before use. Store reconstituted antibodies at 4°Cfor up to a month and make aliquots for extended storage.
Host Animal:
Mouse
Species Reactivity:
Antibody detects zearalenone mycotoxin of Fusarium sp.
Aflatoxins are naturally occurring mycotoxins that are produced by many species of Aspergillus. Aflatoxins are toxic and among the most carcinogenic substances known. Crops which are frequently affected by Asperiillus include cereals (maize, sorghum, pearl millet, rice, wheat), oilseeds (peanut, soybean, sunflower, cotton), spices (chile peppers, black pepper, coriander, turmeric, ginger), and tree nuts (almond, pistachio, walnut, coconut, brazil nut).
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Lyophilized powder is stable for a minimum of 2 years at -20 °C. Reconstitute in distilled water before use. Store reconstituted antibodies at 4°Cfor up to a month and make aliquots for extended storage.
Host Animal:
Mouse
Species Reactivity:
Antibody detects aflatoxin B1 from Aspergillus sp.
Fluorescein, a fluorophore is a commonly used dye in microscopy studies.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Lyophilized powder is stable for a minimum of 2 years at -20 °C. Reconstitute in distilled water before use. Store reconstituted antibodies at 4°Cfor up to a month and make aliquots for extended storage.
Host Animal:
Mouse
Species Reactivity:
Antibody detects free and bound fluorescein.
Immunogen:
Fluorescein
Applications:
ELISA (ELISA), Immunocytochemistry (ICC), Western blot (WB)
Digoxigenin (DIG) is an hapten from plants (Digitalis) and can be used as an epitope tag in many biological applications.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Lyophilized powder is stable for a minimum of 2 years at -20 °C. Reconstitute in distilled water before use. Store reconstituted antibodies at 4°Cfor up to a month and make aliquots for extended storage.
Host Animal:
Mouse
Species Reactivity:
Antibody detects free and bound digoxigenin tag
Immunogen:
Digoxigenin
Applications:
ELISA (ELISA), Immunohistochemistry (IHC), Western blot (WB)
Biotin has a high affinity to avidin or streptavidin and is there used as a common tag.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Lyophilized powder is stable for a minimum of 2 years at -20 °C. Reconstitute in distilled water before use. Store reconstituted antibodies at 4°Cfor up to a month and make aliquots for extended storage.
Host Animal:
Mouse
Species Reactivity:
Antibody detects free biotin and biotin bound on a carrier protein.
Immunogen:
Biotin
Applications:
ELISA (ELISA), Immunohistochemistry (IHC), Western blot (WB)
Xylan is a group of hemicelluloses that reside in plant cells walls and also can be found in some algae (both green and red). Xylans are polysaccharides whose backbone consists of beta-1,4-linked xylosyl residues. This backbone can be substituted with side-chains of arabinosyl, glucuronosyl, and 4-O-mthylglucuronosyl residues, and can also be further modified by acetyl substitution on the hydroxyls of the xylosyl residues.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Rat
Species Reactivity:
Higher plants
Immunogen:
Polysaccharide Arabinogalactan-protein (AGP) from Oryza sativa
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Rat
Species Reactivity:
Higher plants
Immunogen:
Polysaccharide Arabinogalactan-protein (AGP) from Oryza sativa
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Rat
Species Reactivity:
Higher plants
Immunogen:
Polysaccharide Arabinogalactan-protein (AGP) from Oryza sativa
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Rat
Species Reactivity:
Higher plants
Immunogen:
Polysaccharide Arabinogalactan-protein (AGP) from Oryza sativa
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Rat
Species Reactivity:
Higher plants
Immunogen:
Polysaccharide Arabinogalactan-protein (AGP) from Oryza sativa
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Rat
Species Reactivity:
Higher plants
Immunogen:
Polysaccharide Arabinogalactan-protein (AGP) from Oryza sativa
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Rat
Species Reactivity:
Higher plants
Immunogen:
Polysaccharide Arabinogalactan-protein (AGP) from Oryza sativa
Mucilage, a thick, viscous, gley substance of a polar glycoprotein and exopolysaccharide, is found on nearly all plants and some micoorganisms. It plays a role in the storage of water and food, thickening membranes and seed germination.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -80°C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Xylans are polysaccharides and belong to a group of hemicelluloses found in cell walls of plants and in red and green algae. Their backbones are built by beta-1,4-linked xylosyl residues.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store up to 1 month at 4 C, later at -80°C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Mouse
Species Reactivity:
Xylan (low arab) from Phormium tenax, Phormium spp.
Xylans are polysaccharides and belong to a group of hemicelluloses found in cell walls of plants and in red and green algae. Their backbones are built by beta-1,4-linked xylosyl residues.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store up to 1 month at 4 C, later at -80°C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Mouse
Species Reactivity:
Phormium cookianum, Sorghum bicolor, Zea mays
Immunogen:
High arabinose xylan from Phormium cookianum conjugated to Me-BSA
Xyloglucans are polysaccharides commonly referred to as hemicelluloses found in the primary cell walls of vascular plants. Species of trees known as sycamore include: Acer pseudoplatanus, Ficus sycomorus, Platanus orientalis,Platanus occidentalis,Platanus racemosa,Platanus wrightii.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store up to 1 month at 4 C, later at -80°C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Mouse
Species Reactivity:
Fucosylated xyloglucan, epitope XXFG
Immunogen:
BSA-conjugated (covalently) xyloglucan of Acer pseudoplatanus
Strep-tag II is a synthetic peptide consisting of eight amino acids (Trp-Ser-His-Pro-Gln-Phe-Glu-Lys coded also as WSHPQFEKGS) and can be N- or C- terminally fused to recombinant proteins.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid in PBS at 0.5 mg/ml.
Storage Temp:
Store at 4°C for 1-2 weeks (short term). For log term storage, aliquot and store at -20 °C and below, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Mouse
Species Reactivity:
Artificial sequence (3x WSHPQFEKGS)
Immunogen:
Recombinant human protein containing three tandem repeated Strep II tags (3xStrep-tag), separated by GlySer-linker sequence, at the N-terminus (expressed in HEK293 cells).
VSV-G tag corresponds to the partial peptide sequence of the vesicular stomatitis virus glycoprotein from Rhabdoviridae family, and consists of a single RNA molecule that encodes five proteins, one of which is a surface glycoprotein (G).. This epitope tag can be added to a protein from any species to allow further protein detection using different techniques like: immunolocalization, immunoprecipitation or Western blot.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid in PBS
Storage Temp:
Store at -20 °C; Avoid repeated freeze/thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes. For long term storage, transfer to -80 C
Alb3.2 (Inner membrane ALBINO3-like protein 2, chloroplastic) is involved in the assembly of the light-harvesting complex and interacts with reaction center polypeptides of PSI and PSII.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii
Expected Species:
Scenedesmus sp. PABB004
Immunogen:
6xHis tagged, recombinant C-terminal part of Chlamydomonas reinhardtii Alb3.2, UniProt Q8LKI3. Chosen sequence is not conserved in Alb3.1.
Can be provided with ProClin, if requested. For Western blot image, check the original publication G hre et al. 2006.
Application Details:
1: 5000 - 1 : 10 000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water.
Molecular Weight:
44.7 kDa
Not reactive in:
Arabidopsis thaliana, Zea mays
Selected references:
Gohre et al (2006). One of two alb3 proteins is essential for the assembly of the photosystems and for cell survival in Chlamydomonas. Plant Cell. 2006 Jun;18(6):1454-66. doi: 10.1105/tpc.105.038695. Epub 2006 May 5. PMID: 16679460; PMCID: PMC1475496.
PsaF (PSI-F subunit of photosystem I) is a plastocyanin-docking protein, involved in electron transfer from plastocyanin to c553. Alternative names: PSI-F.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii
Immunogen:
PsaF of Chlamydomonas reinhardtii, UniProt: A8J4S1
PsaE (PSI-E subunit of photosystem I) assists in docking of the ferredoxin to PSI and stabilizes the interaction between PsaC and the PSI core. Alternative names: P30 protein, Photosystem I 8.1 kDa protein,Photosystem I reaction center subunit IV, chloroplastic, PSI-E.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii
Immunogen:
PsaE of Chlamydomonas reinhardtii, UniProt: P12352
PsaD (PSI-D subunit of photosystem I) can form complexes with ferredoxin and ferredoxin-oxidoreductase in photosystem I (PS I) reaction center. Alternative names: Photosystem I 20 kDa subunit, PSI-D.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii
Immunogen:
PsaD of Chlamydomonas reinhardtii, UniProt: Q39615
DCL5 (Zea mays Dicer-like 102) may be involved in precise slicing in a range of monocots.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Zea mays DCL5 protein sequence UniProt: A0A1D6KSK2
AURKAIP1 mouse (Aurora kinase A-interacting protein) may act as a negative regulator of Aurora-A kinase, by down-regulation through proteasome-dependent degradation. Alternative names: 28S ribosomal protein S38, mitochondrial (MRP-S38), AURKA-interacting protein.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Mouse
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Recombinat mouse AURKAIP1 protein expressed in E.coli, UniProt: Q9DCJ7
UVR8 (Ultraviolet-B receptor UVR8) is a signaling component that acts as UV-B photoreceptor and plays a key role in establishing UV-protective responses in plants. Upon UV-B irradiation, UVR8 undergoes an immediate switch from homodimer to monomer, accumulates in the nucleus, interacts with the photomorphogenic repressor COP1 and regulates the expression of the transcription factor HY5 by associating with chromatin (through histone H2B binding) in the HY5 promoter region. Involved in controlling aspects of leaf growth and morphogenesis in response to UV-B, is required for normal progression of endocycle and has a regulatory role in stomatal differentiation as well as is required for plant circadian clock response to photomorphogenic UV-B light. Promotes photosynthetic efficiency at elevated levels of UV-B. Plays a role in mediating the effects of UV-B radiation on pathogen resistance by controlling the expression of the sinapate biosynthetic pathway. Alternative names: RCC1 domain-containing protein UVR8,Protein UV-B RESISTANCE 8.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica napus, Coffea arabica, Capsicum annuum, Glycine soja, Gossypium australe, Hordeum vulgare, Ipomoea triloba, Malus domestica, Nicotiana benthamiana, Nicotiana tabacum, Solanum lycopersicum, Solanum tuberosum, Oryza sativa, Phtheirospermum japonicum, Populus alba x Populus x berolinensis, Senna tora, Triticum aestivum, Triticum urartu, Turnera subulata, Zea maysSpecies of your interest not listed? Contact us
CHLH (GUN5) (Magnesium-chelatase subunit ChlH, chloroplastic) is a protein involved in chlorophyll synthesis, plastid to nucleus retrograde signaling and ABA perception. Alternative names: ABA-binding protein, Mg-protoporphyrin IX chelatase subunit ChlH, Protein CONDITIONAL CHLORINA, Protein GENOMES UNCOUPLED 5, Protein RAPID TRANSPIRATION IN DETACHED LEAVES 1
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Hordeum vulgare
Expected Species:
Acaryochloris marina, Halomicronema hongdechloris, Synechocystis sp. 6803Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana CHLH protein sequence, UniProt: Q9FNB0, TAIR: At5g13630
PetD (Cytochrome b6-f complex subunit 4) is the component of the cytochrome b6-f complex, which mediates electron transfer between photosystem II (PSII) and photosystem I (PSI), cyclic electron flow around PSI, and state transitions. Alternative name: 17 kDa polypeptide
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
FREE1 (Protein FREE1) is involved in the regulation of mulitivesicular/prevacuolar compartment protein sorting. Regulates multivesicular body (MVB) protein sorting and plant growth. Alternative names: FYVE domain protein required for endosomal sorting 1, FYVE domain-containing protein 1,FYVE1, PDE330, Pigment Defective Embryo 330.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana FREE1 protein sequence, UniProt: Q9ASS2, TAIR: At1g20110
TOC1 /TIMING OF CAB EXPRESSION 1) is involved in a negative regulation of gene expression and cytokinin activated signaling. Influences carbon fixation and biomass through the circadian clock period.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana TOC1 phosphorylated protein sequence, UniProt: A0A178UC73, TAIR: AT5G61380
TOC1 is heat sensitive and requires specific extraction buffer and denaturation conditions, described in application example. Using other conditions, may contribute to lack of detection of phosphorylation of TOC1 using this antibody.
Application Details:
1 : 1000 (WB)
Purity:
Antigen affinity purified serum, in PBS pH 7.4
Reconstitution:
For reconstitution add 50 l, of sterile or deionized water.
Molecular Weight:
69.195 | kDa (due to N-terminal or C-terminal processing)
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
To be added when available, antibody available in December 2022.
Botulinum toxin is a toxin produced by the anaerobic, gram-positive, bacterium of the genus Clostridium (C. botulinum, C. butyricum, C. baratii and C. argentinense). These strains are widely distributed and can be found in soil and dust. Eight types of botulinum toxin are distinguished, named type A–H. Type A and B are capable of causing disease in humans (botulism) and have longest activity in vivo, and are also used commercially (BOTOX) and medically. Types C–G are less common; types E and F can cause disease in humans, while the other types cause disease in other animals. Type E is a cause of botulism in humans. BotE is cleaved into two chains: heavy and light. Alternative names: Bontoxilysin-E, BoNT, BotE,
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Antibody should be stored at -20 °C.Aliquote to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
Clostridium botulinum
Immunogen:
Recombinant Botulinum Neurotoxin Type E Light Chain (Clostridium botulinum).
Botulinum toxin is a toxin produced by the anaerobic, gram-positive, bacterium of the genus Clostridium (C. botulinum, C. butyricum, C. baratii and C. argentinense). These strains are widely distributed and can be found in soil and dust. Eight types of botulinum toxin are distinguished, named type A–H. Type A and B are capable of causing disease in humans (botulism) and have longest activity in vivo, and are also used commercially (BOTOX) and medically. Types C–G are less common; types E and F can cause disease in humans, while the other types cause disease in other animals. Type E is a cause of botulism in humans. BotE is cleaved into two chains: heavy and light. Alternative names: Bontoxilysin-E, BoNT, BotE,
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Antibody should be stored at -20 °C.Aliquote to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
Clostridium botulinum
Immunogen:
Recombinant Botulinum Neurotoxin Type E Light Chain (Clostridium botulinum).
Botulinum toxin is a toxin produced by the anaerobic, gram-positive, bacterium of the genus Clostridium (C. botulinum, C. butyricum, C. baratii and C. argentinense). These strains are widely distributed and can be found in soil and dust. Eight types of botulinum toxin are distinguished, named type A–H. Type A and B are capable of causing disease in humans (botulism) and have longest activity in vivo, and are also used commercially (BOTOX) and medically. Types C–G are less common; types E and F can cause disease in humans, while the other types cause disease in other animals. Type E is a cause of botulism in humans. BotE is cleaved into two chains: heavy and light. Alternative names: Bontoxilysin-E, BoNT, BotE,
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Antibody should be stored at -20 °C.Aliquote to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
Clostridium botulinum
Immunogen:
Recombinant Botulinum Neurotoxin Type E Light Chain (Clostridium botulinum).
GFP (Green fluorescent protein) was originally identified in photo organs on jellyfish Aequorea victoria. It is a naturally fluorescent protein which emits green light at a maximum wavelength of 509 nm when excited by blue or UV light. It is extensively used in laboratory as a reporter molecule to label and study cellular and subcellular proteins in living cells using a wide range of applications. Antibodies to GFP protein are used in immunoblotting and ELISA. GFP protein has molecular weight of 27 kDa.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes
Host Animal:
Mouse
Species Reactivity:
GFP-tagged proteins
Immunogen:
Recombinant GFP protein derived from Aequorea victoria, UniProt: P42212
Mouse IgG negative control for ChIP is suitable for chromatin immunoprecipitation (ChIP) and has been validated for this assay as well as for MeDIP, IF and other experiments where primary antibodies made in a mouse are used. This preparation contains a pool of the IgG subclasses from the serum of healthy mice.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 4°Cor -20 °C; and make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Rabbit IgG negative control for ChIP is suitable for chromatin immunoprecipitation (ChIP) and has been validated for this assay as well as for MeDIP, IF and other experiments where primary antibodies made in a rabbit are used. This preparation contains a pool of the IgG subclasses from the serum of healthy rabbits.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cor -20 °C; and make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
ASY1 (Asynapsis 1) is a protein required for normal meiosis in male and female gametophytes, which plays a crucial role in coordinating the activity of DMC1. Alternative names: Meiosis-specific protein ASY1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Hordeum vulgare
Expected Species:
Arabidopsis thaliana, Hordeum vulgare, Oryza sativa, Triticum aestivum, Zea maysSpecies of your interest not listed? Contact us
Immunogen:
Recombinant ASY1 protein from Hordeum vulgare, UniProt: A0A8I6YI54
The PsbO protein is an extrinisic subunit of the water splitting photosystem II (PSII) complex. The protein is exposed on the luminal side of the thylakoid membrane, and is hihgly conserved in all known oxygenic photosynthetic organisms.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii
Expected Species:
Halomicronema hongdechloris, Synechocystissp., Synechococcus elongatusSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Chlamydomonas reinhardtii PsbO protein sequence, UniProt: P12853
TAP (tandem-affinity-purification) epitope tag makes a rapid purification of low abundance complexes. TAP approach can be combined with mass spectrometry to allow identification of protein interactions with a given target protein.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
TAP epitope tag
Immunogen:
TAP epitope tag, sequence: CSSGALDYDIPTTASENLYFQ, derived from the C-terminus of the TAP-tag construct after TEV cleavage,
CBP tag comes from muscle myosin light-chain kinase and contains 26 amino acid residues with the molecular weight of 4 kDa. This tag is characterized by the relatively high affinity for calmodulin (CaM), which makes it possible to purify CBP-tagged proteins from crude cell extracts using of a resin with CaM affinity. This antibody allows detection of CBP-tagged proteins.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
The anti-Myc tag is a primary antibody which is used to detect proteins containing the Myc epitope tag. The Myc tag contains the amino acid sequence EQKLISEEDL, corresponding to amino acids 410-419 of human Myc.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
S-tag from pancreatic ribonuclease A (RNase A). Due to abundance of charged and polar residues, this tag may improve solubility of recombinant proteins. It can be fused at the N- or C-terminus of a target protein.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Trx (Thioredoxin 1) is a redox protein with a primary domain conserved across a number of Trx family members. The protein contains a conserved catalytic site Cys-Gly-Pro-Cys. The protein is used as a fusion tag in a number of molecular biology applications.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Strep-tag II is a synthetic peptide consisting of eight amino acids (Trp-Ser-His-Pro-Gln-Phe-Glu-Lys) and this peptide sequence shows high affinity towards Strep-Tactin , a specifically engineered streptavidin, and can be N- or C- terminally fused to recombinant proteins.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
HSV (herpes simplex virus) eptiope tag originates from envelope glycoprotein D. It is frequently used to target N- or C- terminus of a protein of interest to allow target protein detection, in case when specific antibodies are not available.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
KT3 epitope tag consists of 11 amino acids in the leader sequence of T7 bacteriophage gene10 and is used as a tag in many expression vectors including pET system. Specific anti-T7 tag antibodies are suitable for detection of T7-tagged proteins.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
T7 epitope tag consists of 11 amino acids in the leader sequence of T7 bacteriophage gene10 and is used as a tag in many expression vectors including pET system. Specific anti-T7 tag antibodies are suitable for detection of T7-tagged proteins.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
MBP (Maltose binding protein) is encoded by the malE gene of E.coli and is a commonly used tag when studying protein expression using a wide range of applications. MBP tag enables easy purification of proteins from bacterial extracts under mild conditions.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C for up to 1 year, Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
GST-tag (glutathione S-transferase) is a tag added to a protein of interest as a fusion protein to unable purification and detection. The tag is 220 amino acid long, ca. 26 kDa which makes it quite large compare to Myc or FLAG tags.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C for up to 3 years, Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Immunogen:
GST (glutathione S-transferase) recombinant protein
V5-tag is a tag that can be added to a protein of interest as a fusion protein to enable purification and detection. It is derived from a small epitope (Pk) present on the P and V proteins of the paramyxovirus of simian virus (SV5). Addition of a V5-Tag to a protein of interest makes it possible to localize a specific gene product in a variety of cell types, study the topology of proteins and protein complexes, identify associated proteins, and characterize newly identified, low abundance or poorly immunogenic proteins when protein specific antibodies are not available.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
V5-tagged fusion proteins
Immunogen:
KLH-conjugated GKPIPNPLLGLDST synthetic peptide
Applications:
ELISA (ELISA), Immunofluorescence (IF), Immunoprecipitation (IP), Western blot (WB)
mStrawberry is constitutively fluorescent, red fluorescent protein derived from Discosoma sp. developed in Dr. Roger Tsien’s lab by directed mutagenesis of mRFP (Shaner et al. 2004). The mStrawberry fluorescent protein photobleaches rapidly, threfore mCherry is recommended for applications in which require a more photostable red monomer.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tube.
ATP synthase is the universal enzyme that synthesizes ATP from ADP and phosphate using the energy stored in a transmembrane ion gradient. AtpA is the largest subunit of the membrane-extrinsic ATP synthase subcomplex.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii
Expected Species:
Colemanosphaera charkowiensis, Eudorina elegans,Gonium pectorale, Pandorina colemaniae, Pleodorina starrii, Volvox africanus, Yamagishiella unicocca Species of your interest not listed? Contact us
Immunogen:
CF 1 alpha subunit of the chloroplast ATP synthase complex isolated from Chlamydomonas reinhardtii, UniProt: P26526
Alcohol dehydrogenase is an isozyme which preferentially catalyzes the conversion of primary unbranched alcohols to a corresponding aldehydes. Alternative names: Alcohol dehydrogenase I, YADH-1
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Alcohol dehydrogenase isolated and purified from UniProt: P00330
Applications:
ELISA (ELISA), Dot blot (Dot), Indirect immunofluorescence (indirect IF), Western blot (WB)
Aldehyde dehydrogenase in an enzyme involved in synthesis of acetate from ethanol. Alternative name: Aldehyde dehydrogenase 1, mitochondrial
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Aldehyde dehydrogenase isolated and purified from Saccharomyces cerevisiae, UniProt: P22281
Applications:
ELISA (ELISA), Dot blot (Dot), Immunocytochemistry (IHC), Western blot (WB)
Aldehyde dehydrogenase in an enzyme involved in synthesis of acetate from ethanol. Alternative name: Aldehyde dehydrogenase 1, mitochondrial
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Aldehyde dehydrogenase isolated and purified from Saccharomyces cerevisiae, UniProt: P22281
Applications:
ELISA (ELISA), Dot blot (Dot), Indirect immunofluorescence (indirect IF), Western blot (WB)
Choline kinase is an enzyme which catalyzes the committed step in the synthesis of phosphatidylcholine by the CDP-choline pathway. Alternative name: ATP:choline phosphotransferase
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Choline kinase isolated and purified from Saccharomyces cerevisiae, UniProt: P20485
Choline kinase is an enzyme which catalyzes the committed step in the synthesis of phosphatidylcholine by the CDP-choline pathway. Alternative name: ATP:choline phosphotransferase
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Choline kinase isolated and purified from Saccharomyces cerevisiae, UniProt: P20485
Applications:
ELISA (ELISA), Dot blot (Dot), Indirect immunofluorescence (indirect IF), Western blot (WB)
Formate dehydrogenase is an enzyme which is catalysing oxidation of formate to carbon dioxide.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Formate dehydrogenase is isolated and purified from Saccharomyces
Applications:
Dot blot (Dot), ELISA (ELISA),Immunocytochemistry (IHC), (ICC),Immunohistochemistry (paraffin), Western blot (WB)
Formate dehydrogenase is an enzyme which is catalysing oxidation of formate to carbon dioxide.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Isolated and purified formate dehydrogenase from Saccharomyces cerevisiae, UniProt: Q08911
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Beta-Galactosidase is an enzyme involved in hydrolysis of terminal non-reducing beta-D-galactose residues in beta-D-galactosides. Alternative names: Beta-gal, Lactase
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
beta-Galactosidase is isolated and purified from Escherichia coli, UniProt: P00722
Applications:
Dot blot (Dot), ELISA (ELISA), Immunocytochemistry (IHC), Western blot (WB)
Beta-Galactosidase is an enzyme involved in hydrolysis of terminal non-reducing beta-D-galactose residues in beta-D-galactosides. Alternative names: Beta-gal, Lactase
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
beta-Galactosidase is isolated and purified from Escherichia coli, UniProt: P00722
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Glutathion reductase (GR) is an enzyme responsible for maintaining of high levels of reduced glutathionein the cytosol.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Glutathione reductase isolated and purified from Saccharomyces cerevisiae, UniProt: P41921
m6A (N6-methyladenosine) is a modified base, abundant in mRNA in most eukaryotes and found in tRNA’s, rRNA’s, snRNA’s and in long non-coding RNA’s. Adenosine methylation is catalyzed by m6A methyltransferase, a large protein complex which has a preference for the consensus sequence GGACU.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store lyophilized/reconstituted at -20 °C; for long term storage -80°Cis recommened; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Human, Mouse and other species
Immunogen:
BSA-conjugated N6-methyladenosine (m6A)
Applications:
Dot blot (Dot), RNA Immunoprecipitation (RIP) (RIP)
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Guilardia theta
Expected Species:
Algae, Cryptophyte Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from N-terminal sequence of nucleomorph protein.
This antibody can be used as a marker of nucleomorph in fractionation studies
Application Details:
1 : 1000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
13 kDa
Selected references:
Funk et al. (2011). High light stress and the one-helix LHC-like proteins of the cryptophyte Guillardia theta. Biochim Biophys Acta. 2011 Jul;1807(7):841-6. doi: 10.1016/j.bbabio.2011.03.011.
FCP (Fucoxanthin Chla/c protein) is a 19 kDa major Chl a/c protein and most highly expressed members of the Lhcf sub-clade.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
This antibody detects the 2 or 3 major Chl a/c proteins (a.k.a. FCPs), but not the Lhcx's proteins.Antibody will not bind to Lhcx1 (22kDa) or Lhcx6 (25 kDa) proteins of Thassiosira pseudonana.
Application Details:
1 : 1000-1 : 5000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
18-19 kDa
Selected references:
Bentley et al. (2005). Investigation of PSI-associated light-harvesting proteins in a chromophyte alga.” In: Photosynthesis: Fundamental Aspects to Global Perspectives (Eds. A. van der Est and D. Bruce), pp.161-163.
Lhcx6 is a subclade of fucoxanthin Chl a/c proteins.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Cyclotella sp., Thalassiosira pseudonana
Expected Species:
Diatoms Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from C-terminal sequence of Lhcx6 protein from Thalassiosira pseudonana.
Zhu and Green (2010). Photoprotection in the diatom Thalassiosira pseudonana: role of LI818-like proteins in response to high light stress. Biochim Biophys Acta. 2010 Aug;1797(8):1449-57. doi: 10.1016/j.bbabio.2010.04.003. Epub 2010 Apr 11.
Gamma CAH (Gamma Carbonic anhydrase) proteins are localized in the inner mitochondrial membrane. They are in a range of 25-30 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Oryza sativa
Expected Species:
Arachis duranensis, Brachypodium distachyon, Brassica oleracea, Brassica rapa, Camelina sativa, Capsella rubella, Citrus sinensis, Daucus carota, Erythranthe guttatus, Fragaria vesca subsp. vesca, Gossypium hirsutum, Jatropha curcas, Juglans regia, Lupinus angustifolius, Malus x domestica, Medicago truncatula, Nelumbo nucifera, Oryza brachyantha, Populus euphratica, Prunus mume, Pyrus x bretschneideri, Raphanus sativus, Sesamum indicum, Setaria italica, Solanum tuberosum, Tarenaya hassleriana, Theobroma cacao, Triticum aestivum, Zea mays, Zostera muelleri Species of your interest not listed? Contact us
Chen et al. (2019). Composition of Mitochondrial Complex I during the Critical Node of Seed Aging in Oryza sativa. Journal of Plant Physiology Volume 236, May 2019, Pages 7-14.K hn et al. (2015). Complete Mitochondrial Complex I Deficiency Induces an Up-Regulation of Respiratory Fluxes That Is Abolished by Traces of Functional Complex I. Plant Physiol. 2015 Aug;168(4):1537-49. doi: 10.1104/pp.15.00589. Epub 2015 Jul 1.
2 x 50 ml, two component ready to use solutions, enough for 50 midi blots (6,8 x 8,1 cm), which is 2754 cm2
Selected references:
Wieczorek et al. (2020) Development of a New Tomato Torrado Virus-Based Vector Tagged with GFP for Monitoring Virus Movement in Plants. Viruses. 2020 Oct 20;12(10):1195. doi: 10.3390/v12101195. PMID: 33092281; PMCID: PMC7588970.Fallah et al. (2018). Plasminogen activation is required for the development of radiation-induced dermatitis. Cell Death Dis. 2018 Oct 15;9(11):1051. doi: 10.1038/s41419-018-1106-8.
Store at -20 °C.Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
ICS1 | Isochorismate synthase 1 (chloroplastic) is involved in stress response and defence response to bacterium, fungus, leaf abscission, cold. Alternative names: AtICS1, EDS16, Enhanced disease susceptibility to erysiphe orontii 16, Salicyic acid induction deficient 2, SID2.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana (recombinant ICS1)
Expected Species:
please inquire
Immunogen:
KLH-conjugated synthetic peptide derived from Arabidopsis thaliana ICS1 protein sequence, UniProt: Q9S7H8, TAIR: At1g74710.The peptide is perfectly conserved in ICS1-1 and ICS1-2 isoforms of Arabidopsis thaliana.
ICS1 is present in too low levels to allow detection in control conditions. Antibody is recognzing ICS1 in transgenic lines which have ICS1 under 35S promotor and is recognizing well YFP-tagged ICS1.
Application Details:
1 : 1000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
62 | 55 kDa
Not reactive in:
Solanum lycopersicum, Zea mays
Selected references:
To be added when available, antibody released in January 2021
LUX (Transcription factor) essential for the generation of the circadian clock oscillation and activation of CCA1 and LHY expression. It is coregulated with TOC1 and seems to be repressed by CCA1 and LHY by direct binding of these proteins to the evening element in the LUX promoter. Binds to ELF3 and associates with ELF4 in a diurnal complex which is required for the expression of the growth-promoting transcription factors PIF4 and PIF5 and subsequent hypocotyl growth in the early evening.Alternative names: Protein LUX ARRHYTHMO, Protein PHYTOCLOCK 1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica napus, Camelina sativa, Capsella rubella, Eutrema salsugineum, Raphanus sativusSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from Arabidopsis thaliana LUX protein Q9SNB4, At3g46640
Dehydrin ERD10 belongs to dehydrin protein family.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to 3 years. Re-constituted antibody can be stored at 4°Cfor several days to weeks. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Brassica napus
Expected Species:
Brassica juncea, Brassica rapa, Capsella bursa-pastoris, Noccaea caerulescensSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Brassica napus ERD10, UniProt: Q69BP4
STN7 (serine/threonine protein kinase) (EC=2.7.11.1) in Arabidopsis thaliana, and its Stt7 homologue in Chlamydomonas reinhardtii, is required for LHCII phosphorylation and for state transitions. The loss of this thylakoid-associated kinase blocked stn7 (stt7)-deficient mutants in state 1. Alternative names: Protein STATE TRANSITION 7, Stt7 homolog.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to 3 years. Re-constituted antibody can be stored at 4°Cfor several days to weeks. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Nicotiana tabacum
Expected Species:
Anthurium amnicola, Arabidopsis alpina, Capsicum annuum, Dichanthelium oligosanthes, Glycine soja, Gossypium hirsutum, Hordeum vulgare, Medicago truncatula, Morus notabilis, Nelumbo nucifera, Nicotiana sylvestris, Noccaea caerulescens, Vigna radiata var. Radiata Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide specific for Arabidopsis thaliana STN7 serine/threonine kinase, UniProt: Q9S713, TAIR: At1g68830
For reconstitution please add 50 l of sterile water
Molecular Weight:
63,2 | 44 kDa (on urea gel), 55 kDa (no urea)
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Mazur et al. (2021) The SnRK2.10 kinase mitigates the adverse effects of salinity by protecting photosynthetic machinery. Plant Physiol. 2021 Dec 4;187(4):2785-2802. doi: 10.1093/plphys/kiab438. PMID: 34632500; PMCID: PMC8644180.Pralon et al. (2019). Plastoquinone homoeostasis by Arabidopsis proton gradient regulation 6 is essential for photosynthetic efficiency. Commun Biol. 2019 Jun 20;2:220. doi: 10.1038/s42003-019-0477-4. Ancin et al. (2019). Overexpression of thioredoxin m in tobacco chloroplasts inhibits the protein kinase STN7 and alters photosynthetic performance. J Exp Bot. 2019 Feb 5;70(3):1005-1016. doi: 10.1093/jxb/ery415.Rudenko et al. (2019). The role of carbonic anhydrase ?-CA4 in the adaptive reactions of photosynthetic apparatus: the study with ?-CA4 knockout plants. Protoplasma (2019). https://doi.org/10.1007/s00709-019-01456-1Nikkanen et al. (2018). Multilevel regulation of non-photochemical quenching and state transitions by chloroplast NADPH-dependent thioredoxin reductase. Physiol Plant. 2018 Dec 22. doi: 10.1111/ppl.12914.
Thioredoxin-like protein HCF164, chloroplastic is involved in maintaining cell redox homeostasis. The portein displayes disulfide reductase activity that is involved in the biogenesis of the plastid cytochrome b6f complex. Protein is located in the thylakoid membrane with the C-terminal hydrophilic portion, containing the thioredoxin like domain, extending into the thylakoid lumen.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to 3 years. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Aegilops tauschii, Anthurium amnicola, Cajanus cajan, Cephalotus follicularis, Cicer arietinum, Corchorus olitorius, Cucumis melo, Dichanthelium oligosanthes, Glycine soja, Gossypium hirsutum, Medicago truncatula, Morus notabilis, Musa acuminata, Nelumbo nucifera, Nicotiana sylvestris, Nicotiana tabacum, Oryza sativa subsp. japonica, Saccharum hybrid cultivar R570, Solanum chacoense , Theobroma cacao, Vigna radiata var. radiata, Zea mays Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana HCF164 protein sequence, UniProt: A0A178V430,, TAIR: AT4G37200
FBA (Fructose-bisphosphate aldolase, chloroplastic) is an enzyme involved in step 4 of the subpathway that synthesizes D-glyceraldehyde 3-phosphate and glycerone phosphate from D-glucose.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Standard extraction protocol for leaf tissue can be applied. The antibody is directed on the unique peptide present in a chloroplast form of aldolase; it does not react with a cytosolic form in the Lolium-Festuca species.
Application Details:
1 :4000-1 : 8000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
42 | 38 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Fukayama et al. (2018). Expression level of Rubisco activase negatively correlates with Rubisco content in transgenic rice. Photosynth Res. 2018 May 30. doi: 10.1007/s11120-018-0525-9.Perlikowski et al. (2016). Water deficit affects primary metabolism differently in two Lolium multiflorum/Festuca arundinacea introgression forms with a distinct capacity for photosynthesis and membrane regeneration. Frontiers in Plant Science 7:1063. doi: 10.3389/fpls.2016.01063
Special application note:
This product can be sold containing ProClin if requested.
Cytokinins (CK) belong to a class of plant growth substances (plant hormones) which promote cell deivision by means of local and long distance signalling. Zeatin is an adenine-type cytokinin synthesised in stems, leaves and roots.
Product Type:
Antibody
Storage Temp:
Aliquote and store at -20 °C to avoid freezing and thawing cycles.
Cytokinins (CK) belong to a class of plant growth substances (plant hormones) which promote cell deivision by means of local and long distance signalling.Zeatin is an adenine-type cytokinin synthesised in stems, leaves and roots. Synonym: 9-(β-D-Ribofuranosyl)-trans-zeatin, N6-(trans-4-Hydroxy-3-methyl-2-buten-1-yl)adenosine
Product Type:
Antibody
Storage Temp:
Aliquote and store at -20 °C to avoid freezing and thawing cycles.
Botulinum toxin is a toxin produced by the anaerobic, gram-positive, bacterium of the genus Clostridium (C. botulinum, C. butyricum, C. baratii and C. argentinense). These strains are widely distributed and can be found in soil and dust. Eight types of botulinum toxin are distinguished, named type A–H. Type A and B are capable of causing disease in humans (botulism) and have longest activity in vivo, and are also used commercially (BOTOX) and medically. Types C–G are less common; types E and F can cause disease in humans, while the other types cause disease in other animals. BotB is cleaved into two chains: heavy and light. Alternative name: Bontoxilysin-B
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to 3 years. Re-constituted antibody can be stored at 4°Cfor several days to weeks. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Botulinum toxin is a toxin produced by the anaerobic, gram-positive, bacterium of the genus Clostridium (C. botulinum, C. butyricum, C. baratii and C. argentinense). These strains are widely distributed and can be found in soil and dust. Eight types of botulinum toxin are distinguished, named type A–H. Type A and B are capable of causing disease in humans (botulism) and have longest activity in vivo, and are also used commercially (BOTOX) and medically. Types C–G are less common; types E and F can cause disease in humans, while the other types cause disease in other animals. BotA is cleaved into two chains: heavy and light. Alternative name: Bontoxilysin-A
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to 3 years. Re-constituted antibody can be stored at 4°Cfor several days to weeks. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Botulinum toxin A heavy chain
Immunogen:
Recombinat C-terminal heavy chain of BoNT/A1, residues 876–1296, which was cloned into a pET28a His-tag vector (Novagen) and overexpressed in E.coli. UniProt: https://www.uniprot.org/uniprot/P10845
PPH1/TAP38 (Protein phosphatase 1) is a choroplast protein phosphatase TAP38/PPH1, required for efficient dephosphorylation of the LHCII anthena and state transition from state 2 to state 1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Cajanus cajan, Cephalotus follicularis, Cicer arietinum, Cucumis melo, Glycine soja, Gossypium hirsutum, Ilex paraguariensis, Mesembryanthemum crystallinum, Nelumbo nucifera, Nicotiana tabacum, Noccaea caerulescens, Populus trichocarpa, Ricinus communis, Theobroma caca, Vigna radiata var. radiata Species of your interest not listed? Contact us
HXK1 (Hexokinase 1) is an enzyme of plant glucose-signaling network which functions as a glucose sensor. Alternative name: Protein GLUCOSE INSENSITIVE 2.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Upadhyaya and Jagadeeshwar Rao (2019). Reciprocal regulation of photosynthesis and mitochondrial respiration by TOR kinase in Chlamydomonas reinhardtii. Plant Direct Volume 3, Issue 11.
RPL33 | 50S ribosomal protein L33 (chloroplastic) involved in translation process, large subunit of a ribosomal complex. Belongs to bacterial, ribosomal protein bl33 family.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
ATG9 (Autophagy-related protein 9) is required for autophagy that plays an essential role in plant nutrient recycling. Alternative name: AtAPG9.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles.Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Plant ATG9 is most likely N-glycosylated, and glycosylated membrane proteins can migrate as more than one form in SDS-PAGE (smear); the protein most likely forms functional dimers which could be detected also after western blotting. Usage of microsomal fraction is highly recommended.
ATG9 (Autophagy-related protein 9) is required for autophagy that plays an essential role in plant nutrient recycling. Alternative name: AtAPG9.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles.Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica campestris, Brassica rapa subsp. pekinensis, Capsella rubella, Eutrema salsugineum Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana ATG9 protein sequence, N-terminal part, UniProt: Q8RUS5, TAIR: AT2G31260
(6-4)DNA photolyase; Involved in repair of UV radiation-induced DNA damage. Catalyzes the photoreactivation of pyrimidine [6-4] pyrimidone photoproduct (6-4 products). Binds specifically to DNA containing 6-4 products and repairs these lesions in a visible light- dependent manner. Not required for repair of cyclobutane pyrimidine dimer (CPD).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana UVR3-GFP
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana UVR3 protein sequence, UniProt: O48652-1, TAIR: AT3G15620
No confirmed exceptions from predicted reactivity are currently known
Selected references:
To be added when available, antibody available in September 2022.
Special application note:
Reactivity of this antibbody on endogenous material remains to be determined. UVR3 is a low abundance protein, therefore use of specific cellular fraction or concentration through TCA/acetone precipitation is recommended.
NAD(P)H-quinone oxidoreductase subunit 2 is involved in the transfer of electrons from NAD(P)H:plastoquinone, via FMN and iron-sulfur centers, to quinones in the photosynthetic chain and possibly in a chloroplast respiratory chain. Alternative names: NAD(P)H dehydrogenase, subunit 2, NADH-plastoquinone oxidoreductase subunit 2.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Hordeum vulgare
Expected Species:
Trema orientale, Parasponia andersonii, Populus tomentosa, Prunus avium, Raphanus sativus, Ziziphus jujuba Species of your interest not listed? Contact us
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Nikkanen et al. (2018). Regulation of cyclic electron flow by chloroplast NADPH‐dependent thioredoxin system. Plant Direct https://doi.org/10.1002/pld3.93
NAD(P)H dehydrogenase subunit H (EC=1.6.5) is involved in the transfer of electrons from NAD(P)H:plastoquinone, via FMN and iron-sulfur centers, to quinones in the photosynthetic chain and possibly in a chloroplast respiratory chain. Alternative names: NAD(P)H dehydrogenase subunit H; NDH7NADH-plastoquinone oxidoreductase 49 kDa subunit, NADH-plastoquinone oxidoreductase subunit H.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Zea mays
Expected Species:
Cannabis sativa, Hordeum vulgare, Microcystis aeruginosa PCC 7806, Physcomitrella patens, Synechocystis sp. Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from Arabidopsis thaliana NdhH protein sequence, UniProt:P56753-1, TAIR: ATCG01110
This product can be sold containing proclin if requested
Application Details:
1:5000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
45 | 49 kDa
Not reactive in:
Pisum sativum, Phaseolus vulgaris
Selected references:
Seiml-Buchinger et al. (2022) Ascorbate peroxidase postcold regulation of chloroplast NADPH dehydrogenase activity controls cold memory. Plant Physiol. 2022;190(3):1997-2016. doi:10.1093/plphys/kiac355Wada et al. (2021) Identification of a Novel Mutation Exacerbated the PSI Photoinhibition in pgr5/pgrl1 Mutants; Caution for Overestimation of the Phenotypes in Arabidopsis pgr5-1 Mutant. Cells. 2021 Oct 26;10(11):2884. doi: 10.3390/cells10112884. PMID: 34831107; PMCID: PMC8616342.Nikkanen et al. (2018). Regulation of chloroplast NADH dehydrogenase-like complex by NADPH-dependent thioredoxin system. CSH, BioRixiv, doi: https://doi.org/10.1101/261560.
NAD(P)H-quinone oxidoreductase subunit 2 is involved in the transfer of electrons from NAD(P)H:plastoquinone, via FMN and iron-sulfur centers, to quinones in the photosynthetic chain and possibly in a chloroplast respiratory chain. Alternative names: NAD(P)H dehydrogenase, subunit 2, NADH-plastoquinone oxidoreductase subunit 2.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Penzler et al. (2022) Commonalities and specialties in photosynthetic functions of PROTON GRADIENT REGULATION5 variants in Arabidopsis. Plant Physiol. 2022;190(3):1866-1882. doi:10.1093/plphys/kiac363Shen et al. (2022) Architecture of the chloroplast PSI-NDH supercomplex in Hordeum vulgare. Nature. 2022 Jan;601(7894):649-654. doi: 10.1038/s41586-021-04277-6. Epub 2021 Dec 8. PMID: 34879391.Wada et al. (2021) Identification of a Novel Mutation Exacerbated the PSI Photoinhibition in pgr5/pgrl1 Mutants; Caution for Overestimation of the Phenotypes in Arabidopsis pgr5-1 Mutant. Cells. 2021 Oct 26;10(11):2884. doi: 10.3390/cells10112884. PMID: 34831107; PMCID: PMC8616342.
ClpT1 (ATP-dependent Clp protease ATP-binding subunit CLPT1, chloroplastic) is an Accessory protein regulating the assembly of the plastidial Clp protease system. Alternative name:nClpC-like protein.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
BSA-conjugated peptide derived from ClpT1 of Arabidopsis thaliana, TAIR: AT4G25370, UniProt: Q93WL3
For western blot detection image refer to the article below
Application Details:
1 : 4000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
26 | 19 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Sj gren et al. (2004). Inactivation of the clpC1 gene encoding a chloroplast Hsp100 molecular chaperone causes growth retardation, leaf chlorosis, lower photosynthetic activity, and a specific reduction in photosystem content. Plant Physiol. 2004 Dec;136(4):4114-26. Epub 2004 Nov 24.
ClpR4 (ATP-dependent Clp protease proteolytic subunit-related protein 4, chloroplastic) is involved in plastid protein homeostasis. Alternative names: ClpP4, Protein HAPPY ON NORFLURAZON 5.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica oleracea, Cajanus cajan, Capsella rubella, Coffea canephora, Cucumis sativus, Erythranthe guttata, Eutrema salsugineum, Genlisea aurea, Glycine max, Jatropha curcas, Medicago truncatula, Morus notabilis, Populus trichocarpa, Ricinus communis, Solanum lycopersicum, Solanum tuberosum, Vitis viniferaSpecies of your interest not listed? Contact us
Immunogen:
BSA-conjugated peptide derived from ClpR4 of Arabidopsis thaliana, TAIR: AT4G17040, UniProt: Q8LB10
For western blot detection image refer to the article below
Application Details:
1 : 4000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
33,4 | 24,5 kDa
Not reactive in:
Zea mays
Selected references:
Sj gren et al. (2004). Inactivation of the clpC1 gene encoding a chloroplast Hsp100 molecular chaperone causes growth retardation, leaf chlorosis, lower photosynthetic activity, and a specific reduction in photosystem content. Plant Physiol. 2004 Dec;136(4):4114-26. Epub 2004 Nov 24.
ClpR3 (ATP-dependent Clp protease proteolytic subunit-related protein 3, chloroplastic) is a serine-type endopeptidase located in chloroplast stoma. Alternative names: ClpR3, nClpP8.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica napus, Capsella rubella , Populus trichocarpa, Vitis viniferaSpecies of your interest not listed? Contact us
Immunogen:
BSA-conjugated peptide derived from ClpR3 of Arabidopsis thaliana, TAIR: AT1G09130 , UniProt:Q8L770
For western blot detection image refer to the article below
Application Details:
1 : 1000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
36 | 28,5 kDa
Not reactive in:
Zea mays
Selected references:
Sj gren et al. (2004). Inactivation of the clpC1 gene encoding a chloroplast Hsp100 molecular chaperone causes growth retardation, leaf chlorosis, lower photosynthetic activity, and a specific reduction in photosystem content. Plant Physiol. 2004 Dec;136(4):4114-26. Epub 2004 Nov 24.
ClpR2 (ATP-dependent Clp protease proteolytic subunit-related protein 2, chloroplastic) is required for chloroplast development and integrity and is involved in the regulation of plastoglobules formation.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Beta vulgaris subsp. vulgaris, Brassica napus, Eucalyptus grandis, Gossypium arboreum, Phaseolus vulgaris, Spinacia oleraceaSpecies of your interest not listed? Contact us
Immunogen:
BSA-conjugated peptide derived from ClpR2 of Arabidopsis thaliana, TAIR: AT1G12410 , UniProt: Q9XJ36 .
For western blot detection image refer to the article below
Application Details:
1 : 1000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
31 | 25 kDa
Not reactive in:
Zea mays
Selected references:
Sj gren et al. (2004). Inactivation of the clpC1 gene encoding a chloroplast Hsp100 molecular chaperone causes growth retardation, leaf chlorosis, lower photosynthetic activity, and a specific reduction in photosystem content. Plant Physiol. 2004 Dec;136(4):4114-26. Epub 2004 Nov 24.
ClpR1 (ATP-dependent Clp protease proteolytic subunit-related protein 1, chloroplastic) is a protease required for chloroplast development. Alternative names: CLP PROTEASE PROTEOLYTIC SUBUNIT 1, CLPR1, NCLPP5, NUCLEAR CLPP 5, SUPPRESSOR OF VARIEGATION 2, SVR2.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica napus, Citrus sinensis, Daucus carota subsp. sativus, Eucalyptus grandis, Spinacia oleraceaSpecies of your interest not listed? Contact us
Immunogen:
BSA-conjugated peptide derived from ClpR1 of Arabidopsis thaliana, TAIR: AT1G49970 , UniProt:Q9XJ35
For western blot detection image refer to the article below
Application Details:
1 : 500 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
42 | 28 kDa
Not reactive in:
Zea mays
Selected references:
Lee & Back . (2021) Melatonin Regulates Chloroplast Protein Quality Control via a Mitogen-Activated Protein Kinase Signaling Pathway. Antioxidants. 2021; 10(4):511. https://doi.org/10.3390/antiox10040511Sj gren et al. (2004). Inactivation of the clpC1 gene encoding a chloroplast Hsp100 molecular chaperone causes growth retardation, leaf chlorosis, lower photosynthetic activity, and a specific reduction in photosystem content. Plant Physiol. 2004 Dec;136(4):4114-26. Epub 2004 Nov 24.
ClpP6 (ATP-dependent Clp protease proteolytic subunit 6, chloroplastic) is the nuclear encoded protease involved in the degradation of misfolded proteins.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica napus, Capsella rubella, Eutrema salsugineum Species of your interest not listed? Contact us
Immunogen:
Full length Arabidopsis thaliana ClpP6 protein (minus transit peptide) fused to MBP (maltose binding protein). TAIR: AT1G11750 , UniProt:F4IAG5
ClpP5 (ATP-dependent Clp protease proteolytic subunit 5, chloroplastic) is a nuclear encoded protease involved in the degradation of misfolded proteins. Alternative names: ClpP5, nClpP5.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
ClpP4 (ATP-dependent Clp protease proteolytic subunit 4, chloroplastic) is an enzyme which cleaves peptides in various proteins in a process that requires ATP hydrolysis. Displays a chymotrypsin-like activity. Plays a major role in the degradation of misfolded proteins and is essential protein required for chloroplast development and integrity as well as for embryogenesis. Alternative names: endopeptidase ClpP4, nClpP4.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
KLH-conjugated peptide derived from ClpP4 of Arabidopsis thaliana, UniProt:Q94B60, TAIR: AT5G45390
ClpP3 (ATP-dependent Clp protease proteolytic subunit 3, chloroplastic) involved in protein degradation of misfolded proteins.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Capsella rubella, Daucus carota subsp. sativus, Eutrema salsugineum, Jatropha curcas, Prunus persica, Zostera marina Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from ClpP3 of Arabidopsis thaliana, TAIR: AT1G66670, UniProt: Q9SXJ6.
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica napus, Cannabis sativa, Capsella grandiflora, Cardamine impatiens, Cochlearia borzaeana, Eutrema halophilum, Ionopsidium acaule, Isatis tinctoria, Lepidium densiflorum, Nasturtium officinale, Pachycladon cheesemanii, Pugionium cornutum, Raphanus sativusSpecies of your interest not listed? Contact us
Immunogen:
N-terminal 23 amino acid sequence of the Arabidopsis thaliana ClpP1 protein fused to the MBP (maltose binding protein). TAIR: ATCG006, UniProt:P56772.
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
C-terminal 170 amino acid sequence of the Arabidopsis thaliana ClpD protein fused to the MBP (maltose binding protein), TAIR:AT5G51070, UniProt:P42762.
This antibody is slightly cross reacting with ClpC. Image on page 96 in Zheng et al. (2002).For western blot detection image refer to the article below.
Application Details:
1 : 5000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
103 | 102 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Zheng et al. (2002). Characterization of Chloroplast Clp proteins in Arabidopsis: Localization, tissue specificity and stress responses. Physiol Plant. 2002 Jan;114(1):92-101.
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Synechococcus sp. strain PCC 7942
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
C-terminal 218 amino acid sequence of the Synechococcus sp. strain PCC 7942 ClpX protein, fused to the MBP (maltose binding protein). UniProt: O34126.
For western blot detection image refer to the article below
Application Details:
1 : 2000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
49 | 52 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Schelin et al. (2002). The clpP multigene family for the ATP-dependent Clp protease in the cyanobacterium Synechococcus. Microbiology. 2002 Jul;148(Pt 7):2255-65.
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Synechococcus sp. strain PCC 7942
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Full length Synechococcus sp. strin 7942 ClpS2 protein. UniProt: Q31R11
For western blot detection image refer to the article below
Application Details:
1 : 3000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
12,5 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Tryggvesson et al. (2015). Characterization of ClpS2, an essential adaptor protein for the cyanobacterium Synechococcus elongatus. FEBS Lett. 2015 Dec 21;589(24 Pt B):4039-46. doi: 10.1016.
ClpS1 (ATP-dependent Clp protease adapter protein ClpS) is involved in the modulation of the specificicity of the ClpAP-mediated ATP-dependent protein degradation.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Synechococcus sp. strain PCC 7942
Expected Species:
Cyanobacteria Species of your interest not listed? Contact us
Immunogen:
Full length Synechococcus sp. strain PCC 7942 ClpS1 protein, fused to MBP (maltose binding protein). UniProt: Q31QE7
ClpR is a ClpP like protease which lacks the catalytic triad enabkling it to function as a Ser-type protease.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Synechococcus sp. strain PCC 7942
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Full length Synechococcus sp. strain PCC 7942 ClpR protein, fused to MBP (maltose binding protein), UniProt: Q9L4P4.
ClpP3 (ATP-dependent Clp protease proteolytic subunit 3) is one of three different isozymes of ClpP protease.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Synechococcus sp. strain PCC 7942
Expected Species:
Arthrospira platensis C1, Crocosphaera watsonii WH 0005 , Cyanothece sp. (strain PCC 7822), Leptolyngbya sp. PCC 7375, Lyngbya sp. strain PCC 8106, Microcystis aeruginosa PCC 9806, Pleurocapsa sp. PCC 7327, Prochlorococcus marinus str. MIT 1327, Prochlorothrix hollandica PCC 9006, Synechocystis sp. strain PCC 6803, Trichodesmium erythraeum strain IMS101 Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from ClpP3 of Synechococcus sp. strain PCC 7942, UniProt: Q9L4P3
For western blot detection image refer to the article below
Application Details:
1 : 2000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
22 | 21 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Schelin et al. (2002). The clpP multigene family for the ATP-dependent Clp protease in the cyanobacterium Synechococcus. Microbiology. 2002 Jul;148(Pt 7):2255-65.
Special application note:
This antibody does not cross react with other ClpP isoforms
ClpP2 (ATP-dependent Clp protease proteolytic subunit 2) is one of three different isozymes of ClpP protease.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Synechococcus sp. strain PCC 7942
Expected Species:
Cyanobacteria Species of your interest not listed? Contact us
Immunogen:
Full length Synechococcus sp. strain PCC 7942 ClpP2 protein, fused to MBP (maltose binding protein). UniProt: O34125
For western blot detection image refer to the article below
Application Details:
1 : 2000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
23,5 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Schelin et al. (2002). The clpP multigene family for the ATP-dependent Clp protease in the cyanobacterium Synechococcus. Microbiology. 2002 Jul;148(Pt 7):2255-65.
Special application note:
This antibody does not cross react with other ClpP isoforms
ClpP1 (ATP-dependent Clp protease proteolytic subunit 1) is one of three different isozymes of ClpP protease.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
For western blot detection image refer to the article below
Application Details:
1 :4000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
22 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Schelin et al. (2002). The clpP multigene family for the ATP-dependent Clp protease in the cyanobacterium Synechococcus. Microbiology. 2002 Jul;148(Pt 7):2255-65.
Special application note:
This antibody does not cross react with other ClpP isoforms
Senescence-specific cysteine protease (SAG12) is a cysteine protease influenced by cytokinin, auxin and sugars and involved in developmental senescence specific cell death.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Actinidia deliciosa, Brassica rapa, Gossypium hirsutum, Petunia hybrida, Morus notabilis, Nicotiana tabacum, Petunia hybrida, Populus trichocarpa, Ricinus communis, Theobroma cacao Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana SAG12 protein sequence, UniProt:Q38886, TAIR: AT5G45890
Recommended plant extraction buffer: See Durian et al. (2019). Denature in Laemmli-sample buffer (final concentrations: 5% (v/v) beta-mercaptoethanol, 69 mM Tris-HCl pH 6.8, 11.1% (v/v) glycerol, 2.15 % (v/v) SDS) at 70◦C for 5 min
Application Details:
1 : 2000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
38 | 28 kDa
Not reactive in:
Citrus sinensis
Selected references:
Durian et al. (2019). PROTEIN PHOSPHATASE 2A-B' gamma controls Botrytis cinerea resistance and developmental leaf senescence. Plant Physiol. 2019 Oct 28. pii: pp.00893.2019. doi: 10.1104/pp.19.00893.Durian et al. (2019). PROTEIN PHOSPHATASE 2A-B'? controls Botrytis cinerea resistance and developmental leaf senescence. Plant Physiol. 2019 Oct 28. pii: pp.00893.2019. doi: 10.1104/pp.19.00893.Frank et al. (2019). The Hordeum vulgare cysteine protease HvPAP14 plays a role in degradation of chloroplast proteins. J Exp Bot. 2019 Aug 12. pii: erz356. doi: 10.1093/jxb/erz356.
ZCP1 belongs to a large family of putative metallochaperones, likned with maintainance of zinc homeostasis in all living organisms.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii
Expected Species:
Emiliania huxleyi Species of your interest not listed? Contact us
Immunogen:
Recombinant, full length ZCP1 protein of Chlamydomonas reinhardtii, Cre14.g630871, UniProt: A0A059VIM6
ATG8 (Autophagy-related protein 8) is involved in degradation and recycling of intracellular components in a process of autophagy. ATG8 is a molecular autophagy marker in Chlamydomonas reinhardtii (P rez-P rez et al. 2010, Plant Physiol. 152: 1874-88).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
For Arabidopsis thaliana the signal obtained using ATG8 antibodies is cleaner in case of roots compare to leaf material. For best results please follow extraction protocol described in lvarez et al. (2012). ATG8 signal corresponds to the two bands of 17 kDa.Preparation of a cell extract from Arabidopsis thaliana:A. Plants were first subjected to autophagy activating conditions: nutrient (nitrogen or carbon) limitation or oxidative stress in order to activate this degradative process.B. Total protein extracts can be obtained as described by lvarez. Leaves are grinded in liquid nitrogen with a minimal volume of extraction buffer (100 mM Tris-HCl pH 8, 400 mM sucrose, 1 mM EDTA, 0.1 mM phenylmethylsulfonyl fluoride (PMSF), 10 mg/ml sodium deoxycholate, 10 g/ml of leupeptin, 10 g/ml of pepstatin A, 4% (v/v) protease inhibitor cocktail from Roche).C. Cell debris is removed by centrifuging at 500 g for 10 min at 4 C.Important note:It is recommendable to use bigger gels in order to get a better resolution of ATG8 bands. Midi-protean gels are better than mini-gels. There are 9 ATG8 isoforms and this antibody will likely recognizes all of them.For immunolocalization protocol, please inquire.
Application Details:
1 : 1000 (IL), 1 : 1000-1 : 2000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
15,2 | 15 kDa
Not reactive in:
Cuscuta chinensis
Selected references:
Sun et al. (2022) Genome of Paspalum vaginatum and the role of trehalose mediated autophagy in increasing maize biomass. Nat Commun. 2022;13(1):7731. Published 2022 Dec 13. doi:10.1038/s41467-022-35507-8Cao et al. (2022) Autophagic pathway contributes to low-nitrogen tolerance by optimizing nitrogen uptake and utilization in tomato. Hortic Res. 2022 Mar 23;9:uhac068. doi: 10.1093/hr/uhac068. PMID: 35669705; PMCID: PMC9164271.Samperna et al (2022). Cyclopaldic Acid, the Main Phytotoxic Metabolite of Diplodia cupressi, Induces Programmed Cell Death and Autophagy in Arabidopsis thaliana. Toxins (Basel). 2022 Jul 11;14(7):474. doi: 10.3390/toxins14070474. PMID: 35878212; PMCID: PMC9325063.Zharova et al. (2022) Role of Autophagy in Haematococcus lacustris Cell Growth under Salinity. Plants. 2022; 11(2):197. https://doi.org/10.3390/plants11020197 (immunofluorescence)Mishra et al. (2021) Interplay between abiotic (drought) and biotic (virus) stresses in tomato plants. Mol Plant Pathol. 2021 Dec 30. doi: 10.1111/mpp.13172. Epub ahead of print. PMID: 34970822.
Special application note:
This product can be sold containing ProClin if requested.This antibody is recognizing 1 ng of recombinant CrATG8. Antigen used to elicit this antibody is conserved from 70-80 % in following ATG protein from Arabidopsis thaliana: ATG8a UniProt: Q8LEM4 ATG8B UniProt: Q9XEB5 ATG8c UniProt: Q8S927 ATG8d UniProt: Q9SL04, ATG8e UniProt: Q8S926 ATG8f UniProt: Q8VYK7 and conserved below 70 % in: ATG8g UniProt: Q9LZZ9 ATG8h Uniprot: Q8S92This antibody does not recognize all isoforms into the same degree.
CPT6 (cis-prenyltransferase 6) belong to a group of enzymes which synthesize isoprenoid hydrocarbon skeleton with isoprenoid units in the cis (Z) configuration. AtCPT6 is one of the nine Arabidopsis thaliana CPTs, which catalyze the synthesis of a family of very short-chain polyisoprenoid alcohols of six, seven, and eight isoprenoid units.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Surmacz et al. (2014). cis-Prenyltransferase AtCPT6 produces a family of very short-chain polyisoprenoids in planta. Biochim Biophys Acta. 2013 Dec 1;1841(2):240-250. doi: 10.1016/j.bbalip.2013.11.011.
Special application note:
Surmacz described this protein in 20111 as AtCPT6, In TAIR is named ATCPT5 and in UniProt: Dehydrodolichyl diphosphate synthase 3
Deg8 protease forms a hexamer together with Deg5 in the thylakoid lumen and is involved in the cleavage of photodamaged D2 protein of photosystem II. Localized in thylakoid lumen.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Nicotiana tabacum
Expected Species:
Brassica pekinensis, Glycine max, Phaseolus vulgaris, Populus balsamifera, Ricinus communis, Solanum lycopersicum, Vitis vinifera Species of your interest not listed? Contact us
Immunogen:
Recombinant mature Deg8 of Arabidopsis thaliana UniProt: Q9LU10,TAIR:AT5G39830, overexpressed in E.coli
LHCSR3 (Stress-related chlorophyll a/b binding protein 3) plays a role in an efficient enery dissipation process, called non-photochemical quenching (NPQ), in Chlamydomonas reinhardtii.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Bohmer et al. (2023) Chlamydomonas reinhardtii mutants deficient for Old Yellow Enzyme 3 exhibit increased photooxidative stress. Plant Direct. 2023;7(1):e480. Published 2023 Jan 15. doi:10.1002/pld3.480Cazzaniga et al. (2022). Engineering astaxanthin accumulation reduces photoinhibition and increases biomass productivity under high light in Chlamydomonas reinhardtii. Biotechnol Biofuels Bioprod. 2022 Jul 11;15(1):77. doi: 10.1186/s13068-022-02173-3. PMID: 35820961; PMCID: PMC9277849.Burlacot et al. (2022) Alternative photosynthesis pathways drive the algal CO2-concentrating mechanism. Nature 605, 366–371 (2022). https://doi.org/10.1038/s41586-022-04662-9Cecchin et al (2021) LPA2 protein is involved in photosystem II assembly in Chlamydomonas reinhardtii. Plant J. 2021 Jul 4. doi: 10.1111/tpj.15405. Epub ahead of print. PMID: 34218480.Roach et al. (2020). The non-photochemical quenching protein LHCSR3 prevents oxygen-dependent photoinhibition in Chlamydomonas reinhardtii. J Exp Bot. 2020 Jan 16. pii: eraa022. doi: 10.1093/jxb/eraa022.
Kelch repeat-containing protein (KrP)/Galactose oxidase is a protein associated with iron acquisition and metal homeostasis which is a marker for iron defficiency due to the fact that the transcript levels are stably regulated under iron defficiency conditions. Protein can be a target of of bHLH39, bHLH100 and bHLH101 transcription factors. The gene localized at locus At3g07720 is a supposed ancestor of NSP (nitrile-specifier proteins), NSP1, NSP2, and NSP5, which unlike its descendants does not show nitrile-specifier activity.Alternative names: NSL1, NSP-like1, nitrile-specifier protein-like 1
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
This antibody will also bind to recombinant KrP (range 10 ng - 1 g)
Application Details:
1 : 2000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
35,7 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
KrP (NSL1) and NSP5 (nitrile-specifier protein 5) share 53% of amino acid sequence, thus the antibody might also recognize NSP5 from different plant species
Gene At5g11840 is encoding a chloroplast localized protein, called also YCF36.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
higher plants, for specific species Species of your interest not listed? please inquire
Immunogen:
Full length, recombiant protein of Arabidopsis thaliana, UniProt: B6IDH6-1, TAIR:At5g11840
Kelch repeat-containing protein (KrP)/Galactose oxidase is a protein associated with iron acquisition and metal homeostasis.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Major carboxysome shell protein is involved in the formation of the carboxysome, polyhedral includion sequestering Rubisco.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Algae (red), Cyanobacteria, CryptomonadsSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide conserved in Major carboxysome shell protein 1A, UniProt: P45689, Major carboxysome shell protein 1B UniProt: P45690, Major carboxysome shell protein 1C, UniProt: P45688
Huang, Jiang, Yang, et al. (2022) Probing the Internal pH and Permeability of a Carboxysome Shell. Biomacromolecules. 2022;23(10):4339-4348. doi:10.1021/acs.biomac.2c00781Chen et al. (2022) ACS Synth. Biol. 2022, 11, 1, 154-161Publication Date:October 19, 2021 https://doi.org/10.1021/acssynbio.1c00311Li et al. (2020). Reprogramming bacterial protein organelles as a nanoreactor for hydrogen production. Nat Commun. 2020 Oct 28;11(1):5448. doi: 10.1038/s41467-020-19280-0. PMID: 33116131; PMCID: PMC7595155.Long et al. (2018). Carboxysome encapsulation of the CO2-fixing enzyme Rubisco in tobacco chloroplasts. Nat Commun. 2018 Sep 3;9(1):3570. doi: 10.1038/s41467-018-06044-0.
LEA (Late embryogenesis abundant) proteins are very hydrophilic proteins, described over 25 years ago as accumulating during late stages of plant seed development. Found in vegetative plant tissues following exposure to environmental stress. Synonymes: Putative late embryogenesis abundant protein LEA.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Arachis hypogaea, Brassica sp., Glycine max, Medicago truncatula, Phaseolus vulgaris, Thellungiella halophila Species of your interest not listed? Contact us
Immunogen:
recombinant LEA4-5 from Arabidopsis thaliana: UniProt: Q9FG31, TAIR: AT5G06760, a group 4 LEA protein (Battaglia et al., 2008)
LEA (Late embryogenesis abundant) proteins are very hydrophilic proteins, described over 25 years ago as accumulating during late stages of plant seed development. Found in vegetative plant tissues following exposure to environmental stress. Synonymes: Putative late embryogenesis abundant protein LEA.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Arachis hypogaea, Brassica sp., Glycine max, Medicago truncatula, Phaseolus vulgaris, Thellungiella halophila Species of your interest not listed? Contact us
Immunogen:
recombinant LEA4-5 from Arabidopsis thaliana: UniProt: Q9FG31, TAIR: AT5G06760, a group 4 LEA protein (Battaglia et al., 2008)
LEA4-25 (Group 4-late embryogenesis abundant protein PvLEA4-25) belongs to a group of very hydrophilic proteins, described over 25 years ago as accumulating during late stages of plant seed development. Found in vegetative plant tissues following exposure to environmental stress. Synonymes: Putative late embryogenesis abundant protein LEA.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Phaseolus vulgaris
Expected Species:
Glycine tomentosa Species of your interest not listed? Contact us
Immunogen:
Recombinant Phaseolus vulgaris PvLEA 4-1 sequence derived from Pv01G142000
The PvLEA4-1 protein from common bean presents a deduced molecular mass of 16 kDa; however, as other LEA and disordered proteins it migrates with an apparent higher molecular mass, possibly due to post-translational modifications
Application Details:
1 : 2000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
16 | 18 kDa
Not reactive in:
Arabidopsis thaliana
Special application note:
This antibody does not recognize group 4 LEA proteins from Arabidopsis thaliana.
LEA (Late embryogenesis abundant) proteins are very hydrophilic proteins, described over 25 years ago as accumulating during late stages of plant seed development. Found in vegetative plant tissues following exposure to environmental stress.Synonymes: Putative late embryogenesis abundant protein LEA.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Recombiant PvLEA6-3
Expected Species:
Arabidopsis thaliana, Arachis hypogaea, Glycine max, Medicago truncatula, Phaseolus vulgarisSpecies of your interest not listed? Contact us
Immunogen:
Recombinant PvLEA 6 (original name LEA18) (AF240774.1, gi 8895962) from Phaseolus vulgaris, a group 6 LEA protein (Battaglia et al., 2008)
CDPK (calcium-dependent protein kinase) may play a role in signal transfuction pathways.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Hordeum vulgare, Populus sp., Triticum aestivum
Expected Species:
Fragaria ananassa, Malus domestica, Nicotiana attenuata, Oryza sativa, Vicia faba Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide conserved in isoform 1,2,3,4,7,8,10,11,14,20,25,30,32 of Arabidopsis thaliana CDPK kinases
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Siddiqui et al. (2020). Melatonin and calcium function synergistically to promote the resilience through ROS metabolism under arsenic-induced stress. Journal of Hazardous MaterialsVolume 398, 5 November 2020, 122882Ciesla et al. (2016) A Role for Barley Calcium-Dependent Protein Kinase CPK2a in the Response to Drought. Front Plant Sci. 2016 Oct 25;7:1550.
CPX1 (Coproporphyrinogen-III oxidase 1) is a key enzyme of heme biosynthesis. It is catalyzing the oxidative decarboxylation of propionic acid side chains of rings A and B of coproporphyrinogen III.Alternative name: Protein LESION INITIATION 2, AtCPO-I, Coprogen oxidase, Coproporphyrinogenase
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
EDS1 (Enhanced disease susceptibility 1) is a protein with lipase activity involved in aerencyma formation, lipid metabolic process, response to hypoxia and systemic acquired resistance. Alternative names: Putative disease resistance protein EDS1, Putative uncharacterized protein T17F15.40.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Li et al. (2022) Plasma membrane-nucleo-cytoplasmic coordination of a receptor-like cytoplasmic kinase promotes EDS1-dependent plant immunity. Nat Plants. 2022 Jul;8(7):802-816. doi: 10.1038/s41477-022-01195-x. Epub 2022 Jul 18. PMID: 35851623.Chang et al. (2019). PBS3 Protects EDS1 from Proteasome-Mediated Degradation in Plant Immunity. Mol Plant. 2019 Feb 11. pii: S1674-2052(19)30055-3. doi: 10.1016/j.molp.2019.01.023.Chakraborty et al. (2018). Epigenetic and transcriptional control of chickpea WRKY40 promoter activity under Fusarium stress and its heterologous expression in Arabidopsis leads to enhanced resistance against bacterial pathogen. Plant Science, doi.org/10.1016/j.plantsci.2018.07.014
Special application note:
This product can be sold containing ProClin if requested
PP2A (Serine/threonine protein phosphatase 2A 59 kDa regulatory subunit B' gamma isoform) is required for the formation of the PP2A holoenzyme that negatively regulates brassinosteroid signaling by dephosphorylating and inactivating BRI1 in the cytoplasm and is involved in growth regulation and stress signaling. Alternative names: AtB' gamma, PP2A, B' subunit, gamma isoform
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Oryza sativa
Expected Species:
Brassica olereacea, Pisum sativum Species of your interest not listed? Contact us
LSD1 (Lesion simulating disease 1) is a negative regulator of reactive oxygen-induced cell death, cold stress-induced cell death, pathogen-induced hypersensitive response (HR), basal disease resistance. The protein is required for leaf acclimation in response to excess excitation energy.Alternative names: CHILLING SENSITIVE 4, CHS4.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica olereacea, Pisum sativum Species of your interest not listed? Contact us
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Chai et al. (2015). LSD1 and HY5 antagonistically regulate red light induced-programmed cell death in Arabidopsis. Front Plant Sci. 2015 May 5;6:292. doi: 10.3389/fpls.2015.00292. eCollection 2015.
AHB2 (Arabidopsis hemoglobin2) belongs to the plant globin family, and is a heme-, iron- and oxygen-binding protein. Expressed in rosette leaves and young roots, and induced by a variety of environmental stresses. Synonymes: AHB2, ARABIDOPSIS HEMOGLOBIN 2, ARATH GLB2, ATGLB2, GLB2, HAEMOGLOBIN 2, HB2, HEMOGLOBIN 2, NON-SYMBIOTIC HAEMOGLOBIN 2, NSHB2.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Beta vulgaris, Brassica napus, Gossypium hirsutum, Solanum lycopersicum, Solanum tuberosumSpecies of your interest not listed? Contact us
Glyphosate (N-(phosphonomethyl)glycine) is a herbicide of a broad action spectrum which is used to kill broadleaf weeds and grasses known to compete with commercial crops world-wide. Due to its physico-chemical properties glyphosate easily enters the aqueous environment where it is rapidly converted into its main metabolite AMPA (aminomethylphosphonic acid).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store Store at 4°Cup to one month or in aliquots at -20 °C for long time storage. Avoid repeated freezing and thawing. For long time storage in 4 C, please add sodium azide 0,02 %.
Host Animal:
Chicken
Immunogen:
BSA-conjugated Glyphosate (coupled via EDAC/NHS) , Target: Glyphosate, CAS no,: 1071-83-6 from SIGMA,
This antibody was used to prepare anti-glyphosate immunoaffinity column which showed to be very specific and retained glyphosate but not AMPA or glufosinate. Recover of glyphosate was ca. 100 %. The antibody is applicable for any type of (waste) water sample. The detection limit is 2,5 μg/l, while the end concentration is 100 μg/l. The standard curve runs from 5 – 100 μg/l. For an optimal ELISA result it is crucial to use Greiner high affinity plates; As assay buffer 0,1M PBS, 1% BSA heat-treated, pH 7,4 is recommended.
Application Details:
1 : 2000 (ELISA)
Purity:
Total IgY. Purified by PEG precipitation.
Selected references:
Vestri et al. (2021) LSPR immuno-sensing based on iso-Y nanopillars for highly sensitive and specific imidacloprid detection. J Mater Chem B. 2021 Nov 17;9(44):9153-9161. doi: 10.1039/d1tb01344k. PMID: 34694310.Viirlaid et al. (2019). Immunoassay for rapid on-site detection of glyphosate herbicide. Environ Monit Assess. 2019 Jul 24;191(8):507. doi: 10.1007/s10661-019-7657-z.
Special application note:
Antibody is provided in 0,01M PBS, pH 7,2. Composition of PBS: 8 mM Na2HPO4; 2 mM KH2PO4, 137 mM NaCl; 2,68 mM KCl.For coating OVA-glyphosate or KLH-glyphosate can be used.
Atrazine is a herbicide against pre- and post-emergence broadleaf and grassy weeds. It is a very persistent compound and it has been banned in the EU since 2004. Its main toxic effect is as endocrine diruptor.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 2-8°Cup to one month or in aliquots at -20 °C for long time storage. Avoid repeated freezing and thawing.
Host Animal:
Sheep
Immunogen:
BSA-conjugated atrazine, Target: Atrazine, CAS no.: 1912-24-9 purchased from SIGMA
The specificity of the antibody was determined by measuring the cross-reactivity with a range of compounds in ELISA.Cross Reactivity%Atrazine100%Propazine150%Simazine4%Ametryn2500%Prometryn1700%Simetryn280%Terbutylazine2%Atrazine-desethyl7%Atrazine desisopropyl1%Atrazine-2-hydroxy1%Cinosulfuron<0.1%Prosulferon<0.1%Triasulfuron<0.1%Chlorpyrifos<0.1%Clofibrinezuur<0.1%Deltametrin<0.1%Diclofenac1%Etrimfos1%Erythromycine<0.1%Fenitrothion<0.1%Fenofibraat<0.1%Atrazine21%Ibuprofen<0.1%Malathion<0.1%Maleaminezuur<0.1%Metoprolol<0.1%Metacrifos<0.1%4-n-Nonylfenol2%Permetrin<0.1%Pirimifos-ethyl<0.1%Sulfadimidine<0.1%Vinclozolin<0.1%
Acrylamide is a starting material for the production of polyacrylamide, that in turn is used as a filler and in the treatment of waste water, gel electrophoresis, paper production. Acrylamide is produced during heating of foods and it is found in coffee and other food products. The compound is neurotoxic and possesses endocrine disrupting properties.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cup to one month or in aliquots at -20 °C for long time storage. Avoid repeated freezing and thawing.
Total chicken immunoglobulin antibody fraction (IgY) is present in phosphate buffered saline, pH 7.2, 0.02% sodium azide as preservative.The antibody may be used in immunoaffinity chromatography for the isolation, purification and concentration of acrylamide from food samples for further analysis.
FBP aldolase (FBP) is an enzyme (EC=4.1.2.13) which is catalyzing the aldol condensation of of dihydroxyacetone phosphate (DHAP or glycerone-phosphate) with glyceraldehyde 3-phosphate (G3P) to form fructose 1,6-bisphosphate (FBP) in gluconeogenesis and the reverse reaction in glycolysis. It belongs to class II fructose-bisphosphate aldolase family. Alternative names: FBPA, fructose-1,6-bisphosphate aldolase, fructose-bisphosphate aldolase class II.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Synechocystis PCC6803
Expected Species:
Cyanobacteria Species of your interest not listed? Contact us
Immunogen:
Recombinant FBA from Synechocystis sp. PCC6803, UniProt: Q55664, Cyanobase: sll0018
CBP (CREB-binding protein homolog) is a transcriptional coactivator in multiple signal transduction pathways. It might play a role in variety of cellular processes, including differentiation, cellular proliferation, immune response, homeostasis, tumorigenesis, and erganogenesis.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Drosophila melanogaster
Expected Species:
Drosophila melanogaster
Immunogen:
Recombinant CBP part, fused to GST, derived from Drosophila melanogaster protein sequence, UniProt: O01368
RAF2 (Rubisco accumulation factor 2) is a member if PCD family and a chloroplastsic protein which cotains pterin carbinolamine dehydratase domain. Protein is involved in tetrahydrobiopterin biosynthetic process. Alternative names: AT5g51110/MWD22_5, PCD/DCoH-like protein 1, Transcriptional coactivator/pterin dehydrataseImported.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Arabidopsis alpina, Brassica napus, Capsella rubella, Glycine soja, Gpssypium aroboretum, Medicago trunculata, Morus notabilis, Ricinus communis, Theobroma cacao, Vitis vinifera Species of your interest not listed? Contact us
Immunogen:
Recombinant, RAF2 protein choisen from Arabidopsis thaliana protein sequence, UniProt:Q9LU63, TAIR: AT5G51110
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Fristedt et al. (2018). RAF2 is a RuBisCO assembly factor in Arabidopsis thaliana. Plant J. 2018 Apr;94(1):146-156. doi: 10.1111/tpj.13849.Aigner et al. (2017). Plant RuBisCo assembly in E. coli with five chloroplast chaperones including BSD2. Science. 2017 Dec 8;358(6368):1272-1278. doi: 10.1126/science.aap9221.
SVR4-like (Supressor of variegation 4-like) is a homolog of SVR4. It is a nuclear-encoded chloroplast-located protein required for proper function of the plastid transcriptional machinery. Synonymes: MRL7-like, MESOPHYLL-CELL RNAI LIBRARY LINE 7-LIKE, MRL7-L.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Horderum vulgare
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from Arabidopsis thaliana SVR4-like protein sequence, UniProt: Q84RF5, TAIR: At2g31840
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Powikrowska et al. (2013). SVR4 of variegation 4 and SVR4-like two proteins with a role in proper organization of the chloroplast genetic machinery. Physiol Plant. Sep 23. doi: 10.1111/ppl.12108.
Special application note:
This protein is present in very low amounts only in early stages of plant development and this has to be taken into account when harvesting the tissue. Western blots were done on: Arabidopsis thaliana total protein extract from cotyledons and Hordeum vulgare (2-14 days old plants).
SVR4 (Supressor of variegation 4) is a nuclear-encoded chloroplast-located protein required for proper function of the plastid transcriptional machinery. Synonymes: ATECB1, EARLY CHLOROPLAST BIOGENESIS 1, ECB1, MESOPHYLL-CELL RNAI LIBRARY LINE 7, MRL7.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Loudya et al. (2021) Cellular and transcriptomic analyses reveal two-staged chloroplast biogenesis underpinning photosynthesis build-up in the wheat leaf. Genome Biol. 2021 May 11;22(1):151. doi: 10.1186/s13059-021-02366-3. PMID: 33975629; PMCID: PMC8111775.Powikrowska et al. (2013). SVR4 of variegation 4 and SVR4-like two proteins with a role in proper organization of the chloroplast genetic machinery. Physiol Plant. Sep 23. doi: 10.1111/ppl.12108.
Special application note:
This protein is present in very low amounts only in early stages of plant development and this has to be taken into account when harvesting the tissue. Western blots were done on: Arabidopsis thaliana total protein extract from cotyledons and Hordeum vulgare (2-14 days old plants).
Alpha-synuclein is normally an unstructured soluble protein that can aggregate to form insoluble fibrils in pathological conditions characterized by Lewy bodies, such as Parkinson's disease, dementia with Lewy-bodies, and multiple system atrophy. In analogy to many other amyloid associated disorders, alpha-synuclein may also form oligomeric assemblies. These small and soluble forms have been suggested to exert a stronger tissue damaging effect as compared to the monomeric and fibrillar counterpart. Using a recently developed technique a monoclonal oligomer-specific antibody has been designed.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
For short time storage add sodium azide and store at +4°C. For long time storage store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Human
Immunogen:
synthetic peptide derived from human alpha-synuclein N-terminal Met1-Val15
Alpha-synuclein is normally an unstructured soluble protein that can aggregate to form insoluble fibrils in pathological conditions characterized by Lewy bodies, such as Parkinson's disease, dementia with Lewy-bodies, and multiple system atrophy.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
For short time storage add sodium azide and store at +4°C. For long time storage store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Human
Expected Species:
Mouse
Immunogen:
synthetic peptide derived from human alpha-synuclein N-terminal Met1-Val15
Applications:
Dot blot (Dot), ELISA (ELISA), Immunohistochemistry (IHC)
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Tanudjojo et al. (2021) Phenotypic manifestation of ?-synuclein strains derived from Parkinson's disease and multiple system atrophy in human dopaminergic neurons. Nat Commun. 2021 Jun 21;12(1):3817. doi: 10.1038/s41467-021-23682-z. PMID: 34155194; PMCID: PMC8217249.
Special application note:
This antibody will recognize human SNCA monomers and multimers in Western blot. This antibody binds weakly to fibrills in IHC.Cross reactivity of this antibody to synuclein beta was not determined.This antibody can be used as a capture antibody in ELISA, combined with AS08 358 as a detection antibody.
Alpha-synuclein is normally an unstructured soluble protein that can aggregate to form insoluble fibrils in pathological conditions characterized by Lewy bodies, such as Parkinson's disease, dementia with Lewy-bodies, and multiple system atrophy. In analogy to many other amyloid associated disorders, alpha-synuclein may also form oligomeric assemblies. These small and soluble forms have been suggested to exert a stronger tissue damaging effect as compared to the monomeric and fibrillar counterpart. Using a recently developed technique a monoclonal oligomer-specific antibody has been designed.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Human
Immunogen:
Synthetic peptide derived from human alpha-synuclein Gly111-Tyr125
Alpha-synuclein is normally an unstructured soluble protein that can aggregate to form insoluble fibrils in pathological conditions characterized by Lewy bodies, such as Parkinson's disease, dementia with Lewy-bodies, and multiple system atrophy. In analogy to many other amyloid associated disorders, alpha-synuclein may also form oligomeric assemblies. These small and soluble forms have been suggested to exert a stronger tissue damaging effect as compared to the monomeric and fibrillar counterpart. Using a recently developed technique a monoclonal oligomer-specific antibody has been designed.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
For short time storage add sodium azide and store at +4°C. For long time storage store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Human, mouse
Immunogen:
Synthetic peptide derived from human alpha-synuclein Gly111-Tyr125
Applications:
Dot blot (Dot), ELISA (ELISA), Immunohistochemistry (IHC)
Limegrover et al. (2021) Sigma-2 receptor antagonists rescue neuronal dysfunction induced by Parkinson's patient brain-derived a-synuclein. J Neurosci Res. 2021 Apr;99(4):1161-1176. doi: 10.1002/jnr.24782. Epub 2021 Jan 22. PMID: 33480104.Kilpel inen et al. (2019). Behavioural and dopaminergic changes in double mutated human A30P*A53T alpha-synuclein transgenic mouse model of Parkinson s disease.Sci Rep. 2019 Nov 22;9(1):17382. doi: 10.1038/s41598-019-54034-z.Wu et al. (2017). The critical role of Nramp1 in degrading a-synuclein oligomers in microglia under iron overload condition. Neurobiol Dis. 2017 Aug;104:61-72. doi: 10.1016/j.nbd.2017.05.001. (human, mouse, immunolocalization)Svarcbahs et al. (2016). Inhibition of Prolyl Oligopeptidase Restores Spontaneous Motor Behavior in the a-Synuclein Virus Vector-Based Parkinson's Disease Mouse Model by Decreasing a-Synuclein Oligomeric Species in Mouse Brain. J Neurosci. 2016 Dec 7;36(49):12485-12497.Br nnstr m et al. (2014). A Generic Method for Design of Oligomer-Specific Antibodies. PLoS ONE. DOI: 10.1371/journal.pone.0090857.
Special application note:
This antibody is specific to oligomers in ELISA as a capture antibody. For specific details, please check: Br nnstr m et al. (2014). A Generic Method for Design of Oligomer-Specific Antibodies. PLoS ONE. DOI: 10.1371/journal.pone.0090857.
Alpha-synuclein is normally an unstructured soluble protein that can aggregate to form insoluble fibrils in pathological conditions characterized by Lewy bodies, such as Parkinson's disease, dementia with Lewy-bodies, and multiple system atrophy. In analogy to many other amyloid associated disorders, alpha-synuclein may also form oligomeric assemblies. These small and soluble forms have been suggested to exert a stronger tissue damaging effect as compared to the monomeric and fibrillar counterpart. Using a recently developed technique a monoclonal oligomer-specific antibody has been designed.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
For short time storage add sodium azide and store at +4°C. For long time storage store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Human
Immunogen:
Synthetic peptide derived from human alpha-synuclein Glu131-Ala140
Alpha-synuclein is normally an unstructured soluble protein that can aggregate to form insoluble fibrils in pathological conditions characterized by Lewy bodies, such as Parkinson's disease, dementia with Lewy-bodies, and multiple system atrophy. In analogy to many other amyloid associated disorders, alpha-synuclein may also form oligomeric assemblies. These small and soluble forms have been suggested to exert a stronger tissue damaging effect as compared to the monomeric and fibrillar counterpart. Using a recently developed technique a monoclonal oligomer-specific antibody has been designed.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
For short time storage please add sodium azide and srote at +4°C.For long time storage store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Human
Expected Species:
Mouse
Immunogen:
synthetic peptide derived from human alpha-synuclein Glu131-Ala140
Applications:
Dot blot (Dot), ELISA (ELISA), Immunolocalization (IL)
Alzheimer's disease (AD) is the most prevalent neurodegenerative disease in the growing population of elderly people. A hallmark of AD is the accumulation of plaques in the brain of AD patients. The plaques predominantly consist of aggregates of amyloid-beta (Abeta), a peptide of 39-42 amino acids generated in vivo by specific, proteolytic cleavage of the amyloid precursor protein. Recent findings however suggest that smaller oligomeric forms of Abeta, formed in parallel to the amyloid plaques, excert the predominant tissue damaging effect.Specific identification of the oligomeric forms is as a consequence of great interest. Based on a recently published technique a highly oligomer-specific antibody (mAB-M), targeting Abeta oligomers while omitting reactivity towards the monomeric and fibrillar counterpart, has been developed.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
For short time storage please add sodium azide and srote at +4°C.For long time storage store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Human
Immunogen:
synthetic peptide chosen from human Abeta protein (3-10) pregion, oligomer specific
Applications:
Dot blot (Dot), ELISA (ELISA), Immunolocalization (IL)
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Meilandt et al. (2019). Characterization of the selective in vitro and in vivo binding properties of crenezumab to oligomeric A ?². Alzheimers Res Ther. 2019 Dec 1;11(1):97. doi: 10.1186/s13195-019-0553-5.Br nnstr m et al. (2014). A Generic Method for Design of Oligomer-Specific Antibodies. PLoS ONE. DOI: 10.1371/journal.pone.0090857.
Special application note:
Immunolocalization: human tissue was paraffin-embedded and sectioned. De-waxed and rehydrated in an ethanol gradient. Antigens were retrieved in sodium citrate buffer (pH 6) at 95 C for 1 h. The tissue sections were separately incubated for 1 h at RT with primary antibody and antibody binding was visualized with IgG Preoxidase Reagent Kit.This antibody is specific for human Amyloid-Beta oligomers.
Alzheimer's disease (AD) is the most prevalent neurodegenerative disease in the growing population of elderly people. A hallmark of AD is the accumulation of plaques in the brain of AD patients. The plaques predominantly consist of aggregates of amyloid-beta (Abeta), a peptide of 39-42 amino acids generated in vivo by specific, proteolytic cleavage of the amyloid precursor protein. Recent findings however suggest that smaller oligomeric forms of Abeta, formed in parallel to the amyloid plaques, excert the predominant tissue damaging effect.Specific identification of the oligomeric forms is as a consequence of great interest. Based on a recently published technique a highly oligomer-specific antibody (mAB-O), targeting Abeta oligomers while omitting reactivity towards the monomeric and fibrillar counterpart, has been developed.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Human
Expected Species:
Mouse, Bovine, Chicken, Dog, Porcine, Rabbit
Immunogen:
Synthetic peptide chosen from human Abeta (1-42) protein,
Applications:
Dot blot (Dot), ELISA (ELISA), Immunolocalization (IL)
Immunolocalization: human tissue was paraffin-embedded and sectioned. De-waxed and rehydrated in an ethanol gradient. Antigens were retrieved in sodium citrate buffer (pH 6) at 95 C for 1 h. The tissue sections were separately incubated for 1 h at RT with primary antibody and antibody binding was visualized with IgG Preoxidase Reagent Kit.This Monoclonal IgG1, kappa light chain, (clone number 3E5.F8) is specific for human Amyloid-Beta oligomers.
RH3 (RNA helicase) is involved in RNA synthesis, modification, cleavage and degradation. RH3 is the most abundant plastid DEAD box RNA helicase in maize and Arabidopsis thaliana.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Zea mays
Expected Species:
Panicum italicum, Oryza brachyantha, Oryza sativa Species of your interest not listed? Contact us
Immunogen:
recombinant RH3 from Zea mays, amino acids 531-691, conserved in Zea mays RH3A (GRMZM2G415491_P01) and RH3B (GRMZM2G163072_P01) and Arabidopsis thaliana At5g26742
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Bach-Pages et al. (2020). Discovering the RNA-Binding Proteome of Plant Leaves With an Improved RNA Interactome Capture Method. Biomolecules. 2020 Apr 24;10(4):E661. doi: 10.3390/biom10040661.Asakura et al. (2012). Chloroplast RH3 DEAD box RNA helicases in maize and Arabidopsis function in splicing of specific group II introns and affect chloroplast ribosome biogenesis. Plant Physiol. 2012 Jul;159(3):961-74. doi: 10.1104/pp.112.197525. Epub 2012 May 10.
NDH (NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic) is involved in the transfer of electrons from NAD(P)H:plastoquinone, via FMN and iron-sulfur centers, to quinones in the photosynthetic chain and possibly in a chloroplast respiratory chain. Alternative names: NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic, NADH-plastoquinone oxidoreductase subunit 5.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
The antibody may be stored at -20 °C for one year in its original formulation. Additionally, antibody may be stored at 2°Cto 8°Cfor up to 1 month without detectable loss of activity. Avoid repeated freeze-thaw cycles of the diluted antibody.
Host Animal:
Rabbit
Species Reactivity:
Oryza sativa
Immunogen:
KLH-conjugated synthetic peptide derived from Oryza sativa OsChl78 UniProt: P0C328
IPP isomerase (EC=5.3.3.2) is an enzyme which is catalyzing the reversible isomerization of IPP to produce dimethylallyl pyrophosphate, the initial substrate in the biosynthesis of carotenoids and many other long-chain isoprenoids.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Sun et al. (1998). Differential expression of two isopentenyl pyrophosphate isomerases and enhanced carotenoid accumulation in a unicellular chlorophyte. PNAS, Vol. 95, pp. 11482–11488, September 1998.
Lycopene cyclase (EC=5.5.1.19) is an enzyme involved in carotenoid biosynthesis, which catalyzes the double cyclization reaction which converts lycopene to beta-carotene and neurosporene to beta-zeacarotene. Synonymes:
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Tang el al. (2020). OsNSUN2-Mediated 5-Methylcytosine mRNA Modification Enhances Rice Adaptation to High Temperature. Dev Cell. 2020 May 4;53(3):272-286.e7. doi: 10.1016/j.devcel.2020.03.009.Sun et al. (1998). Differential expression of two isopentenyl pyrophosphate isomerases and enhanced carotenoid accumulation in a unicellular chlorophyte. PNAS, Vol. 95, pp. 11482–11488, September 1998.
Sec8 is a member of the exocyst complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. Involved in secretory process during cell plate initiation during cytokinesis. Participates in polarized pectn delivery.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
The major light-harvesting antenna complex II (LHCII) in photosynthetic eukaryotes is located in the thylakoid membrane of the chloroplast. It is a heterotrimeric complex formed by up to 3 different individual subtypes of chlorophyll a/b-binding proteins: Lhcb1, Lhcb2, and Lhcb3. Lhcb2 is often coded by several nuclear genes and is found together with Lhcb1 within the mobile LHCII trimers involved in state1-state2 transition.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Wu et al. (2021). Formation of light-harvesting complex (LHC) II aggregates from LHCII-PSI-LHCI complexes in rice plants under high light. J Exp Bot. 2021 May 3:erab188. doi: 10.1093/jxb/erab188. Epub ahead of print. PMID: 33939808.Mazur et al. (2021) The SnRK2.10 kinase mitigates the adverse effects of salinity by protecting photosynthetic machinery. Plant Physiol. 2021 Dec 4;187(4):2785-2802. doi: 10.1093/plphys/kiab438. PMID: 34632500; PMCID: PMC8644180.Bychkov et al. (2019). Melatonin modifies the expression of the genes for nuclear- and plastid-encoded chloroplast proteins in detached Arabidopsis leaves exposed to photooxidative stress. Plant Physiology and Biochemistry, doi.org/10.1016/j.plaphy.2019.10.013.Vietoshkina et al. (2019). Comparison of State Transitions of the Photosynthetic Antennae in Arabidopsis and Barley Plants upon Illumination with Light of Various Intensity. Biochemistry (Moscow), Vol 84, Issue 9, pp 1065–1073Rudenko et al. (2019). The role of carbonic anhydrase ?-CA4 in the adaptive reactions of photosynthetic apparatus: the study with ?-CA4 knockout plants. Protoplasma (2019). https://doi.org/10.1007/s00709-019-01456-1
The major light-harvesting antenna complex II (LHCII) in photosynthetic eukaryotes is located in the thylakoid membrane of the chloroplast. It is a heterotrimeric complex formed by up to 3 different individual subtypes of chlorophyll a/b-binding proteins: Lhcb1, Lhcb2, and Lhcb3. Lhcb1 is the most abundant chlorophyll a/b-binding protein in eukaryotic phototrophs and often is coded by several nuclear genes.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Nilsson et al. (2020). PSB33 protein sustains Photosystem II in plant chloroplasts under UVA light. J Exp Bot. 2020 Sep 15;eraa427.doi: 10.1093/jxb/eraa427.Rudenko et al. (2019). The role of carbonic anhydrase a-CA4 in the adaptive reactions of photosynthetic apparatus: the study with a-CA4 knockout plants. Protoplasma (2019). https://doi.org/10.1007/s00709-019-01456-1Rantala and Tikkanen et al. (2018). Phosphorylation-induced lateral rearrangements of thylakoid protein complexes upon light acclimation. Plant Direct Vol. 2, Issue 2.Rantala et al. (2017). Proteomic characterization of hierarchical megacomplex formation in Arabidopsis thylakoid membrane. Plant J. 2017 Dec;92(5):951-962. doi: 10.1111/tpj.13732.Fristedt et al. (2017). PSB33 sustains photosystem II D1 protein under fluctuating light conditions. Journal of Experimental Botany doi:10.1093/jxb/erx218.
Sec6 is a member of the exocyst complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Carica papaya, Medicago truncatula, Ricinus communis Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from Arabidopsis thaliana Sec6, UniProt F4IA34, TAIR AT1G71820
MT2a (Metallothionein 2a) is a cysteine-rich, low molecular mass protein with a metal ion binding function. Metallothionenins (MTs) are involved in many physiological processes such as metal ion homeostasis, detoxification of excess metals and protection against oxidative stress.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
MT1a (Metallothionein type1) is a cysteine-rich, low molecular mass protein with a metal ion binding function. Metallothionenins (MTs) are involved in many physiological processes such as metal ion homeostasis, detoxification of excess metals and protection against oxidative stress.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
CGLD27 (CONSERVED IN THE GREEN LINEAGE AND DIATOMS 27) is required for growth in low iron conditions. Localized in chloroplasts. Mostly expressed in seeds, leaves and flowers and at a lower extent in roots.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana (recombinant CGLD27)
Expected Species:
Chlamydomonas reinhardtiSpecies of your interest not listed? Contact us
Immunogen:
thioredoxin fusion of CGLD27 of Arabidopsis thaliana, UniProt Q9FN15-1 TAIR At5g67370
AGO2 belongs to a group of argonaute proteins which are catalytic component of the RNA-incudes silencing complex (RISC). This protein complex is responsible for the gene silencing (RNAi). AGO2 is probably involved in antiviral RNA silencing.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Capsella rubella, Solanum tuberosumSpecies of your interest not listed? Contact us
AGO2 protein is strongly induced by stress. AGO expression may be tissue specific and using floral tissue is recommended where most of the AGOs are expressed the highest. Use of proteasome inhibitors as MG132 can help to stabilize AGO proteins during extraction procedure. Antibody incubation should be done over night in 4 C. Use of material with enriched AGO2 levels is recommened.
Clavel et al. (2021) Atypical molecular features of RNA silencing against the phloem-restricted polerovirus TuYV. Nucleic Acids Res. 2021 Nov 8;49(19):11274-11293. doi: 10.1093/nar/gkab802. PMID: 34614168; PMCID: PMC8565345.Oliver & Martinez. (2021) Accumulation dynamics of ARGONAUTE proteins during meiosis in Arabidopsis. Plant Reprod. 2021 Nov 23. doi: 10.1007/s00497-021-00434-z. Epub ahead of print. PMID: 34812935.Wang et al. (2019). The PROTEIN PHOSPHATASE4 Complex Promotes Transcription and Processing of Primary microRNAs in Arabidopsis. Plant Cell. 2019 Feb;31(2):486-501. doi: 10.1105/tpc.18.00556.Dalmadi et al. (2019). AGO-unbound cytosolic pool of mature miRNAs in plant cells reveals a novel regulatory step at AGO1 loading. Nucleic Acids Res. 2019 Aug 8. pii: gkz690. doi: 10.1093/nar/gkz690.You et al. (2019). FIERY1 promotes microRNA accumulation by suppressing rRNA-derived small interfering RNAs in Arabidopsis. Nat Commun. 2019 Sep 27;10(1):4424. doi: 10.1038/s41467-019-12379-z. (immunoprecipiation)
ARC5 (Dynamin-like protein ARC5) is a probable GTPase component of both plastid and peroxisme division machinery. Required for the last steps of plastid division specifically in mesophyll-cell, when the narrow isthmus breaks, facilitating the separation of the daughter plastids. Necessary for peroxisome activities. Seems to influence stromule (stroma-filled tubular extensions of the plastid envelope membrane) length and frequency. Alternative names: Dynamin-related protein 5B Protein ACCUMULATION AND REPLICATION OF CHLOROPLASTS 5.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Shelf life upon re-constitution is 6 months. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube. Store reconstituted antibodies at 4°Cor in -20 for extrended periods of time. Lyophilized powder is stable for a minimum of 2 years at -20 °C.
Host Animal:
Rabbit
Expected Species:
Arabidopsis thaliana
Immunogen:
KLH-conjugated synthetic peptide derived from internal domain of Dynamin-like protein ARC5 from Arabidopsis thaliana Uniprot: Q84N64,TAIR: AT3G19720
Antibody format is a total IgG (purified on Protein A)
Application Details:
1 : 500-1 : 5 000 (WB)
Purity:
Total IgG in Tris 0,1M, glycine 0,1M, sucrose 2%.
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
87 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Pipitone et al. (2021). A multifaceted analysis reveals two distinct phases of chloroplast biogenesis during de-etiolation in Arabidopsis. Elife. 2021 Feb 25;10:e62709. doi: 10.7554/eLife.62709. PMID: 33629953; PMCID: PMC7906606.
40S ribosomal protein S14-1 is localized in cytoplasm and belongs to ribosomal protein S11P family.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
20 g of total protein is needed for detection of S14 in Arabidopsis thaliana
Application Details:
1 : 1000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
16 | 15 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Pereira Firmino et al. (2020). Separation and Paired Proteome Profiling of Plant Chloroplast and Cytoplasmic Ribosomes. Plants (Basel) . 2020 Jul 14;9(7):892.doi: 10.3390/plants9070892. Ma et al. (2020). An ortholog of the Vasa intronic gene is required for small RNA-mediated translation repression in Chlamydomonas reinhardtii. Proc Natl Acad Sci U S A. 2020 Jan 7;117(1):761-770. doi: 10.1073/pnas.1908356117.Shinozaki et al. (2020). Autophagy Increases Zinc Bioavailability to Avoid Light-Mediated ROS Production under Zn Deficiency. Plant Physiol. 2020 Jan 15. pii: pp.01522.2019. doi: 10.1104/pp.19.01522.Wegener et al. (2019). Magnetic Tracking of Protein Synthesis in Microfluidic Environments-Challenges and Perspectives. Nanomaterials (Basel). 2019 Apr 9;9(4). pii: E585. doi: 10.3390/nano9040585.Liu et al. (2018). Transcriptomics analyses reveal the molecular roadmap and long noncoding RNA landscape of sperm cell lineage development. Plant J. 2018 Jul 26. doi: 10.1111/tpj.14041.
Plasma membrane aquaporin, PIP2;7 is water channel protein required for water transport across cell membrane. Alternative names: plasma membrane intrinsic protein 2-7, AtPIP2;7, plasma membrane intrinsic protein 3, salt stress-induced major intrinsic protein, PIP3a
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Detection pattern consists of di and monomer of PIP2-7.This antibody has a potential to work in immunolocalization studies, as it is recognizing C-terminal part of the sequence.This product can be sold containing ProClin if requested.
Application Details:
1 : 600 (IP), 1: 3000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
30.7 | 30 kDa (Zea mays)
Not reactive in:
Hordeum vulgare
Selected references:
Kumar et al. (2022). Proteomic dissection of rice cytoskeleton reveals the dominance of microtubule and microfilament proteins, and novel components in the cytoskeleton-bound polysome, Plant Physiology and Biochemistry, Volume 170,2022,Pages 75-86,ISSN 0981-9428, https://doi.org/10.1016/j.plaphy.2021.11.037.
SRP43 (Signal recognition peptide 43) is a part of the chloroplast signal recognition particle pathway, required for post-translational targeting of proteins into the thylakoid membrane but seems to be dispensable for co-translational targeting with a translating ribosome present. The protein acts as a highly specific chaperone for LHCPs, preventing aggregation and being able to dissolve aggregates. Alternative names: Chloroplast signal recognition peptide 43, CPSRP43, CAO, CHAOS
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
LSD1 (Lesion simulating disease 1) monitors a superoxide-dependent signal and negatively regulates a plant cell death pathway. contains zinc-finger motifs. LSD1 negatively regulates a basal defense pathway that can act upstream or independently of both NIM1/NPR1 function and SA accumulation. Alternative names: CHILLING SENSITIVE 4, CHS4.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4 C; make aliquots to avoid working with a stock. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica olereacea, Pisum sativum Species of your interest not listed? Contact us
DCL3 (EC=3.1.26) is a ribonuclease (RNase) III involved in RNA-mediated post-transcriptional gene silencing (PTGS). Functions in the microRNAs (miRNAs) biogenesis pathway by cleaving primary miRNAs (pri-miRNAs) and precursor miRNAs (pre-miRNAs). Synonymes: Endoribonuclease Dicer homolog 3.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Donkey anti-Sheep IgG (H&L) , DyLight 594 Conjugated, min. cross-reactivity to human,mouse, or rabbit IgG is a secondary antibody conjugated to DyLight 594, which binds to all sheep IgG (H&L) in immunological assays. DyLight 550 has Amax = 593 nm, Emax = 618 nm. Antibodies are are affinity purified using solid phase sheep IgG.DyLight is a registered trade mark of Thermofisher Inc., and its subsidaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized material at 2-8°C. Product is stable for 4 weeks at 2-8°Cafter rehydration. For long time storage after reconstitution, dilute the antibody solution with glycerol to a final concentration of 50% glycerol and store as liquid at -20 °C, to prevent loss of enzymatic activity. For example, if you have reconstituted 1 mg of antibody in 1,1 ml of sterile water add 1,1 ml of glycerol. Such solution will not freeze in -20 °C, If you are using a 1:5000 dilution prior to diluting with glycerol, then you would need to use a 1:2500 dilution after adding glycerol. Prepare working dilution prior to use and then discard. Be sure to mix well but without foaming.
Based on immunoelectrophoresis, this antibody reacts with: heavy (γ) chains on sheep IgG light chains on all sheep immunoglobulins.No reactivity is observed to: non-immunoglobulin sheep serum proteins IgG from human, mouse or rabbit.BSA and milk have to be replaced by other blocking reagents, like doneky serum or commercial formulations which are free from bovine IgG.
Application Details:
1 : 20-1 : 2000 for most applications
Purity:
Immunogen affinity purified donkey IgG.
Reconstitution:
For reconstitution add 1,1 ml of sterile water, Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Conjugate is present in 10 mM Sodium Phosphate, 0,15 M Sodium Chloride, pH 7,2, 1 % (w/v) BSA, Protease/IgG free, 0,05 % (w/v) sodium azide is added as preservative
Donkey anti-Sheep IgG (H&L) , DyLight 594 Conjugated, min. cross-reactivity to human or rabbit IgG is a secondary antibody conjugated to DyLight 594, which binds to all sheep IgG (H&L) in immunological assays. DyLight 550 has Amax = 593 nm, Emax = 618 nm. Antibodies are are affinity purified using solid phase sheep IgG.DyLight is a registered trade mark of Thermofisher Inc., and its subsidaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized material at 2-8°C. Product is stable for 4 weeks at 2-8°Cafter rehydration. For long time storage after reconstitution, dilute the antibody solution with glycerol to a final concentration of 50% glycerol and store as liquid at -20 °C, to prevent loss of enzymatic activity. For example, if you have reconstituted 1 mg of antibody in 1,1 ml of sterile water add 1,1 ml of glycerol. Such solution will not freeze in -20 °C, If you are using a 1:5000 dilution prior to diluting with glycerol, then you would need to use a 1:2500 dilution after adding glycerol. Prepare working dilution prior to use and then discard. Be sure to mix well but without foaming.
Based on immunoelectrophoresis, this antibody reacts with: heavy (γ) chains on sheep IgG light chains on all sheep immunoglobulins.No reactivity is observed to: non-immunoglobulin sheep serum proteins IgG from human or rabbit.BSA and milk have to be replaced by other blocking reagents, like doneky serum or commercial formulations which are free from bovine IgG.
Application Details:
1 : 20-1 : 2000 for most applications
Purity:
Immunogen affinity purified donkey IgG.
Reconstitution:
For reconstitution add 1,1 ml of sterile water, Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Conjugate is present in 10 mM Sodium Phosphate, 0,15 M Sodium Chloride, pH 7,2, 1 % (w/v) BSA, Protease/IgG free, 0,05 % (w/v) sodium azide is added as preservative
Donkey anti-Sheep IgG (H&L) , DyLight 594 Conjugate is a secondary antibody conjugated to DyLight 594, which binds to all sheep IgG (H&L) in immunological assays. DyLight 550 has Amax = 593 nm, Emax = 618 nm. Antibodies are are affinity purified using solid phase sheep IgG.DyLight is a registered trade mark of Thermofisher Inc., and its subsidaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized material at 2-8°C. Product is stable for 4 weeks at 2-8°Cafter rehydration. For long time storage after reconstitution, dilute the antibody solution with glycerol to a final concentration of 50% glycerol and store as liquid at -20 °C, to prevent loss of enzymatic activity. For example, if you have reconstituted 1 mg of antibody in 1,1 ml of sterile water add 1,1 ml of glycerol. Such solution will not freeze in -20 °C, If you are using a 1:5000 dilution prior to diluting with glycerol, then you would need to use a 1:2500 dilution after adding glycerol. Prepare working dilution prior to use and then discard. Be sure to mix well but without foaming.
Based on immunoelectrophoresis, this antibody reacts with: heavy (γ) chains on sheep IgG light chains on all sheep immunoglobulins.No reactivity is observed to: non-immunoglobulin sheep serum proteins.BSA and milk have to be replaced by other blocking reagents, like doneky serum or commercial formulations which are free from bovine IgG.
Application Details:
1 : 20-1 : 2000 for most applications
Purity:
Immunogen affinity purified donkey IgG.
Reconstitution:
For reconstitution add 1,1 ml of sterile water, Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Conjugate is present in 10 mM Sodium Phosphate, 0,15 M Sodium Chloride, pH 7,2, 1 % (w/v) BSA, Protease/IgG free, 0,05 % (w/v) sodium azide is added as preservative
Goat anti-Rat IgG (H&L) , DyLight 594 Conjugate is a secondary antibody conjugated to DyLight 594, which binds to all rat IgG (H&L) in immunological assays. DyLight 550 has Amax = 593 nm, Emax = 618 nm. Antibodies are are affinity purified using solid phase rat IgG.DyLight is a registered trade mark of Thermofisher Inc., and its subsidaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized material at 2-8°C. Product is stable for 4 weeks at 2-8°Cafter rehydration. For long time storage after reconstitution, dilute the antibody solution with glycerol to a final concentration of 50% glycerol and store as liquid at -20 °C, to prevent loss of enzymatic activity. For example, if you have reconstituted 1 mg of antibody in 1,1 ml of sterile water add 1,1 ml of glycerol. Such solution will not freeze in -20 °C, If you are using a 1:5000 dilution prior to diluting with glycerol, then you would need to use a 1:2500 dilution after adding glycerol. Prepare working dilution prior to use and then discard. Be sure to mix well but without foaming.
Based on immunoelectrophoresis, this antibody reacts with: heavy (γ) chains on rat IgG light chains on all rat immunoglobulins.No reactivity is observed to: non-immunoglobulin rat serum proteins.
Application Details:
1 : 20-1 : 2000 for most applications
Purity:
Immunogen affinity purified goat IgG.
Reconstitution:
For reconstitution add 1,1 ml of sterile water, Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Conjugate is present in 10 mM Sodium Phosphate, 0,15 M Sodium Chloride, pH 7,2, 1 % (w/v) BSA, Protease/IgG free, 0,05 % (w/v) sodium azide is added as preservative
Donkey anti-Rat IgG (H&L) , DyLight 594 Conjugated, min. cross-reactivity to bovine, chicken, goat, guinea pig, hamster, horse, human,mouse, rabbit or sheep IgG is a secondary antibody conjugated to DyLight 594, which binds to rat IgG (H&L) in immunological assays. DyLight 550 has Amax = 593 nm, Emax = 618 nm. Antibodies are are affinity purified using solid phase rat IgG.DyLight is a registered trade mark of Thermofisher Inc., and its subsidaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized material at 2-8°C. Product is stable for 4 weeks at 2-8°Cafter rehydration. For long time storage after reconstitution, dilute the antibody solution with glycerol to a final concentration of 50% glycerol and store as liquid at -20 °C, to prevent loss of enzymatic activity. For example, if you have reconstituted 1 mg of antibody in 1,1 ml of sterile water add 1,1 ml of glycerol. Such solution will not freeze in -20 °C, If you are using a 1:5000 dilution prior to diluting with glycerol, then you would need to use a 1:2500 dilution after adding glycerol. Prepare working dilution prior to use and then discard. Be sure to mix well but without foaming.
Based on immunoelectrophoresis, this antibody reacts with: heavy (γ) chains on rat IgG light chains on all rat immunoglobulins.No reactivity is observed to: non-immunoglobulin rat serum proteins IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, mouse, rabbit or sheep.
Application Details:
1 : 20-1 : 2000 for most applications
Purity:
Immunogen affinity purified donkey IgG.
Reconstitution:
For reconstitution add 1,1 ml of sterile water, Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Conjugate is present in 10 mM Sodium Phosphate, 0,15 M Sodium Chloride, pH 7,2, 1 % (w/v) BSA, Protease/IgG free, 0,05 % (w/v) sodium azide is added as preservative
Research area:
Anti-Rat
Cookies:
X
We use cookies to help personalise and improve your web experience.
By using our website you consent to our use of cookies, some of which may have already been set on your device.
View our Cookie Policy to learn more.