Arginase-1, encoded by the ARG1 gene, is a cytosolic metalloenzyme expressed predominantly in hepatocytes. Arginase-1 plays a key role in the urea cycle by catalyzing the hydrolysis of arginine to ornithine and urea. Argininemia is an inherited autosomal recessive disorder characterized by a buildup of arginine and ammonia in the blood. Anti-Arginase-1 is highly specific for hepatocytes, and is therefore a sensitive and specific marker of benign and malignant hepatic tumours.
Arginase-1, encoded by the ARG1 gene, is a cytosolic metalloenzyme expressed predominantly in hepatocytes. Arginase-1 plays a key role in the urea cycle by catalyzing the hydrolysis of arginine to ornithine and urea. Argininemia is an inherited autosomal recessive disorder characterized by a buildup of arginine and ammonia in the blood. Anti-Arginase-1 is highly specific for hepatocytes, and is therefore a sensitive and specific marker of benign and malignant hepatic tumours.
Arginase-1, encoded by the ARG1 gene, is a cytosolic metalloenzyme expressed predominantly in hepatocytes. Arginase-1 plays a key role in the urea cycle by catalyzing the hydrolysis of arginine to ornithine and urea. Argininemia is an inherited autosomal recessive disorder characterized by a buildup of arginine and ammonia in the blood. Anti-Arginase-1 is highly specific for hepatocytes, and is therefore a sensitive and specific marker of benign and malignant hepatic tumours.
Annexin A1 (ANXA1) is a membrane protein that plays a role in innate and adaptive immunity by controlling the biosynthesis of inflammation, prostaglandins, and leukotriene mediators. This target is overexpressed in 97% of all samples from patients with hairy cell leukemia, and is absent in other B-cell lymphomas. High ANXA1 expression is frequently associated with advanced stage esophageal and esophagogastric junction adenocarcinoma, and is also linked to advanced and metastatic disease states.
Annexin A1 (ANXA1) is a membrane protein that plays a role in innate and adaptive immunity by controlling the biosynthesis of inflammation, prostaglandins, and leukotriene mediators. This target is overexpressed in 97% of all samples from patients with hairy cell leukemia, and is absent in other B-cell lymphomas. High ANXA1 expression is frequently associated with advanced stage esophageal and esophagogastric junction adenocarcinoma, and is also linked to advanced and metastatic disease states.
Annexin A1 (ANXA1) is a membrane protein that plays a role in innate and adaptive immunity by controlling the biosynthesis of inflammation, prostaglandins, and leukotriene mediators. This target is overexpressed in 97% of all samples from patients with hairy cell leukemia, and is absent in other B-cell lymphomas. High ANXA1 expression is frequently associated with advanced stage esophageal and esophagogastric junction adenocarcinoma, and is also linked to advanced and metastatic disease states.
Androgen Receptor (AR) is a transcriptional regulator with a broad array of functions. This marker is clinically significant in the understanding of tumour progression and tumour aggressiveness. The detection of AR by immunohistochemical staining is important for diagnosis of all types of prostate carcinoma, including both therapy-responsive and therapy-unresponsive disease states. Co-testing with AR and CK20 is used for differential diagnosis of desmoplastic trichoepithelioma (DTE) [CK20+/AR-], morpheaform basal cell carcinoma (BCC) [CK20-/AR+], and microcystic adnexal carcinoma (MAC) [CK20-/AR-].
Product Type:
Primary Antibody
Antibody Type:
Monoclonal
Format:
Predilute
Storage Temp:
2-8 degrees Celsius
Host Animal:
Rabbit
Species Reactivity:
Human
Immunogen:
Recombinant Protein
Applications:
IHC
Clone number:
IHC511
Antibody Isotype:
IgG
GMDN Code:
56796
UKCA Status:
UKCA
CE-IVD Status:
RUO
Positive Control:
Prostate Carcinoma
Purification:
Affinity Purification
Buffer:
Tris Buffer pH7.6 with BSA, and sodium azide as preservative
Androgen Receptor (AR) is a transcriptional regulator with a broad array of functions. This marker is clinically significant in the understanding of tumour progression and tumour aggressiveness. The detection of AR by immunohistochemical staining is important for diagnosis of all types of prostate carcinoma, including both therapy-responsive and therapy-unresponsive disease states. Co-testing with AR and CK20 is used for differential diagnosis of desmoplastic trichoepithelioma (DTE) [CK20+/AR-], morpheaform basal cell carcinoma (BCC) [CK20-/AR+], and microcystic adnexal carcinoma (MAC) [CK20-/AR-].
Product Type:
Primary Antibody
Antibody Type:
Monoclonal
Format:
Concentrate
Storage Temp:
2-8 degrees Celsius
Host Animal:
Rabbit
Species Reactivity:
Human
Immunogen:
Recombinant Protein
Applications:
IHC
Clone number:
IHC511
Antibody Isotype:
IgG
GMDN Code:
56796
UKCA Status:
UKCA
CE-IVD Status:
RUO
Positive Control:
Prostate Carcinoma
Purification:
Affinity Purification
Buffer:
Tris Buffer pH7.6 with BSA, and sodium azide as preservative
Androgen Receptor (AR) is a transcriptional regulator with a broad array of functions. This marker is clinically significant in the understanding of tumour progression and tumour aggressiveness. The detection of AR by immunohistochemical staining is important for diagnosis of all types of prostate carcinoma, including both therapy-responsive and therapy-unresponsive disease states. Co-testing with AR and CK20 is used for differential diagnosis of desmoplastic trichoepithelioma (DTE) [CK20+/AR-], morpheaform basal cell carcinoma (BCC) [CK20-/AR+], and microcystic adnexal carcinoma (MAC) [CK20-/AR-].
Product Type:
Primary Antibody
Antibody Type:
Monoclonal
Format:
Concentrate
Storage Temp:
2-8 degrees Celsius
Host Animal:
Rabbit
Species Reactivity:
Human
Immunogen:
Recombinant Protein
Applications:
IHC
Clone number:
IHC511
Antibody Isotype:
IgG
GMDN Code:
56796
UKCA Status:
UKCA
CE-IVD Status:
RUO
Positive Control:
Prostate Carcinoma
Purification:
Affinity Purification
Buffer:
Tris Buffer pH7.6 with BSA, and sodium azide as preservative
Alpha-Fetoprotein (AFP) is a major plasma glycoprotein seen in hepatocytes of fetal liver and in hepatoma. Elevated levels of AFP in adult serum may be indicative of hepatocellular carcinoma, hepatoid adenocarcinoma, germ cell tumours, or yolk sac tumours. In hepatocellular carcinoma, AFP expression usually indicates malignancy in a hepatocellular nodule and hepatic histogenesis of a malignancy.
Product Type:
Primary Antibody
Antibody Type:
Monoclonal
Format:
Predilute
Storage Temp:
2-8 degrees Celsius
Host Animal:
Mouse
Species Reactivity:
Human
Immunogen:
Recombinant Protein
Applications:
IHC
Clone number:
IHC714
Antibody Isotype:
IgG
GMDN Code:
56770
UKCA Status:
UKCA
CE-IVD Status:
IVDD
Positive Control:
Hepatocellular Carcinoma
Purification:
Affinity Purification
Buffer:
Tris Buffer pH7.6 with BSA, and sodium azide as preservative
Alpha-Fetoprotein (AFP) is a major plasma glycoprotein seen in hepatocytes of fetal liver and in hepatoma. Elevated levels of AFP in adult serum may be indicative of hepatocellular carcinoma, hepatoid adenocarcinoma, germ cell tumours, or yolk sac tumours. In hepatocellular carcinoma, AFP expression usually indicates malignancy in a hepatocellular nodule and hepatic histogenesis of a malignancy.
Product Type:
Primary Antibody
Antibody Type:
Monoclonal
Format:
Concentrate
Storage Temp:
2-8 degrees Celsius
Host Animal:
Mouse
Species Reactivity:
Human
Immunogen:
Recombinant Protein
Applications:
IHC
Clone number:
IHC714
Antibody Isotype:
IgG
GMDN Code:
56770
UKCA Status:
UKCA
CE-IVD Status:
IVDD
Positive Control:
Hepatocellular Carcinoma
Purification:
Affinity Purification
Buffer:
Tris Buffer pH7.6 with BSA, and sodium azide as preservative
Alpha-Fetoprotein (AFP) is a major plasma glycoprotein seen in hepatocytes of fetal liver and in hepatoma. Elevated levels of AFP in adult serum may be indicative of hepatocellular carcinoma, hepatoid adenocarcinoma, germ cell tumours, or yolk sac tumours. In hepatocellular carcinoma, AFP expression usually indicates malignancy in a hepatocellular nodule and hepatic histogenesis of a malignancy.
Product Type:
Primary Antibody
Antibody Type:
Monoclonal
Format:
Concentrate
Storage Temp:
2-8 degrees Celsius
Host Animal:
Mouse
Species Reactivity:
Human
Immunogen:
Recombinant Protein
Applications:
IHC
Clone number:
IHC714
Antibody Isotype:
IgG
GMDN Code:
56770
UKCA Status:
UKCA
CE-IVD Status:
IVDD
Positive Control:
Hepatocellular Carcinoma
Purification:
Affinity Purification
Buffer:
Tris Buffer pH7.6 with BSA, and sodium azide as preservative
Anaplastic Lymphoma Kinase (ALK) is a receptor tyrosine kinase which plays a role in brain and nervous system development. ALK is typically expressed at low levels in regions of the developing central and peripheral nervous system, such as the neonatal brain and spinal cord. The most common genetic alterations of this gene are chromosomal translocations, which result in multiple ALK fusion proteins that are involved in tumourigenesis, as in the case of anaplastic large cell lymphoma (ALCL), lung adenocarcinoma, and inflammatory myofibroblastic tumours. Aberrant ALK expression is also found in other tumours such as familial neuroblastoma, non-small cell lung carcinoma (NSCLC), and brain cancers.
Product Type:
Primary Antibody
Antibody Type:
Monoclonal
Format:
Predilute
Storage Temp:
2-8 degrees Celsius
Host Animal:
Mouse
Species Reactivity:
Human
Immunogen:
Recombinant Protein
Applications:
IHC
Clone number:
IHC509
Antibody Isotype:
IgG2b
GMDN Code:
56791
UKCA Status:
UKCA
CE-IVD Status:
IVDD
Positive Control:
Anaplastic Large Cell Lymphoma
Purification:
Affinity Purification
Buffer:
Tris Buffer pH7.6 with BSA, and sodium azide as preservative
Anaplastic Lymphoma Kinase (ALK) is a receptor tyrosine kinase which plays a role in brain and nervous system development. ALK is typically expressed at low levels in regions of the developing central and peripheral nervous system, such as the neonatal brain and spinal cord. The most common genetic alterations of this gene are chromosomal translocations, which result in multiple ALK fusion proteins that are involved in tumourigenesis, as in the case of anaplastic large cell lymphoma (ALCL), lung adenocarcinoma, and inflammatory myofibroblastic tumours. Aberrant ALK expression is also found in other tumours such as familial neuroblastoma, non-small cell lung carcinoma (NSCLC), and brain cancers.
Product Type:
Primary Antibody
Antibody Type:
Monoclonal
Format:
Concentrate
Storage Temp:
2-8 degrees Celsius
Host Animal:
Mouse
Species Reactivity:
Human
Immunogen:
Recombinant Protein
Applications:
IHC
Clone number:
IHC509
Antibody Isotype:
IgG2b
GMDN Code:
56791
UKCA Status:
UKCA
CE-IVD Status:
IVDD
Positive Control:
Anaplastic Large Cell Lymphoma
Purification:
Affinity Purification
Buffer:
Tris Buffer pH7.6 with BSA, and sodium azide as preservative
Anaplastic Lymphoma Kinase (ALK) is a receptor tyrosine kinase which plays a role in brain and nervous system development. ALK is typically expressed at low levels in regions of the developing central and peripheral nervous system, such as the neonatal brain and spinal cord. The most common genetic alterations of this gene are chromosomal translocations, which result in multiple ALK fusion proteins that are involved in tumourigenesis, as in the case of anaplastic large cell lymphoma (ALCL), lung adenocarcinoma, and inflammatory myofibroblastic tumours. Aberrant ALK expression is also found in other tumours such as familial neuroblastoma, non-small cell lung carcinoma (NSCLC), and brain cancers.
Product Type:
Primary Antibody
Antibody Type:
Monoclonal
Format:
Concentrate
Storage Temp:
2-8 degrees Celsius
Host Animal:
Mouse
Species Reactivity:
Human
Immunogen:
Recombinant Protein
Applications:
IHC
Clone number:
IHC509
Antibody Isotype:
IgG2b
GMDN Code:
56791
UKCA Status:
UKCA
CE-IVD Status:
IVDD
Positive Control:
Anaplastic Large Cell Lymphoma
Purification:
Affinity Purification
Buffer:
Tris Buffer pH7.6 with BSA, and sodium azide as preservative
Aldo-Keto Reductase Family 1 Member B10 (AKR1B10) is an enzyme of the aldo-keto reductase superfamily, and catalyzes the reduction of aliphatic and aromatic aldehydes. AKR1B10 is commonly expressed in adrenal glands, the small intestine, and colon tissues. AKR1B10 staining is useful in the recognition of liver carcinogenesis.
Product Type:
Primary Antibody
Antibody Type:
Monoclonal
Format:
Predilute
Storage Temp:
2-8 degrees Celsius
Host Animal:
Mouse
Species Reactivity:
Human
Immunogen:
Recombinant Protein
Applications:
IHC
Clone number:
IHC508
Antibody Isotype:
IgG2a
GMDN Code:
?
UKCA Status:
UKCA
CE-IVD Status:
IVDD
Positive Control:
Hepatocellular Carcinoma
Purification:
Affinity Purification
Buffer:
Tris Buffer pH7.6 with BSA, and sodium azide as preservative
Aldo-Keto Reductase Family 1 Member B10 (AKR1B10) is an enzyme of the aldo-keto reductase superfamily, and catalyzes the reduction of aliphatic and aromatic aldehydes. AKR1B10 is commonly expressed in adrenal glands, the small intestine, and colon tissues. AKR1B10 staining is useful in the recognition of liver carcinogenesis.
Product Type:
Primary Antibody
Antibody Type:
Monoclonal
Format:
Concentrate
Storage Temp:
2-8 degrees Celsius
Host Animal:
Mouse
Species Reactivity:
Human
Immunogen:
Recombinant Protein
Applications:
IHC
Clone number:
IHC508
Antibody Isotype:
IgG2a
GMDN Code:
?
UKCA Status:
UKCA
CE-IVD Status:
IVDD
Positive Control:
Hepatocellular Carcinoma
Purification:
Affinity Purification
Buffer:
Tris Buffer pH7.6 with BSA, and sodium azide as preservative
Aldo-Keto Reductase Family 1 Member B10 (AKR1B10) is an enzyme of the aldo-keto reductase superfamily, and catalyzes the reduction of aliphatic and aromatic aldehydes. AKR1B10 is commonly expressed in adrenal glands, the small intestine, and colon tissues. AKR1B10 staining is useful in the recognition of liver carcinogenesis.
Product Type:
Primary Antibody
Antibody Type:
Monoclonal
Format:
Concentrate
Storage Temp:
2-8 degrees Celsius
Host Animal:
Mouse
Species Reactivity:
Human
Immunogen:
Recombinant Protein
Applications:
IHC
Clone number:
IHC508
Antibody Isotype:
IgG2a
GMDN Code:
?
UKCA Status:
UKCA
CE-IVD Status:
IVDD
Positive Control:
Hepatocellular Carcinoma
Purification:
Affinity Purification
Buffer:
Tris Buffer pH7.6 with BSA, and sodium azide as preservative
Actin is part of the cytoskeletal system of all cell types. Smooth muscle actin is found in myofibroblasts and myoepithelium, but not in cardiac or skeletal muscles. Labeling of smooth muscle actin in concert with muscle specific actin staining can allow for differentiation between rhabdomyosarcoma and leiomyosarcoma, as muscle-specific actin is found in rhabdomyoblasts, while smooth muscle actin is found in leiomyosarcomas.
For the development of sandwich ELISA kit to measure mouse CCL20/MIP-3 alpha in cell culture supernatants, cell lysates, serum and plasma (heparin, EDTA).
Product Type:
Antibodies Primary
Storage Temp:
-20°C
Immunogen:
Expression system for standard: E.coli; Immunogen sequence: A28-M97
Applications:
ELISA
Additional Info:
For the development of sandwich ELISA kit to measure mouse CCL20/MIP-3 alpha in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).
Biosite Brand:
BioSite ELISA
Species Reactivity:
mouse
Cross Reactivity:
There is no detectable cross-reactivity with other relevant proteins.
Actin is part of the cytoskeletal system of all cell types. Smooth muscle actin is found in myofibroblasts and myoepithelium, but not in cardiac or skeletal muscles. Labeling of smooth muscle actin in concert with muscle specific actin staining can allow for differentiation between rhabdomyosarcoma and leiomyosarcoma, as muscle-specific actin is found in rhabdomyoblasts, while smooth muscle actin is found in leiomyosarcomas.
Actin is part of the cytoskeletal system of all cell types. Smooth muscle actin is found in myofibroblasts and myoepithelium, but not in cardiac or skeletal muscles. Labeling of smooth muscle actin in concert with muscle specific actin staining can allow for differentiation between rhabdomyosarcoma and leiomyosarcoma, as muscle-specific actin is found in rhabdomyoblasts, while smooth muscle actin is found in leiomyosarcomas.
Actin is part of the cytoskeletal system of every cell type. It can be classified based on isoelectric points as alpha, beta, and gamma. Muscle Specific Actin includes those of the alpha and gamma isotypes. Skeletal, smooth, and cardiac muscle cells will all stain positively with Anti-Muscle Specific Actin, but mesenchymal cells, not including myoepithelium, will stain negatively. Normal and neoplastic non-muscle cells, including vascular endothelial and connective tissues, carcinomas, melanomas, and lymphomas, will also be negative for muscle specific actin. The use of Anti-Muscle Specific Actin in concert with Anti-Smooth Muscle Actin can allow for differentiation between rhabdomyosarcoma and leiomyosarcoma, as muscle specific actin is found in rhabdomyoblasts, while smooth muscle actin is found in leiomyosarcomas.
Actin is part of the cytoskeletal system of every cell type. It can be classified based on isoelectric points as alpha, beta, and gamma. Muscle Specific Actin includes those of the alpha and gamma isotypes. Skeletal, smooth, and cardiac muscle cells will all stain positively with Anti-Muscle Specific Actin, but mesenchymal cells, not including myoepithelium, will stain negatively. Normal and neoplastic non-muscle cells, including vascular endothelial and connective tissues, carcinomas, melanomas, and lymphomas, will also be negative for muscle specific actin. The use of Anti-Muscle Specific Actin in concert with Anti-Smooth Muscle Actin can allow for differentiation between rhabdomyosarcoma and leiomyosarcoma, as muscle specific actin is found in rhabdomyoblasts, while smooth muscle actin is found in leiomyosarcomas.
Actin is part of the cytoskeletal system of every cell type. It can be classified based on isoelectric points as alpha, beta, and gamma. Muscle Specific Actin includes those of the alpha and gamma isotypes. Skeletal, smooth, and cardiac muscle cells will all stain positively with Anti-Muscle Specific Actin, but mesenchymal cells, not including myoepithelium, will stain negatively. Normal and neoplastic non-muscle cells, including vascular endothelial and connective tissues, carcinomas, melanomas, and lymphomas, will also be negative for muscle specific actin. The use of Anti-Muscle Specific Actin in concert with Anti-Smooth Muscle Actin can allow for differentiation between rhabdomyosarcoma and leiomyosarcoma, as muscle specific actin is found in rhabdomyoblasts, while smooth muscle actin is found in leiomyosarcomas.
Adrenocorticotropic Hormone (ACTH or Corticotropin) is a peptidic hormone synthesized in the anterior pituitary gland. The primary application of Anti-ACTH is in the identification of pituitary tumours and the study of pituitary disease. The Anti-ACTH antibody reacts with ACTH-producing cells (corticotrophs). It may also cause paraneoplastic syndromes by secreting ACTH from other tumours, such as some small cell carcinomas of the lung.
Product Type:
Primary Antibody
Antibody Type:
Monoclonal
Format:
Predilute
Storage Temp:
2-8 degrees Celsius
Host Animal:
Mouse
Species Reactivity:
Human
Immunogen:
Recombinant Protein
Applications:
IHC
Clone number:
IHC503
Antibody Isotype:
IgG1
GMDN Code:
56764
UKCA Status:
UKCA
CE-IVD Status:
IVDD
Positive Control:
Skeletal Muscle
Purification:
Affinity Purification
Buffer:
Tris Buffer pH7.6 with BSA, and sodium azide as preservative
Adrenocorticotropic Hormone (ACTH or Corticotropin) is a peptidic hormone synthesized in the anterior pituitary gland. The primary application of Anti-ACTH is in the identification of pituitary tumours and the study of pituitary disease. The Anti-ACTH antibody reacts with ACTH-producing cells (corticotrophs). It may also cause paraneoplastic syndromes by secreting ACTH from other tumours, such as some small cell carcinomas of the lung.
Product Type:
Primary Antibody
Antibody Type:
Monoclonal
Format:
Concentrate
Storage Temp:
2-8 degrees Celsius
Host Animal:
Mouse
Species Reactivity:
Human
Immunogen:
Recombinant Protein
Applications:
IHC
Clone number:
IHC503
Antibody Isotype:
IgG1
GMDN Code:
56764
UKCA Status:
UKCA
CE-IVD Status:
IVDD
Positive Control:
Skeletal Muscle
Purification:
Affinity Purification
Buffer:
Tris Buffer pH7.6 with BSA, and sodium azide as preservative
Adrenocorticotropic Hormone (ACTH or Corticotropin) is a peptidic hormone synthesized in the anterior pituitary gland. The primary application of Anti-ACTH is in the identification of pituitary tumours and the study of pituitary disease. The Anti-ACTH antibody reacts with ACTH-producing cells (corticotrophs). It may also cause paraneoplastic syndromes by secreting ACTH from other tumours, such as some small cell carcinomas of the lung.
Product Type:
Primary Antibody
Antibody Type:
Monoclonal
Format:
Concentrate
Storage Temp:
2-8 degrees Celsius
Host Animal:
Mouse
Species Reactivity:
Human
Immunogen:
Recombinant Protein
Applications:
IHC
Clone number:
IHC503
Antibody Isotype:
IgG1
GMDN Code:
56764
UKCA Status:
UKCA
CE-IVD Status:
IVDD
Positive Control:
Skeletal Muscle
Purification:
Affinity Purification
Buffer:
Tris Buffer pH7.6 with BSA, and sodium azide as preservative
5-methylcytosine (5-mC) is formed from the DNA methylation of the 5-carbon found on the cytosine ring. A 5-methylcytosine monoclonal antibody is a useful tool in identifying and discriminating between the unmodified cytosine base (C) and the methylated cytosine base (5-mC) as part of DNA methylation studies. DNA methylation plays an important role in the repression of transcription in the genome. When present in promoter regions, 5-mC is associated with stable transcriptional silencing which results in inactivation of gene function, thereby having an important role in tumorigenesis.
5-methylcytosine (5-mC) is formed from the DNA methylation of the 5-carbon found on the cytosine ring. A 5-methylcytosine monoclonal antibody is a useful tool in identifying and discriminating between the unmodified cytosine base (C) and the methylated cytosine base (5-mC) as part of DNA methylation studies. DNA methylation plays an important role in the repression of transcription in the genome. When present in promoter regions, 5-mC is associated with stable transcriptional silencing which results in inactivation of gene function, thereby having an important role in tumorigenesis.
5-methylcytosine (5-mC) is formed from the DNA methylation of the 5-carbon found on the cytosine ring. A 5-methylcytosine monoclonal antibody is a useful tool in identifying and discriminating between the unmodified cytosine base (C) and the methylated cytosine base (5-mC) as part of DNA methylation studies. DNA methylation plays an important role in the repression of transcription in the genome. When present in promoter regions, 5-mC is associated with stable transcriptional silencing which results in inactivation of gene function, thereby having an important role in tumorigenesis.
Apop's suite of CalRexin (TM) imaging reagents have been designed for imaging stressed, dying and apoptotic cells. They are monoclonal antibody fluorophore conjugates that target an epitope in the extracellular domain of the human calcitonin receptor (CT receptor), a novel marker of cell stress/autophagy and pre-apoptotic cell stress/apoptosis. They recognise and bind an epitope that is common to both C1a and C1b isoforms of the human calcitonin receptor, a membrane protein with seven transmembrane domains that is coupled to G protein messenger systems. The calcitonin receptor has been identified in a broad range of tissues throughout the life cycle of an organism as well as in diseased, stressed and damaged tissues. CalRexin (TM):fluorophore is accumulated into live cells and is designed for live cell assays.
Advantages: Simple to use High sensitivity, detect sub-populations in FACS of dying cells Enhanced stability (> 1 yr) Multiple applications (FACS, Operetta, confocal microscopy) Calcium independence for assays No false positives vs Annexin
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
200 µg in 200 µL PBS Purified, 1 mg/mL in phosphate buffered saline (PBS), sterile filtered
Host Animal:
Mouse
Species Reactivity:
Human cells and cell lines
Immunogen:
Synthetic peptide derived from sequence situated in the N-terminal domain of human calcitonin receptor.
For use in live cell assays to study pre-apoptotic stress and events leading to apoptosis. Flow Cytometry (1:500) Immunocytochemistry Live* (1:500) *Note that cells undergoing programmed cell death must be unfixed during the stain but may be fixed thereafter. ELISA (1:5000/50% colour) Immunoblotting (1:100)
UK:
138
WEBLIST PRICE 2022 USD:
200
GBP Equivalent price at 1.3:
110
Distributor_Net_Purchase_Price_2022_USD:
140
Price to us in GBP:
77.00
Profit:
61.00
Alternative Names:
Monoclonal antibody mAb2C4 conjugated with TFP esters:AZ680 The name given to mAb2C4 is CalRexin (TM)
Shelf Life:
Short term storage (12 months) at 4-6?C
Storage:
Storage for 12 months at 4-6?C after filter sterilization. Do not freeze. Prepare working dilutions on day of use.
Apop's suite of CalRexin (TM) imaging reagents have been designed for imaging stressed, dying and apoptotic cells. They are monoclonal antibody fluorophore conjugates that target an epitope in the extracellular domain of the human calcitonin receptor (CT receptor), a novel marker of cell stress/autophagy and pre-apoptotic cell stress/apoptosis. They recognise and bind an epitope that is common to both C1a and C1b isoforms of the human calcitonin receptor, a membrane protein with seven transmembrane domains that is coupled to G protein messenger systems. The calcitonin receptor has been identified in a broad range of tissues throughout the life cycle of an organism as well as in diseased, stressed and damaged tissues. CalRexin (TM):fluorophore is accumulated into live cells and is designed for live cell assays.
Advantages: Simple to use High sensitivity, detect sub-populations in FACS of dying cells Enhanced stability (> 1 yr) Multiple applications (FACS, Operetta, confocal microscopy) Calcium independence for assays No false positives vs Annexin
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
200 µg in 200 µL PBS Purified, 1 mg/mL in phosphate buffered saline (PBS), sterile filtered
Host Animal:
Mouse
Species Reactivity:
Human cells and cell lines
Immunogen:
Synthetic peptide derived from sequence situated in the N-terminal domain of human calcitonin receptor.
For use in live cell assays to study pre-apoptotic stress and events leading to apoptosis. Flow Cytometry (1:500) Immunocytochemistry Live* (1:500) *Note that cells undergoing programmed cell death must be unfixed during the stain but may be fixed thereafter. ELISA (1:5000/50% colour) Immunoblotting (1:100)
UK:
138
WEBLIST PRICE 2022 USD:
200
GBP Equivalent price at 1.3:
110
Distributor_Net_Purchase_Price_2022_USD:
140
Price to us in GBP:
77.00
Profit:
61.00
Alternative Names:
Monoclonal antibody mAb2C4 conjugated with TFP esters:AZ647 The name given to mAb2C4 is CalRexin (TM)
Shelf Life:
Short term storage (12 months) at 4-6?C
Storage:
Storage for 12 months at 4-6?C after filter sterilization. Do not freeze. Prepare working dilutions on day of use.
Apop's suite of CalRexin (TM) imaging reagents have been designed for imaging stressed, dying and apoptotic cells. They are monoclonal antibody fluorophore conjugates that target an epitope in the extracellular domain of the human calcitonin receptor (CT receptor), a novel marker of cell stress/autophagy and pre-apoptotic cell stress/apoptosis. They recognise and bind an epitope that is common to both C1a and C1b isoforms of the human calcitonin receptor, a membrane protein with seven transmembrane domains that is coupled to G protein messenger systems. The calcitonin receptor has been identified in a broad range of tissues throughout the life cycle of an organism as well as in diseased, stressed and damaged tissues. CalRexin (TM):fluorophore is accumulated into live cells and is designed for live cell assays.
Advantages: Simple to use High sensitivity, detect sub-populations in FACS of dying cells Enhanced stability (> 1 yr) Multiple applications (FACS, Operetta, confocal microscopy) Calcium independence for assays No false positives vs Annexin
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
200 µg in 200 µL PBS Purified, 1 mg/mL in phosphate buffered saline (PBS), sterile filtered
Host Animal:
Mouse
Species Reactivity:
Human cells and cell lines
Immunogen:
Synthetic peptide derived from sequence situated in the N-terminal domain of human calcitonin receptor.
For use in live cell assays to study pre-apoptotic stress and events leading to apoptosis. Flow Cytometry (1:500) Immunocytochemistry Live* (1:500) *Note that cells undergoing programmed cell death must be unfixed during the stain but may be fixed thereafter. ELISA (1:5000/50% colour) Immunoblotting (1:100)
UK:
124
WEBLIST PRICE 2022 USD:
180
GBP Equivalent price at 1.3:
99
Distributor_Net_Purchase_Price_2022_USD:
126
Price to us in GBP:
69.30
Profit:
54.70
Alternative Names:
Monoclonal antibody mAb2C4 conjugated with TFP esters:AZ568 The name given to mAb2C4 is CalRexin (TM)
Shelf Life:
Short term storage (12 months) at 4-6?C
Storage:
Storage for 12 months at 4-6?C after filter sterilization. Do not freeze. Prepare working dilutions on day of use.
Apop's suite of CalRexin (TM) imaging reagents have been designed for imaging stressed, dying and apoptotic cells. They are monoclonal antibody fluorophore conjugates that target an epitope in the extracellular domain of the human calcitonin receptor (CT receptor), a novel marker of cell stress/autophagy and pre-apoptotic cell stress/apoptosis. They recognise and bind an epitope that is common to both C1a and C1b isoforms of the human calcitonin receptor, a membrane protein with seven transmembrane domains that is coupled to G protein messenger systems. The calcitonin receptor has been identified in a broad range of tissues throughout the life cycle of an organism as well as in diseased, stressed and damaged tissues. CalRexin (TM):fluorophore is accumulated into live cells and is designed for live cell assays.
Advantages: Simple to use High sensitivity, detect sub-populations in FACS of dying cells Enhanced stability (> 1 yr) Multiple applications (FACS, Operetta, confocal microscopy) Calcium independence for assays No false positives vs Annexin
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
200 µg in 200 µL PBS Purified, 1 mg/mL in phosphate buffered saline (PBS), sterile filtered
Host Animal:
Mouse
Species Reactivity:
Human cells and cell lines
Immunogen:
Synthetic peptide derived from sequence situated in the N-terminal domain of human calcitonin receptor.
For use in live cell assays to study pre-apoptotic stress and events leading to apoptosis. Flow Cytometry (1:500) Immunocytochemistry Live* (1:500) *Note that cells undergoing programmed cell death must be unfixed during the stain but may be fixed thereafter. ELISA (1:5000/50% colour) Immunoblotting (1:100)
UK:
138
WEBLIST PRICE 2022 USD:
200
GBP Equivalent price at 1.3:
110
Distributor_Net_Purchase_Price_2022_USD:
140
Price to us in GBP:
77.00
Profit:
61.00
Alternative Names:
Monoclonal antibody mAb2C4 conjugated with TFP esters:AZ488 The name given to mAb2C4 is CalRexin (TM)
Shelf Life:
Short term storage (12 months) at 4-6?C
Storage:
Storage for 12 months at 4-6?C after filter sterilization. Do not freeze. Prepare working dilutions on day of use.
Apop's suite of CalRexin (TM) imaging reagents have been designed for imaging stressed, dying and apoptotic cells. They are monoclonal antibody fluorophore conjugates that target an epitope in the extracellular domain of the human calcitonin receptor (CT receptor), a novel marker of cell stress/autophagy and pre-apoptotic cell stress/apoptosis. They recognise and bind an epitope that is common to both C1a and C1b isoforms of the human calcitonin receptor, a membrane protein with seven transmembrane domains that is coupled to G protein messenger systems. The calcitonin receptor has been identified in a broad range of tissues throughout the life cycle of an organism as well as in diseased, stressed and damaged tissues. CalRexin (TM):fluorophore is accumulated into live cells and is designed for live cell assays.
Advantages: Simple to use High sensitivity, detect sub-populations in FACS of dying cells Enhanced stability (> 1 yr) Multiple applications (FACS, Operetta, confocal microscopy) Calcium independence for assays No false positives vs Annexin
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
200 µg in 200 µL PBS Purified, 1 mg/mL in phosphate buffered saline (PBS), sterile filtered
Host Animal:
Mouse
Species Reactivity:
Human cells and cell lines
Immunogen:
Synthetic peptide derived from sequence situated in the N-terminal domain of human calcitonin receptor.
For use in live cell assays to study pre-apoptotic stress and events leading to apoptosis. Flow Cytometry (1:500) Immunocytochemistry Live* (1:500) *Note that cells undergoing programmed cell death must be unfixed during the stain but may be fixed thereafter. ELISA (1:5000/50% colour) Immunoblotting (1:100)
UK:
516
WEBLIST PRICE 2022 USD:
750
GBP Equivalent price at 1.3:
413
Distributor_Net_Purchase_Price_2022_USD:
525
Price to us in GBP:
288.75
Profit:
227.25
Alternative Names:
Monoclonal antibody mAb2C4 conjugated with TFP esters:AZ680 The name given to mAb2C4 is CalRexin (TM)
Shelf Life:
Short term storage (12 months) at 4-6?C
Storage:
Storage for 12 months at 4-6?C after filter sterilization. Do not freeze. Prepare working dilutions on day of use.
Apop's suite of CalRexin (TM) imaging reagents have been designed for imaging stressed, dying and apoptotic cells. They are monoclonal antibody fluorophore conjugates that target an epitope in the extracellular domain of the human calcitonin receptor (CT receptor), a novel marker of cell stress/autophagy and pre-apoptotic cell stress/apoptosis. They recognise and bind an epitope that is common to both C1a and C1b isoforms of the human calcitonin receptor, a membrane protein with seven transmembrane domains that is coupled to G protein messenger systems. The calcitonin receptor has been identified in a broad range of tissues throughout the life cycle of an organism as well as in diseased, stressed and damaged tissues. CalRexin (TM):fluorophore is accumulated into live cells and is designed for live cell assays.
Advantages: Simple to use High sensitivity, detect sub-populations in FACS of dying cells Enhanced stability (> 1 yr) Multiple applications (FACS, Operetta, confocal microscopy) Calcium independence for assays No false positives vs Annexin
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
200 µg in 200 µL PBS Purified, 1 mg/mL in phosphate buffered saline (PBS), sterile filtered
Host Animal:
Mouse
Species Reactivity:
Human cells and cell lines
Immunogen:
Synthetic peptide derived from sequence situated in the N-terminal domain of human calcitonin receptor.
For use in live cell assays to study pre-apoptotic stress and events leading to apoptosis. Flow Cytometry (1:500) Immunocytochemistry Live* (1:500) *Note that cells undergoing programmed cell death must be unfixed during the stain but may be fixed thereafter. ELISA (1:5000/50% colour) Immunoblotting (1:100)
UK:
516
WEBLIST PRICE 2022 USD:
750
GBP Equivalent price at 1.3:
413
Distributor_Net_Purchase_Price_2022_USD:
525
Price to us in GBP:
288.75
Profit:
227.25
Alternative Names:
Monoclonal antibody mAb2C4 conjugated with TFP esters:AZ647 The name given to mAb2C4 is CalRexin (TM)
Shelf Life:
Short term storage (12 months) at 4-6?C
Storage:
Storage for 12 months at 4-6?C after filter sterilization. Do not freeze. Prepare working dilutions on day of use.
Apop's suite of CalRexin (TM) imaging reagents have been designed for imaging stressed, dying and apoptotic cells. They are monoclonal antibody fluorophore conjugates that target an epitope in the extracellular domain of the human calcitonin receptor (CT receptor), a novel marker of cell stress/autophagy and pre-apoptotic cell stress/apoptosis. They recognise and bind an epitope that is common to both C1a and C1b isoforms of the human calcitonin receptor, a membrane protein with seven transmembrane domains that is coupled to G protein messenger systems. The calcitonin receptor has been identified in a broad range of tissues throughout the life cycle of an organism as well as in diseased, stressed and damaged tissues. CalRexin (TM):fluorophore is accumulated into live cells and is designed for live cell assays.
Advantages: Simple to use High sensitivity, detect sub-populations in FACS of dying cells Enhanced stability (> 1 yr) Multiple applications (FACS, Operetta, confocal microscopy) Calcium independence for assays No false positives vs Annexin
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
200 µg in 200 µL PBS Purified, 1 mg/mL in phosphate buffered saline (PBS), sterile filtered
Host Animal:
Mouse
Species Reactivity:
Human cells and cell lines
Immunogen:
Synthetic peptide derived from sequence situated in the N-terminal domain of human calcitonin receptor.
For use in live cell assays to study pre-apoptotic stress and events leading to apoptosis. Flow Cytometry (1:500) Immunocytochemistry Live* (1:500) *Note that cells undergoing programmed cell death must be unfixed during the stain but may be fixed thereafter. ELISA (1:5000/50% colour) Immunoblotting (1:100)
UK:
447
WEBLIST PRICE 2022 USD:
650
GBP Equivalent price at 1.3:
358
Distributor_Net_Purchase_Price_2022_USD:
455
Price to us in GBP:
250.25
Profit:
196.75
Alternative Names:
Monoclonal antibody mAb2C4 conjugated with TFP esters:AZ568 The name given to mAb2C4 is CalRexin (TM)
Shelf Life:
Short term storage (12 months) at 4-6?C
Storage:
Storage for 12 months at 4-6?C after filter sterilization. Do not freeze. Prepare working dilutions on day of use.
Apop's suite of CalRexin (TM) imaging reagents have been designed for imaging stressed, dying and apoptotic cells. They are monoclonal antibody fluorophore conjugates that target an epitope in the extracellular domain of the human calcitonin receptor (CT receptor), a novel marker of cell stress/autophagy and pre-apoptotic cell stress/apoptosis. They recognise and bind an epitope that is common to both C1a and C1b isoforms of the human calcitonin receptor, a membrane protein with seven transmembrane domains that is coupled to G protein messenger systems. The calcitonin receptor has been identified in a broad range of tissues throughout the life cycle of an organism as well as in diseased, stressed and damaged tissues. CalRexin (TM):fluorophore is accumulated into live cells and is designed for live cell assays.
Advantages: Simple to use High sensitivity, detect sub-populations in FACS of dying cells Enhanced stability (> 1 yr) Multiple applications (FACS, Operetta, confocal microscopy) Calcium independence for assays No false positives vs Annexin
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
200 µg in 200 µL PBS Purified, 1 mg/mL in phosphate buffered saline (PBS), sterile filtered
Host Animal:
Mouse
Species Reactivity:
Human cells and cell lines
Immunogen:
Synthetic peptide derived from sequence situated in the N-terminal domain of human calcitonin receptor.
For use in live cell assays to study pre-apoptotic stress and events leading to apoptosis. Flow Cytometry (1:500) Immunocytochemistry Live* (1:500) *Note that cells undergoing programmed cell death must be unfixed during the stain but may be fixed thereafter. ELISA (1:5000/50% colour) Immunoblotting (1:100)
UK:
516
WEBLIST PRICE 2022 USD:
750
GBP Equivalent price at 1.3:
413
Distributor_Net_Purchase_Price_2022_USD:
525
Price to us in GBP:
288.75
Profit:
227.25
Alternative Names:
Monoclonal antibody mAb2C4 conjugated with TFP esters:AZ488 The name given to mAb2C4 is CalRexin (TM)
Shelf Life:
Short term storage (12 months) at 4-6?C
Storage:
Storage for 12 months at 4-6?C after filter sterilization. Do not freeze. Prepare working dilutions on day of use.
XLG2 protein is involved in G protein-coupled receptor signaling pathway and is involved in defense response, hypersensitive response and response to bacterium.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Recombinant XLG2 of Arabidopsis thaliana UniProt: C6KIE6, TAIR: AT4G34390
PDR8 protein is a key factor which controls the extent of cell death in defense response. Alternative names: ABC transporter ABCG.36, AtABCG36, pleiotropic drug resistance protein 8, protein PENETRATION 3
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Camelina sativa, Eutrema salsugineumSpecies of your interest not listed? Contact us
TIPs belong to MIP/aquaporin protein family. Alternative names: Aquaporin TIP1-1,gamma-tonoplast intrinsic protein, gamma-TIP, aquaporin TIP, gamma-tonoplast intrinsic protein, gamma-TIP, aquaporin TIP, tonoplast intrinsic protein, root-specific RB7, gamma-tonoplast intrinsic protein 2, gamma-TIP2, salt stress-induced tonoplast intrinsic protein
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Oryza sativa
Expected Species:
Brassica napus, Gossypium hirsutum, Hordeum vulgare, Populus trichocarpa, Raphanus sativus, Ricinus communisSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide conserved in Raphanus sativus TIP1;1 and TIP1;2 (protein accesion number available in Suga et al. 2001). Peptide is also conserved in Arabidopsis thaliana TIP1-1 P25818, At2g36830, TIP1-2 Q41963, At3g26520
Protein or membrane sample should be treated at 70 C for 10 min before loading on the gel.Diluted antibody solution can be used 2 to 3 times within one month if it contains 0.1 % sodium azide as preservative and is stored at -20 °C to -80 C.Triton X-100 should not be included in the protein extraction buffer, when cell organelles or membrane proteins must be separated from soluble proteins. Because, Triton X breaks membrane structure and solubilizes most membranes proteins. Furthermore, it should be noted that Triton X at high concentrations binds SDS and mask the detergent effect of SDS for SDS-PAGE. Also, micelles of Triton X behave as a large complex with molecular mass of 90 kDa at high concentrations in SDS-PAGE.
Application Details:
1 : 1000 (WB)
Purity:
Antigen affinity purified serum, in PBS pH 7.4
Reconstitution:
For reconstitution, add 50 l of sterile water.
Molecular Weight:
25,8 | 23 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Mao and Sun (2015). Arabidopsis seed-specific vacuolar aquaporins are involved in maintaining seed longevity under the control of ABSCISIC ACID INSENSITIVE 3. J Exp Bot. 2015 May 26. pii: erv244.Suga et al. (2001). Specificity of the accumulation of mRNAs and proteins of the plasma membrane and tonoplast aquaporings in radish organs. Planta 212:294-304.
LEA (Late embryogenesis abundant) proteins are very hydrophilic proteins, described over 25 years ago as accumulating during late stages of plant seed development. Found in vegetative plant tissues following exposure to environmental stress. Synonymes: Putative late embryogenesis abundant protein LEA.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
LEA (Late embryogenesis abundant) proteins are very hydrophilic proteins, described over 25 years ago as accumulating during late stages of plant seed development. Found in vegetative plant tissues following exposure to environmental stress. Synonymes: Putative late embryogenesis abundant protein LEA.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Part of a recombinant Arabidopsis thaliana LEA4-5, corresponding to position 78-158, UniProt: Q9FG31 , TAIR: AT5G06760
LEA (Late embryogenesis abundant) proteins are very hydrophilic proteins, described over 25 years ago as accumulating during late stages of plant seed development. Found in vegetative plant tissues following exposure to environmental stress. Synonymes: Putative late embryogenesis abundant protein LEA.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Rubisco catalyzes the rate-limiting step of carbon dioxide fixation in photosynthesis. This enzyme contains two subunits, each present in eight copies. In plants and green algae, 55-kD large subunit is coded by the chloroplast rbcL gene, and the 15-kD small subunit is coded by a family of nuclear RbcS genes.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Davies et al. (1997) Induction of extracellular matrix glycoproteins in Brassica petioles by wounding and in response to Xanthomonas campestris. Mol Plant Microbe Interact. 1997;10(7):812-820. doi:10.1094/MPMI.1997.10.7.812Wang. et al. (1995) The monoclonal antibody JIM19 modulates abscisic acid action in barley aleurone protoplasts. Planta 196, 271-276 (1995). https://doi.org/10.1007/BF00201384
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Davies et al. (1997) Induction of extracellular matrix glycoproteins in Brassica petioles by wounding and in response to Xanthomonas campestris. Mol Plant Microbe Interact. 1997;10(7):812-820. doi:10.1094/MPMI.1997.10.7.812Wang. et al. (1995) The monoclonal antibody JIM19 modulates abscisic acid action in barley aleurone protoplasts. Planta 196, 271-276 (1995). https://doi.org/10.1007/BF00201384
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Marcus et al. (2010) Restricted access of proteins to mannan polysaccharides in intact plant cell walls, the plant joutnal, volume 64, Issue 2, October 2010
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. This antibody, directed to branched galactan, is now a cell wall marker that can facilitate the study of vascular development across a range of different angiosperms.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Torode, O Neill, Marcus et al. (2018) Branched Pectic Galactan in Phloem-Sieve-Element Cell Walls: Implications for Cell Mechanics. Plant Physiol. 2018;176(2):1547-1558. doi:10.1104/pp.17.01568
LEA (Late embryogenesis abundant) proteins are very hydrophilic proteins, described over 25 years ago as accumulating during late stages of plant seed development. Found in vegetative plant tissues following exposure to environmental stress. Synonymes: Putative late embryogenesis abundant protein LEA.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
ELF4 (Early flowering 4) is the component of the central CCA1/LHY-TOC1 negative feedback loop in the circadian clock that promotes clock accuracy and is required for sustained rhythms in the absence of daily light/dark cycles. Increases ELF3 nuclear distribution and localization in nuclear bodies. ELF4 is necessary for light-induced expression of both CCA1 and LHY and mediates both entrainment to an environmental cycle and circadian rhythm sustainability under constant conditions. Controls flowering time. Alternative name: Protein ARRHYTHMIC 44.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to several years. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
KLH-conjugated peptide derived from N-terminal of Arabidopsis thaliana ELF4, UniProt: O04211, TAIR: AT2G40080
The plasma membrane H+ ATPase of plants and fungi generates a proton gradient that drives the active transport of nutrients by H+-symport
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Psb27-H1 (Photosystem II repair protein 27) is involved in repair of photodamaged photosystem II (PSII). Localized in the chloroplast lumen, and involved in cellular response to light intensity. Alternative name: Thylakoid lumenal protein PSB27-H1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica oleracea, Brassica rapa,Capsella rubella, Coffea arabica,Camellia sinensis,Cucurbita pepo subsp. pepo, Erythranthe guttata,Gossypium hirsutum, Hevea brasiliensis, Hibiscus syriacu,Morus notabilis, Populus alba, Populus trichocarpa,Raphanus sativus, Quillaja saponaria Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana PSB27-H1 protein sequence, UniProt: Q9LR64, TAIR: At1g03600
Freshly extracted samples are recommended for the analysis. For protein transfer, use a membrane with a pore size of 0.2 m to secure that the protein will transfer correctly, as described here.
Application Details:
1 : 1000 (WB)
Purity:
Antigen affinity purified serum, in PBS pH 7.4
Reconstitution:
For reconstitution, add 50 l, of sterile or deionized water.
Molecular Weight:
18.8 | 11.7 | kDa (due to terminal processing)
Not reactive in:
Chlamydomonas reinhardtii
Selected references:
To be added when available, antibody available in April 2023.
Ribosomal protein L4, chloroplastic, is one of the primary proteins involved in rRNA-binding, located in chloroplast. Alternative names: EMB2784, EMBRYO DEFECTIVE 2784, PLASTID RIBOSOMAL PROTEIN L4, PRPL4, RIBOSOMAL PROTEIN L4.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Cas9 (CRISPR-associated endonuclease 9) is an RNA-guided DNA endonuclease associated with the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) type II adaptive immunity system. CRISPR clusters are transcribed and processed into CRISPR RNA (crRNA). Cas9 protein serves as a genome engineering tool to induce site-directed double strand breaks in DNA. Alternative name: Csn1.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 4 C; Please remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Mouse
Species Reactivity:
Cas9 from Streptococcus pyogenes
Immunogen:
Recombinant protein part from the N-terminus of Cas9 from Streptococcus pyogenes.
Heat-shock protein 70 (Hsp70) is the major stress-inducible protein in vertebrates and is highly conserved throughout evolution. It plays a role as a molecular chaperone and is important for allowing cells to cope with acute stressor insult, especially those affecting the protein machinery. Heat shock cognate protein 70 (HSC70), is a highly conserved protein and a member of the family of molecular chaperones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 g/ l
Storage Temp:
Stable for at least one year at -20 °C. Avoid multiple freeze-thaw cycles, prepare aliquotes. Please, remember to spin a tube briefly prior opening them to avoid any loses that might occur from material adhering to the cap or sides of the tube.
Aflatoxins are naturally occurring mycotoxins that are produced by many species of Aspergillus. Aflatoxins are toxic and among the most carcinogenic substances known. Crops which are frequently affected by Asperiillus include cereals (maize, sorghum, pearl millet, rice, wheat), oilseeds (peanut, soybean, sunflower, cotton), spices (chile peppers, black pepper, coriander, turmeric, ginger), and tree nuts (almond, pistachio, walnut, coconut, brazil nut).
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Lyophilized powder is stable for a minimum of 2 years at -20 °C. Reconstitute in distilled water before use. Store reconstituted antibodies at 4°Cfor up to a month and make aliquots for extended storage.
Aflatoxins are naturally occurring mycotoxins that are produced by many species of Aspergillus. Aflatoxins are toxic and among the most carcinogenic substances known. Crops which are frequently affected by Asperiillus include cereals (maize, sorghum, pearl millet, rice, wheat), oilseeds (peanut, soybean, sunflower, cotton), spices (chile peppers, black pepper, coriander, turmeric, ginger), and tree nuts (almond, pistachio, walnut, coconut, brazil nut).
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Lyophilized powder is stable for a minimum of 2 years at -20 °C. Reconstitute in distilled water before use. Store reconstituted antibodies at 4°Cfor up to a month and make aliquots for extended storage.
MBP (Maltose binding protein) is encoded by the malE gene of E.coli and is a commonly used tag when studying protein expression using a wide range of applications. MBP tag enables easy purification of proteins from bacterial extracts under mild conditions.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Lyophilized powder is stable for a minimum of 2 years at -20 °C. Reconstitute in distilled water before use. Store reconstituted antibodies at 4°Cfor up to a month and make aliquots for extended storage.
Host Animal:
Mouse
Species Reactivity:
MBP maltose binding protein epitope tag
Immunogen:
MBP epitope tag protein.
Applications:
ELISA (ELISA), Immunocytochemistry (ICC), Immunofluorescence (IF), Western blot (WB)
Keyhole limpet hemocyanin (KLH) is a large cooper-containing protein consisting of subunits with MW of 400 kDa. It is found in the hemolymph of the sea mollusk Megathura crenulata. This extracellular respiratory protein has many immunostimulatory properties, including the ability to enhance the host’s immune response by interacting with T cells, monocytes, macrophages, and polymorphonuclear lymphocytes. Since its discovery, KLH has been used primarily as a carrier for vaccines and antigens and as adjuvant treatment in regimens such as antimicrobial therapy.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Lyophilized powder is stable for a minimum of 2 years at -20 °C. Reconstitute in distilled water before use. Store reconstituted antibodies at 4°Cfor up to a month and make aliquots for extended storage.
Host Animal:
Mouse
Species Reactivity:
Reacts with Keyhole Limpet 8-9 kDa Hemocyanin protein.
Protein present in plant vascular tissue (xylem and vascular cambium) is detected by anti-KLH antibodies (H glund et al. 2002) which might lead to false results in IL when using anti-peptide antibodies generated to KLH-conjugated peptide.
Zearalenone is a RAL and F-2 mycotoxin produced by some Fusarium and Gibberella species. It is a potent estrogenic metabolite and is the primary toxin causing infertility, abortion or other breeding problems, especially in swine. Zearalenone is found in a many cereal crops, such as maize, barley, oats, wheat, rice, sorghum as well as in bread all over the world.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Lyophilized powder is stable for a minimum of 2 years at -20 °C. Reconstitute in distilled water before use. Store reconstituted antibodies at 4°Cfor up to a month and make aliquots for extended storage.
Host Animal:
Mouse
Species Reactivity:
Antibody detects zearalenone mycotoxin of Fusarium sp.
Aflatoxins are naturally occurring mycotoxins that are produced by many species of Aspergillus. Aflatoxins are toxic and among the most carcinogenic substances known. Crops which are frequently affected by Asperiillus include cereals (maize, sorghum, pearl millet, rice, wheat), oilseeds (peanut, soybean, sunflower, cotton), spices (chile peppers, black pepper, coriander, turmeric, ginger), and tree nuts (almond, pistachio, walnut, coconut, brazil nut).
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Lyophilized powder is stable for a minimum of 2 years at -20 °C. Reconstitute in distilled water before use. Store reconstituted antibodies at 4°Cfor up to a month and make aliquots for extended storage.
Host Animal:
Mouse
Species Reactivity:
Antibody detects aflatoxin B1 from Aspergillus sp.
Fluorescein, a fluorophore is a commonly used dye in microscopy studies.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Lyophilized powder is stable for a minimum of 2 years at -20 °C. Reconstitute in distilled water before use. Store reconstituted antibodies at 4°Cfor up to a month and make aliquots for extended storage.
Host Animal:
Mouse
Species Reactivity:
Antibody detects free and bound fluorescein.
Immunogen:
Fluorescein
Applications:
ELISA (ELISA), Immunocytochemistry (ICC), Western blot (WB)
Digoxigenin (DIG) is an hapten from plants (Digitalis) and can be used as an epitope tag in many biological applications.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Lyophilized powder is stable for a minimum of 2 years at -20 °C. Reconstitute in distilled water before use. Store reconstituted antibodies at 4°Cfor up to a month and make aliquots for extended storage.
Host Animal:
Mouse
Species Reactivity:
Antibody detects free and bound digoxigenin tag
Immunogen:
Digoxigenin
Applications:
ELISA (ELISA), Immunohistochemistry (IHC), Western blot (WB)
Biotin has a high affinity to avidin or streptavidin and is there used as a common tag.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Lyophilized powder is stable for a minimum of 2 years at -20 °C. Reconstitute in distilled water before use. Store reconstituted antibodies at 4°Cfor up to a month and make aliquots for extended storage.
Host Animal:
Mouse
Species Reactivity:
Antibody detects free biotin and biotin bound on a carrier protein.
Immunogen:
Biotin
Applications:
ELISA (ELISA), Immunohistochemistry (IHC), Western blot (WB)
Xylan is a group of hemicelluloses that reside in plant cells walls and also can be found in some algae (both green and red). Xylans are polysaccharides whose backbone consists of beta-1,4-linked xylosyl residues. This backbone can be substituted with side-chains of arabinosyl, glucuronosyl, and 4-O-mthylglucuronosyl residues, and can also be further modified by acetyl substitution on the hydroxyls of the xylosyl residues.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Rat
Species Reactivity:
Higher plants
Immunogen:
Polysaccharide Arabinogalactan-protein (AGP) from Oryza sativa
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Rat
Species Reactivity:
Higher plants
Immunogen:
Polysaccharide Arabinogalactan-protein (AGP) from Oryza sativa
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Rat
Species Reactivity:
Higher plants
Immunogen:
Polysaccharide Arabinogalactan-protein (AGP) from Oryza sativa
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Rat
Species Reactivity:
Higher plants
Immunogen:
Polysaccharide Arabinogalactan-protein (AGP) from Oryza sativa
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Rat
Species Reactivity:
Higher plants
Immunogen:
Polysaccharide Arabinogalactan-protein (AGP) from Oryza sativa
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Rat
Species Reactivity:
Higher plants
Immunogen:
Polysaccharide Arabinogalactan-protein (AGP) from Oryza sativa
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Rat
Species Reactivity:
Higher plants
Immunogen:
Polysaccharide Arabinogalactan-protein (AGP) from Oryza sativa
Mucilage, a thick, viscous, gley substance of a polar glycoprotein and exopolysaccharide, is found on nearly all plants and some micoorganisms. It plays a role in the storage of water and food, thickening membranes and seed germination.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -80°C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Xylans are polysaccharides and belong to a group of hemicelluloses found in cell walls of plants and in red and green algae. Their backbones are built by beta-1,4-linked xylosyl residues.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store up to 1 month at 4 C, later at -80°C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Mouse
Species Reactivity:
Xylan (low arab) from Phormium tenax, Phormium spp.
Xylans are polysaccharides and belong to a group of hemicelluloses found in cell walls of plants and in red and green algae. Their backbones are built by beta-1,4-linked xylosyl residues.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store up to 1 month at 4 C, later at -80°C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Mouse
Species Reactivity:
Phormium cookianum, Sorghum bicolor, Zea mays
Immunogen:
High arabinose xylan from Phormium cookianum conjugated to Me-BSA
Xyloglucans are polysaccharides commonly referred to as hemicelluloses found in the primary cell walls of vascular plants. Species of trees known as sycamore include: Acer pseudoplatanus, Ficus sycomorus, Platanus orientalis,Platanus occidentalis,Platanus racemosa,Platanus wrightii.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store up to 1 month at 4 C, later at -80°C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Mouse
Species Reactivity:
Fucosylated xyloglucan, epitope XXFG
Immunogen:
BSA-conjugated (covalently) xyloglucan of Acer pseudoplatanus
Strep-tag II is a synthetic peptide consisting of eight amino acids (Trp-Ser-His-Pro-Gln-Phe-Glu-Lys coded also as WSHPQFEKGS) and can be N- or C- terminally fused to recombinant proteins.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid in PBS at 0.5 mg/ml.
Storage Temp:
Store at 4°C for 1-2 weeks (short term). For log term storage, aliquot and store at -20 °C and below, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Mouse
Species Reactivity:
Artificial sequence (3x WSHPQFEKGS)
Immunogen:
Recombinant human protein containing three tandem repeated Strep II tags (3xStrep-tag), separated by GlySer-linker sequence, at the N-terminus (expressed in HEK293 cells).
VSV-G tag corresponds to the partial peptide sequence of the vesicular stomatitis virus glycoprotein from Rhabdoviridae family, and consists of a single RNA molecule that encodes five proteins, one of which is a surface glycoprotein (G).. This epitope tag can be added to a protein from any species to allow further protein detection using different techniques like: immunolocalization, immunoprecipitation or Western blot.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid in PBS
Storage Temp:
Store at -20 °C; Avoid repeated freeze/thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes. For long term storage, transfer to -80 C
Alb3.2 (Inner membrane ALBINO3-like protein 2, chloroplastic) is involved in the assembly of the light-harvesting complex and interacts with reaction center polypeptides of PSI and PSII.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii
Expected Species:
Scenedesmus sp. PABB004
Immunogen:
6xHis tagged, recombinant C-terminal part of Chlamydomonas reinhardtii Alb3.2, UniProt Q8LKI3. Chosen sequence is not conserved in Alb3.1.
Can be provided with ProClin, if requested. For Western blot image, check the original publication G hre et al. 2006.
Application Details:
1: 5000 - 1 : 10 000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water.
Molecular Weight:
44.7 kDa
Not reactive in:
Arabidopsis thaliana, Zea mays
Selected references:
Gohre et al (2006). One of two alb3 proteins is essential for the assembly of the photosystems and for cell survival in Chlamydomonas. Plant Cell. 2006 Jun;18(6):1454-66. doi: 10.1105/tpc.105.038695. Epub 2006 May 5. PMID: 16679460; PMCID: PMC1475496.
PsaF (PSI-F subunit of photosystem I) is a plastocyanin-docking protein, involved in electron transfer from plastocyanin to c553. Alternative names: PSI-F.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii
Immunogen:
PsaF of Chlamydomonas reinhardtii, UniProt: A8J4S1
PsaE (PSI-E subunit of photosystem I) assists in docking of the ferredoxin to PSI and stabilizes the interaction between PsaC and the PSI core. Alternative names: P30 protein, Photosystem I 8.1 kDa protein,Photosystem I reaction center subunit IV, chloroplastic, PSI-E.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii
Immunogen:
PsaE of Chlamydomonas reinhardtii, UniProt: P12352
PsaD (PSI-D subunit of photosystem I) can form complexes with ferredoxin and ferredoxin-oxidoreductase in photosystem I (PS I) reaction center. Alternative names: Photosystem I 20 kDa subunit, PSI-D.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii
Immunogen:
PsaD of Chlamydomonas reinhardtii, UniProt: Q39615
DCL5 (Zea mays Dicer-like 102) may be involved in precise slicing in a range of monocots.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Zea mays DCL5 protein sequence UniProt: A0A1D6KSK2
AURKAIP1 mouse (Aurora kinase A-interacting protein) may act as a negative regulator of Aurora-A kinase, by down-regulation through proteasome-dependent degradation. Alternative names: 28S ribosomal protein S38, mitochondrial (MRP-S38), AURKA-interacting protein.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Mouse
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Recombinat mouse AURKAIP1 protein expressed in E.coli, UniProt: Q9DCJ7
UVR8 (Ultraviolet-B receptor UVR8) is a signaling component that acts as UV-B photoreceptor and plays a key role in establishing UV-protective responses in plants. Upon UV-B irradiation, UVR8 undergoes an immediate switch from homodimer to monomer, accumulates in the nucleus, interacts with the photomorphogenic repressor COP1 and regulates the expression of the transcription factor HY5 by associating with chromatin (through histone H2B binding) in the HY5 promoter region. Involved in controlling aspects of leaf growth and morphogenesis in response to UV-B, is required for normal progression of endocycle and has a regulatory role in stomatal differentiation as well as is required for plant circadian clock response to photomorphogenic UV-B light. Promotes photosynthetic efficiency at elevated levels of UV-B. Plays a role in mediating the effects of UV-B radiation on pathogen resistance by controlling the expression of the sinapate biosynthetic pathway. Alternative names: RCC1 domain-containing protein UVR8,Protein UV-B RESISTANCE 8.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica napus, Coffea arabica, Capsicum annuum, Glycine soja, Gossypium australe, Hordeum vulgare, Ipomoea triloba, Malus domestica, Nicotiana benthamiana, Nicotiana tabacum, Solanum lycopersicum, Solanum tuberosum, Oryza sativa, Phtheirospermum japonicum, Populus alba x Populus x berolinensis, Senna tora, Triticum aestivum, Triticum urartu, Turnera subulata, Zea maysSpecies of your interest not listed? Contact us
CHLH (GUN5) (Magnesium-chelatase subunit ChlH, chloroplastic) is a protein involved in chlorophyll synthesis, plastid to nucleus retrograde signaling and ABA perception. Alternative names: ABA-binding protein, Mg-protoporphyrin IX chelatase subunit ChlH, Protein CONDITIONAL CHLORINA, Protein GENOMES UNCOUPLED 5, Protein RAPID TRANSPIRATION IN DETACHED LEAVES 1
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Hordeum vulgare
Expected Species:
Acaryochloris marina, Halomicronema hongdechloris, Synechocystis sp. 6803Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana CHLH protein sequence, UniProt: Q9FNB0, TAIR: At5g13630
PetD (Cytochrome b6-f complex subunit 4) is the component of the cytochrome b6-f complex, which mediates electron transfer between photosystem II (PSII) and photosystem I (PSI), cyclic electron flow around PSI, and state transitions. Alternative name: 17 kDa polypeptide
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
FREE1 (Protein FREE1) is involved in the regulation of mulitivesicular/prevacuolar compartment protein sorting. Regulates multivesicular body (MVB) protein sorting and plant growth. Alternative names: FYVE domain protein required for endosomal sorting 1, FYVE domain-containing protein 1,FYVE1, PDE330, Pigment Defective Embryo 330.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana FREE1 protein sequence, UniProt: Q9ASS2, TAIR: At1g20110
TOC1 /TIMING OF CAB EXPRESSION 1) is involved in a negative regulation of gene expression and cytokinin activated signaling. Influences carbon fixation and biomass through the circadian clock period.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana TOC1 phosphorylated protein sequence, UniProt: A0A178UC73, TAIR: AT5G61380
TOC1 is heat sensitive and requires specific extraction buffer and denaturation conditions, described in application example. Using other conditions, may contribute to lack of detection of phosphorylation of TOC1 using this antibody.
Application Details:
1 : 1000 (WB)
Purity:
Antigen affinity purified serum, in PBS pH 7.4
Reconstitution:
For reconstitution add 50 l, of sterile or deionized water.
Molecular Weight:
69.195 | kDa (due to N-terminal or C-terminal processing)
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
To be added when available, antibody available in December 2022.
Botulinum toxin is a toxin produced by the anaerobic, gram-positive, bacterium of the genus Clostridium (C. botulinum, C. butyricum, C. baratii and C. argentinense). These strains are widely distributed and can be found in soil and dust. Eight types of botulinum toxin are distinguished, named type A–H. Type A and B are capable of causing disease in humans (botulism) and have longest activity in vivo, and are also used commercially (BOTOX) and medically. Types C–G are less common; types E and F can cause disease in humans, while the other types cause disease in other animals. Type E is a cause of botulism in humans. BotE is cleaved into two chains: heavy and light. Alternative names: Bontoxilysin-E, BoNT, BotE,
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Antibody should be stored at -20 °C.Aliquote to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
Clostridium botulinum
Immunogen:
Recombinant Botulinum Neurotoxin Type E Light Chain (Clostridium botulinum).
Botulinum toxin is a toxin produced by the anaerobic, gram-positive, bacterium of the genus Clostridium (C. botulinum, C. butyricum, C. baratii and C. argentinense). These strains are widely distributed and can be found in soil and dust. Eight types of botulinum toxin are distinguished, named type A–H. Type A and B are capable of causing disease in humans (botulism) and have longest activity in vivo, and are also used commercially (BOTOX) and medically. Types C–G are less common; types E and F can cause disease in humans, while the other types cause disease in other animals. Type E is a cause of botulism in humans. BotE is cleaved into two chains: heavy and light. Alternative names: Bontoxilysin-E, BoNT, BotE,
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Antibody should be stored at -20 °C.Aliquote to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
Clostridium botulinum
Immunogen:
Recombinant Botulinum Neurotoxin Type E Light Chain (Clostridium botulinum).
Botulinum toxin is a toxin produced by the anaerobic, gram-positive, bacterium of the genus Clostridium (C. botulinum, C. butyricum, C. baratii and C. argentinense). These strains are widely distributed and can be found in soil and dust. Eight types of botulinum toxin are distinguished, named type A–H. Type A and B are capable of causing disease in humans (botulism) and have longest activity in vivo, and are also used commercially (BOTOX) and medically. Types C–G are less common; types E and F can cause disease in humans, while the other types cause disease in other animals. Type E is a cause of botulism in humans. BotE is cleaved into two chains: heavy and light. Alternative names: Bontoxilysin-E, BoNT, BotE,
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Antibody should be stored at -20 °C.Aliquote to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
Clostridium botulinum
Immunogen:
Recombinant Botulinum Neurotoxin Type E Light Chain (Clostridium botulinum).
GFP (Green fluorescent protein) was originally identified in photo organs on jellyfish Aequorea victoria. It is a naturally fluorescent protein which emits green light at a maximum wavelength of 509 nm when excited by blue or UV light. It is extensively used in laboratory as a reporter molecule to label and study cellular and subcellular proteins in living cells using a wide range of applications. Antibodies to GFP protein are used in immunoblotting and ELISA. GFP protein has molecular weight of 27 kDa.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes
Host Animal:
Mouse
Species Reactivity:
GFP-tagged proteins
Immunogen:
Recombinant GFP protein derived from Aequorea victoria, UniProt: P42212
Mouse IgG negative control for ChIP is suitable for chromatin immunoprecipitation (ChIP) and has been validated for this assay as well as for MeDIP, IF and other experiments where primary antibodies made in a mouse are used. This preparation contains a pool of the IgG subclasses from the serum of healthy mice.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 4°Cor -20 °C; and make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Rabbit IgG negative control for ChIP is suitable for chromatin immunoprecipitation (ChIP) and has been validated for this assay as well as for MeDIP, IF and other experiments where primary antibodies made in a rabbit are used. This preparation contains a pool of the IgG subclasses from the serum of healthy rabbits.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cor -20 °C; and make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
ASY1 (Asynapsis 1) is a protein required for normal meiosis in male and female gametophytes, which plays a crucial role in coordinating the activity of DMC1. Alternative names: Meiosis-specific protein ASY1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Hordeum vulgare
Expected Species:
Arabidopsis thaliana, Hordeum vulgare, Oryza sativa, Triticum aestivum, Zea maysSpecies of your interest not listed? Contact us
Immunogen:
Recombinant ASY1 protein from Hordeum vulgare, UniProt: A0A8I6YI54
The PsbO protein is an extrinisic subunit of the water splitting photosystem II (PSII) complex. The protein is exposed on the luminal side of the thylakoid membrane, and is hihgly conserved in all known oxygenic photosynthetic organisms.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii
Expected Species:
Halomicronema hongdechloris, Synechocystissp., Synechococcus elongatusSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Chlamydomonas reinhardtii PsbO protein sequence, UniProt: P12853
TAP (tandem-affinity-purification) epitope tag makes a rapid purification of low abundance complexes. TAP approach can be combined with mass spectrometry to allow identification of protein interactions with a given target protein.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
TAP epitope tag
Immunogen:
TAP epitope tag, sequence: CSSGALDYDIPTTASENLYFQ, derived from the C-terminus of the TAP-tag construct after TEV cleavage,
CBP tag comes from muscle myosin light-chain kinase and contains 26 amino acid residues with the molecular weight of 4 kDa. This tag is characterized by the relatively high affinity for calmodulin (CaM), which makes it possible to purify CBP-tagged proteins from crude cell extracts using of a resin with CaM affinity. This antibody allows detection of CBP-tagged proteins.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
The anti-Myc tag is a primary antibody which is used to detect proteins containing the Myc epitope tag. The Myc tag contains the amino acid sequence EQKLISEEDL, corresponding to amino acids 410-419 of human Myc.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
S-tag from pancreatic ribonuclease A (RNase A). Due to abundance of charged and polar residues, this tag may improve solubility of recombinant proteins. It can be fused at the N- or C-terminus of a target protein.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Trx (Thioredoxin 1) is a redox protein with a primary domain conserved across a number of Trx family members. The protein contains a conserved catalytic site Cys-Gly-Pro-Cys. The protein is used as a fusion tag in a number of molecular biology applications.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Strep-tag II is a synthetic peptide consisting of eight amino acids (Trp-Ser-His-Pro-Gln-Phe-Glu-Lys) and this peptide sequence shows high affinity towards Strep-Tactin , a specifically engineered streptavidin, and can be N- or C- terminally fused to recombinant proteins.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
HSV (herpes simplex virus) eptiope tag originates from envelope glycoprotein D. It is frequently used to target N- or C- terminus of a protein of interest to allow target protein detection, in case when specific antibodies are not available.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
KT3 epitope tag consists of 11 amino acids in the leader sequence of T7 bacteriophage gene10 and is used as a tag in many expression vectors including pET system. Specific anti-T7 tag antibodies are suitable for detection of T7-tagged proteins.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
T7 epitope tag consists of 11 amino acids in the leader sequence of T7 bacteriophage gene10 and is used as a tag in many expression vectors including pET system. Specific anti-T7 tag antibodies are suitable for detection of T7-tagged proteins.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
MBP (Maltose binding protein) is encoded by the malE gene of E.coli and is a commonly used tag when studying protein expression using a wide range of applications. MBP tag enables easy purification of proteins from bacterial extracts under mild conditions.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C for up to 1 year, Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
GST-tag (glutathione S-transferase) is a tag added to a protein of interest as a fusion protein to unable purification and detection. The tag is 220 amino acid long, ca. 26 kDa which makes it quite large compare to Myc or FLAG tags.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C for up to 3 years, Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Immunogen:
GST (glutathione S-transferase) recombinant protein
V5-tag is a tag that can be added to a protein of interest as a fusion protein to enable purification and detection. It is derived from a small epitope (Pk) present on the P and V proteins of the paramyxovirus of simian virus (SV5). Addition of a V5-Tag to a protein of interest makes it possible to localize a specific gene product in a variety of cell types, study the topology of proteins and protein complexes, identify associated proteins, and characterize newly identified, low abundance or poorly immunogenic proteins when protein specific antibodies are not available.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
V5-tagged fusion proteins
Immunogen:
KLH-conjugated GKPIPNPLLGLDST synthetic peptide
Applications:
ELISA (ELISA), Immunofluorescence (IF), Immunoprecipitation (IP), Western blot (WB)
mStrawberry is constitutively fluorescent, red fluorescent protein derived from Discosoma sp. developed in Dr. Roger Tsien’s lab by directed mutagenesis of mRFP (Shaner et al. 2004). The mStrawberry fluorescent protein photobleaches rapidly, threfore mCherry is recommended for applications in which require a more photostable red monomer.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tube.
ATP synthase is the universal enzyme that synthesizes ATP from ADP and phosphate using the energy stored in a transmembrane ion gradient. AtpA is the largest subunit of the membrane-extrinsic ATP synthase subcomplex.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii
Expected Species:
Colemanosphaera charkowiensis, Eudorina elegans,Gonium pectorale, Pandorina colemaniae, Pleodorina starrii, Volvox africanus, Yamagishiella unicocca Species of your interest not listed? Contact us
Immunogen:
CF 1 alpha subunit of the chloroplast ATP synthase complex isolated from Chlamydomonas reinhardtii, UniProt: P26526
Alcohol dehydrogenase is an isozyme which preferentially catalyzes the conversion of primary unbranched alcohols to a corresponding aldehydes. Alternative names: Alcohol dehydrogenase I, YADH-1
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Alcohol dehydrogenase isolated and purified from UniProt: P00330
Applications:
ELISA (ELISA), Dot blot (Dot), Indirect immunofluorescence (indirect IF), Western blot (WB)
Aldehyde dehydrogenase in an enzyme involved in synthesis of acetate from ethanol. Alternative name: Aldehyde dehydrogenase 1, mitochondrial
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Aldehyde dehydrogenase isolated and purified from Saccharomyces cerevisiae, UniProt: P22281
Applications:
ELISA (ELISA), Dot blot (Dot), Immunocytochemistry (IHC), Western blot (WB)
Aldehyde dehydrogenase in an enzyme involved in synthesis of acetate from ethanol. Alternative name: Aldehyde dehydrogenase 1, mitochondrial
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Aldehyde dehydrogenase isolated and purified from Saccharomyces cerevisiae, UniProt: P22281
Applications:
ELISA (ELISA), Dot blot (Dot), Indirect immunofluorescence (indirect IF), Western blot (WB)
Choline kinase is an enzyme which catalyzes the committed step in the synthesis of phosphatidylcholine by the CDP-choline pathway. Alternative name: ATP:choline phosphotransferase
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Choline kinase isolated and purified from Saccharomyces cerevisiae, UniProt: P20485
Expression system for standard: NS0; Immunogen sequence: H129-R247
Applications:
ELISA
Additional Info:
The Quick ELISA kits, assay takes less than 1.5 hours. Detect Mouse BDNF with <15pg/ml sensitivity Compatible samples: cell culture supernatants, cell lysates, serum and plasma (heparin, EDTA, citrate). This is a TMB colorimetric sandwich ELISA kit with short assay time and quick experiment set up.
Biosite Brand:
BioSite ELISA
Species Reactivity:
mouse
Cross Reactivity:
There is no detectable cross-reactivity with other relevant proteins.
Choline kinase is an enzyme which catalyzes the committed step in the synthesis of phosphatidylcholine by the CDP-choline pathway. Alternative name: ATP:choline phosphotransferase
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Choline kinase isolated and purified from Saccharomyces cerevisiae, UniProt: P20485
Applications:
ELISA (ELISA), Dot blot (Dot), Indirect immunofluorescence (indirect IF), Western blot (WB)
Formate dehydrogenase is an enzyme which is catalysing oxidation of formate to carbon dioxide.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Formate dehydrogenase is isolated and purified from Saccharomyces
Applications:
Dot blot (Dot), ELISA (ELISA),Immunocytochemistry (IHC), (ICC),Immunohistochemistry (paraffin), Western blot (WB)
Formate dehydrogenase is an enzyme which is catalysing oxidation of formate to carbon dioxide.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Isolated and purified formate dehydrogenase from Saccharomyces cerevisiae, UniProt: Q08911
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Beta-Galactosidase is an enzyme involved in hydrolysis of terminal non-reducing beta-D-galactose residues in beta-D-galactosides. Alternative names: Beta-gal, Lactase
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
beta-Galactosidase is isolated and purified from Escherichia coli, UniProt: P00722
Applications:
Dot blot (Dot), ELISA (ELISA), Immunocytochemistry (IHC), Western blot (WB)
Beta-Galactosidase is an enzyme involved in hydrolysis of terminal non-reducing beta-D-galactose residues in beta-D-galactosides. Alternative names: Beta-gal, Lactase
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
beta-Galactosidase is isolated and purified from Escherichia coli, UniProt: P00722
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Glutathion reductase (GR) is an enzyme responsible for maintaining of high levels of reduced glutathionein the cytosol.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Glutathione reductase isolated and purified from Saccharomyces cerevisiae, UniProt: P41921
Glutathion reductase (GR) is an enzyme responsible for maintaining of high levels of reduced glutathionein the cytosol.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Glutathione reductase isolated and purified from Saccharomyces cerevisiae, UniProt: P41921
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Glyceraldehyde-3-phosphate dehydrogenase is an enzyme of a first step of the pathway that synthesizes pyruvate from D-glyceradehyde 3-phosphate. Alternative name: GAPDH 3
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Glyceraldehyde-3-phosphate dehydrogenase isolated and purified from Saccharomyces cerevisiae, UniProt: P00359
Applications:
Dot blot (Dot), ELISA (ELISA), Immunocytochemistry (IHC), Western blot (WB)
Glyceraldehyde-3-phosphate dehydrogenase is an enzyme of a first step of the pathway that synthesizes pyruvate from D-glyceradehyde 3-phosphate. Alternative name: GAPDH 3
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Glyceraldehyde-3-phosphate dehydrogenase isolated and purified from Saccharomyces cerevisiae, UniProt: P00359
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Hexokinase is an enzyme which catalyzes the phosphorylation of hexose, such as D-glucose and D-fructose, to hexose 6-phosphate (D-glucose 6-phosphate and D-fructose 6-phosphate, respectively).Alternative names: Hexokinase PII, Hexokinase-B
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Hexokinase isolated and purified from Saccharomyces cerevisiae, UniProt: P04807
Hexokinase is an enzyme which catalyzes the phosphorylation of hexose, such as D-glucose and D-fructose, to hexose 6-phosphate (D-glucose 6-phosphate and D-fructose 6-phosphate, respectively).Alternative names: Hexokinase PII, Hexokinase-B
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Hexokinase isolated and purified from Saccharomyces cerevisiae, UniProt: P04807
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Alkaline phosphatase is an enzyme which is involved in dephosphorylation process. Found in periplasmic space in Escherichia coli. Alternative name: APase
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Alkaline phosphatase isolated and purified from Escherichia coli, UniProt: P00634
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Alkaline phosphatase is an enzyme which is involved in dephosphorylation process. Found in periplasmic space in Escherichia coli. Alternative name: APase
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Alkaline phosphatase isolated and purified from Escherichia coli, UniProt: P00634
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
3-Phosphoglyceric phosphokinase is an enzyme which generates ATP by catalysing the transfer of a phosphate group from 1,3-diphosphoglycerate to ADP, in glycolysis and gluconeogenesis.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
3-Phosphoglyceric phosphokinase isolated and purified from Saccharomyces cerevisiae
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
3-Phosphoglyceric phosphokinase is an enzyme which generates ATP by catalysing the transfer of a phosphate group from 1,3-diphosphoglycerate to ADP, in glycolysis and gluconeogenesis.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
3-Phosphoglyceric phosphokinase isolated and purified from Saccharomyces cerevisiae, UniProt: P00560
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Phosphoglucose isomerase, is a cytoplasmic enzyme, which catalyses the conversion of glucose-6-phosphate to fructose-6-phosphate, the second step in glycolysis, and the reverse reaction during gluconeogenesis. Alternative names: GPI , Phosphoglucose isomerase, PGI Phosphohexose isomerase, PHI
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Phosphoglucose isomerase isolated and purified from Saccharomyces cerevisiae, UniProt: P12709
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Phosphoglucose isomerase, is a cytoplasmic enzyme, which catalyses the conversion of glucose-6-phosphate to fructose-6-phosphate, the second step in glycolysis, and the reverse reaction during gluconeogenesis. Alternative names: GPI , Phosphoglucose isomerase, PGI Phosphohexose isomerase, PHI
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Phosphoglucose isomerase isolated and purified from Saccharomyces cerevisiae, UniProt: P12709
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Gluconate kinase is involved in the pathway D-gluconate degradation, which is part of carbohydrate acid metabolism.Alternative names: Gluconate kinase 2, Thermoresistant gluconokinase
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Gluconate kinase isolated and purified from Escherichia coli, UniProt: P46859
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Gluconate kinase is involved in the pathway D-gluconate degradation, which is part of carbohydrate acid metabolism.Alternative names: Gluconate kinase 2, Thermoresistant gluconokinase
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Gluconate kinase is isolated and purified from Escherichia coli, UniProt: P46859
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Ribonucleic acid polymerase DNA-dependent RNA polymerase (RNAP) catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. This subunit plays an important role in subunit assembly since its dimerization is the first step in the sequential assembly of subunits to form the holoenzyme.
Product Type:
Antibody
Antibody Type:
PolyclonalRibonucleic acid polymerase isolated and purified from Escherichia coli, Freund's complete adjuvant is used in the first step of the immunization procedure
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Ribonucleic acid polymerase isolated and purified from Escherichia coli, UniProt: P0A7Z4
Applications:
Dot blot (Dot), ELISA (ELISA),Immunocytochemistry (IHC), (ICC),Immunohistochemistry (paraffin), Western blot (WB)
Ribonucleic acid polymerase DNA-dependent RNA polymerase (RNAP) catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. This subunit plays an important role in subunit assembly since its dimerization is the first step in the sequential assembly of subunits to form the holoenzyme.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Ribonucleic acid polymerase isolated and purified from Escherichia coli, UniProt: P0A7Z4
Applications:
Indirect immunofluorescence (indirect IF)ELISA (ELISA),Dot blot (Dot),Western blot (WB)
Nuclease from Staphylococcus aureus is an enzyme secreted by these bacteria to degrade neutrophil extracellular trap of a host.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Staphylococcus aureus
Expected Species:
Species of your interest not listed?Contact us
Immunogen:
Nuclease isolated and purified from Staphylococcus aureus
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Nuclease from Staphylococcus aureus is an enzyme secreted by these bacteria to degrade neutrophil extracellular trap of a host.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Staphylococcus aureus
Expected Species:
Species of your interest not listed?Contact us
Immunogen:
Nuclease isolated and purified from Staphylococcus aureus
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF),Western blot (WB)
NADH-FMN oxidoredutase is an enzyme involved in riboflavin metabolism and often forms a two-component system with monooxygenases and displays a strong preference for NADH over NADPH. Alternative names: FMN reductase (NADH); NADH-FMN reductase; NADH-dependent FMN reductase; NADH:FMN oxidoreductase; NADH:flavin oxidoreductase
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Photobacterium fischeriSpecies of your interest not listed?Contact us.support@agrisera.com
Expected Species:
Species of your interest not listed?Contact us.support@agrisera.com
Immunogen:
NADH-FMN oxidoredutase isolated and purified from Photobacterium fischeri
Applications:
ELISA (ELISA), Dot blot (Dot), Indirect immunofluorescence (indirect IF), Western blot (WB)
Luciferase is an enzyme that catalyzes a light-emitting reaction and can be found in bacteria, algae, fungi, jellyfish, insects, shrimp, and squid, and the resulting light that these organisms produce is termed bioluminescence. Bacterial luciferase genes (luxA, luxB, luxC, luxD, and luxE), responsible for the light-emitting reaction (the lux genes) have been used in construction of bioreporters that emit a blue-green light with a maximum intensity at 490 nm.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Photobacterium fischeri
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Luciferase isolated and purified from Photobacterium fischeri
Applications:
ELISA (ELISA), Dot blot (Dot), Indirect immunofluorescence (indirect IF), Western blot (WB)
Luciferase is an enzyme that catalyzes a light-emitting reaction and can be found in bacteria, algae, fungi, jellyfish, insects, shrimp, and squid, and the resulting light that these organisms produce is termed bioluminescence. Bacterial luciferase genes (luxA, luxB, luxC, luxD, and luxE), responsible for the light-emitting reaction (the lux genes) have been used in construction of bioreporters that emit a blue-green light with a maximum intensity at 490 nm.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Photobacterium fischeri
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Luciferase isolated and purified from Photobacterium fischeri
Applications:
ELISA (ELISA),Dot blot (Dot), Indirect immunofluorescence (indirect IF), Western blot (WB)
c-Myc is derived from Myc proto-oncogene protein. The c-Myc protein is a transcription factor (nuclear localization). c-Myc is commonly activated in a variety of tumor cells and plays an important role in cellular proliferation, differentiation, apoptosis and cell cycle progression. A short peptide was used as an epitope tag, that is easily recognized by tag specific antibodies. This is a universal detection reagent which will allow detection of any c-Myc tag containing protein.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store in the dark at 2-8°C. Do not freeze. Avoid prolonged exposure to light. Do not use after expiration date stamped on vial label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
c-Myc tagged fusion proteins
Immunogen:
Conjugated synthetic peptide: AEEQKLISEEDLL derived from the C-terminal region of human c-Myc. UniProt: P01106
c-Myc is derived from Myc proto-oncogene protein. The c-Myc protein is a transcription factor (nuclear localization). c-Myc is commonly activated in a variety of tumor cells and plays an important role in cellular proliferation, differentiation, apoptosis and cell cycle progression. A short peptide was used as an epitope tag, that is easily recognized by tag specific antibodies. This is a universal detection reagent which will allow detection of any c-Myc tag containing protein.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store in the dark at 2-8°C. Do not freeze. Avoid prolonged exposure to light. Do not use after expiration date stamped on vial label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
c-Myc tagged fusion proteins
Immunogen:
Conjugated synthetic peptide: AEEQKLISEEDLL derived from the C-terminal region of human c-Myc. UniProt: P01106
Tubulin alpha (TUA) together with beta tubulin is making up microtubules. The microtubules are intracellular dynamic polymers made up of evolutionarily conserved polymorphic alpha/beta-tubulin heterodimers and a large number of microtubule-associated proteins (MAPs). The microtubules consist of 13 protofilaments and have an outer diameter 25 nm. Microtubules have their intrinsic polarity; highly dynamic plus ends and less dynamic minus ends. Microtubules are required for vital processes in eukaryotic cells including mitosis, meiosis, maintenance of cell shape and intracellular transport.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store in the dark at 2-8°C. Do not freeze. Avoid prolonged exposure to light. Do not use after expiration date stamped on vial label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
c-Myc is derived from Myc proto-oncogene protein. The c-Myc protein is a transcription factor (nuclear localization). c-Myc is commonly activated in a variety of tumor cells and plays an important role in cellular proliferation, differentiation, apoptosis and cell cycle progression. A short peptide was used as an epitope tag, that is easily recognized by tag specific antibodies. This is a universal detection reagent which will allow detection of any c-Myc tag containing protein.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on the label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
c-Myc tagged fusion proteins
Immunogen:
Conjugated synthetic peptide: AEEQKLISEEDLL derived from the C-terminal region of human c-Myc. UniProt: P01106
Applications:
Immunoprecipitation (IP), Immunohistochemisty (IHC), paraffin, Flow cytometry (Flowcyt), Western blot (WB)
Tubulin alpha (TUA) together with beta tubulin is making up microtubules. The microtubules are intracellular dynamic polymers made up of evolutionarily conserved polymorphic alpha/beta-tubulin heterodimers and a large number of microtubule-associated proteins (MAPs). The microtubules consist of 13 protofilaments and have an outer diameter 25 nm. Microtubules have their intrinsic polarity; highly dynamic plus ends and less dynamic minus ends. Microtubules are required for vital processes in eukaryotic cells including mitosis, meiosis, maintenance of cell shape and intracellular transport.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on the label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Dendra2 is an improved version of green-to-red photo switchable protein Dendra, from an octocoral (Dendronephthya) and compared to it, Dendra2 exhibits brighter fluorescence before and after photoswitching. Excitation maximum of Dendra2 is 490 nm before and 553 nm after photoactivation, and its emission maximum is 507 nm before and 573 nm after photoactivation. Activating light for Dendra2 is UV/violet to blue. Nonactivated Dendra2 spectral characteristics are similar to EGFP, and this green fluorescence can be detected at low light intensities of blue light. At high intensities of the same blue light (or of UV/violet light) Dendra2 is photoactivated and gets emission characteristics similar to TRITC.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on the label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Dendra2-tagged proteins
Immunogen:
Dendra2 tag protein
Applications:
Immunocytochemistry (ICC), Flow cytometry (FlowCyt) (QC tested), Western blot (WB)
Nitrotyrosine can be detected in proteins from a variety of tissues, usually in association with pathological conditions. Reaction of nitric oxide with superoxide produces peroxynitrite, which can undergo heterolytic cleavage into nitronium and hydroxyl ions. Nitration of tyrosine residues by nitronium ion forms nitrotyrosine groups in the respective proteins. Nitrotyrosine is thus a marker for inflammation-associated tissue damage.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on the label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Nitrotyrosine ,Nitrotyrosine
Immunogen:
NO2-Tyr-CH2-Thyroglobulin
Applications:
Immunohistochemistry (IHC) paraffin, Iimmunohistochemistry (IHC) frozen sections, Western blot (WB)
GST-tag (glutathione S-transferase) from a parasite Schistosoma japonicum is a tag added to a protein of interest as a fusion protein for protein purification and detection. It allows purification by affinity chromatography on immobilized glutathione. GST is utilized as a fusion protein with foreign proteins in a range of prokaryotic expression vectors, including the pGEX family of vectors. The tag is 220 amino acid long, ca. 26 kDa which makes it quite large compare to Myc or FLAG tags.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on the label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
To be added when available, antibody released in October 2021.
Special application note:
This antibody is recognizing native and denatured fusion proteins containing the GST-Tag sequence expressed in E. coli, yeast, mammalian, and in vitro transcription/translation systems. It can be also used for immuno purification of GST-tagged proteins.
c-Myc is derived from Myc proto-oncogene protein. The c-Myc protein is a transcription factor (nuclear localization). c-Myc is commonly activated in a variety of tumor cells and plays an important role in cellular proliferation, differentiation, apoptosis and cell cycle progression. A short peptide was used as an epitope tag, that is easily recognized by tag specific antibodies. This is a universal detection reagent which will allow detection of any c-Myc tag containing protein.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on the label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
c-Myc tagged fusion proteins
Immunogen:
Conjugated synthetic peptide: AEEQKLISEEDLL derived from the C-terminal region of human c-Myc. UniProt: P01106
Applications:
Flow cytometry (Flowcyt), Immunohistochemistry (IHC), paraffin, Immunoprecipitation (IP), Western blot (WB)
Mouse anti-DYKDDDDK is a primary antibody which binds to DYKDDDDK (Sigma FLAG ). The small size of this tag and its high hydrophilicity decrease the probability of interference with its expression, proteolytic maturation, antigenicity, localization and function.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on the label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
DYKDDDDK (Sigma FLAG ) epitope tag
Immunogen:
KLH-conjugated synthetic peptide: DYKDDDDK (Sigma FLAG )
Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on the label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Species independent
Immunogen:
BSA-conjugated phosphotyrosine
Applications:
Immunocyto chemistry (ICC), Flowcyt (FC), Western blot (WB)
Horseradish peroxidase removes hydrogen peroxide, acts in oxidation of toxic reductants, biosynthesis and degradation of lignin, response to environmental stresses such as wounding, pathogen attack and oxidative stress. HRP is also used as an epitope tag, for protein overexpression.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on the label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Immunocytochemistry: this was successfully used for staining of formaldehyde-fixed, Triton-permeabilized cells transfected with HRP gene
Application Details:
1 g/ml (WB)
Conjugation:
IgG1
Isotype:
IgG1
Purity:
Purified by precipitation and chromatography.
Selected references:
To be added when available. Antibody released in October 2021.
Special application note:
The antibody binds horseradish peroxidase, It is suitable for preparation of PAP (Peroxidase-Anti-Peroxidase soluble complexes), where three molecules of HRP are complexed with two molecules of anti-HRP antibodies
Beta-Galactosidase is an enzyme (EC:3.2.1.23) involved in hydrolysis of terminal non-reducing beta-D-galactose residues into beta-D-galactosides. The protein is encoded by lacZ gene.Alternative names: Beta-gal, Lactase, GalB
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on the label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Escherichia coli, GalB-tagged fusion proteins
Immunogen:
beta-Galactosidase purified from E. coli. UniProt: P00722
Actin is a highly conserved protein and an essential component of cell cytoskeleton and plays an important role in cytoplasmic streaming, cell shape determination, cell division, organelle movement and extension growth. Preferentially expressed in young and expanding tissues, floral organ primordia, developing seeds and emerging inflorescence.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
This is a key enzyme of plant metabolism catalyzing the first reaction in the biosynthesis from L-phenylalanine of a wide variety of natural products based on the phenylpropane skeleton.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Nicotiana benthamiana
Expected Species:
Arabidopsis thaliana, Hibiscus syriacus, Lotus corniculatus, Solanum dulcamara, Solanum lycopersicum,Vigna unguiculata, Species of your interest not listed? Contact us
Phosphinothricin N-acetyltransferase (BAR) is an enzyme is an effector of phosphinothricin tripeptide (PTT or bialaphos) resistance, herbicide resitance gene. BAR (BASTA) gene is used as a selectable marker for genetic transformation of plants.Alternative names: PPT N-acetyltransferase, Phosphinothricin-resistance protein.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
BAR (BASTA)
Expected Species:
Streptomyces viridochromogenesSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from position 36-50 of Phosphinothricin N-acetyltransferase (BAR or BASTA), UniProt: P16426
BAR (BASTA) gene is a selectable marker of plant genetic transformation, Nada (2016). Novel recombinant binary vectors harboring Basta (bar) gene as a plant selectable marker for genetic transformation of plants. Physiol Mol Biol Plants. 2016 Apr; 22(2): 241–251.
Application Details:
1 : 1000 (WB)
Purity:
Antigen affinity purified serum, in PBS pH 7.4
Reconstitution:
For reconstitution add 50 l, of sterile or deionized water.
Molecular Weight:
20.6 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
To be added when available, antibody available in May 2023.
Phosphinothricin N-acetyltransferase (BAR) is an enzyme is an effector of phosphinothricin tripeptide (PTT or bialaphos) resistance, herbicide resitance gene. BAR (BASTA) gene is used as a selectable marker for genetic transformation of plants.Alternative names: PPT N-acetyltransferase, Phosphinothricin-resistance protein.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
BAR (BASTA)
Expected Species:
Streptomyces viridochromogenesSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from position 170-183 of Phosphinothricin N-acetyltransferase (BAR or BASTA), UniProt: P16426
BAR (BASTA) gene is a selectable marker of plant genetic transformation, Nada (2016). Novel recombinant binary vectors harboring Basta (bar) gene as a plant selectable marker for genetic transformation of plants. Physiol Mol Biol Plants. 2016 Apr; 22(2): 241–251.
Application Details:
1 : 1000 - 1: 5000 (WB)
Purity:
Antigen affinity purified serum, in PBS pH 7.4
Reconstitution:
For reconstitution add 50 l, of sterile or deionized water.
Molecular Weight:
20.6 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
To be added when available, antibody available in May 2023.
PDLP1 (Plasmodesmata-located protein 1) mediates callose deposit during fungal infection and is required for systemic acquired resistance (SAR), mediated by azelaic acid (AzA), glycerol-3-phosphate (G3P), and salicylic acid (SA). Alternative names: PD-located protein 1,Cysteine-rich repeat secretory protein 56, Plasmodesmata localizing protein 1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Saccharomyces cerevisiae Rnr1 (EC=1.17.4.1) is an enzyme from ribonucleoside diphosphate reductase large chain family. Is localized to cytoplasm and provides precursors necessary for DNA synthesis. Alternative names: ribonucleotide reductase large subunit 1, ribonucleotide reductase R1 subunit 1
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Two KLH-conjugated synthetic peptides derived from c-terminal of Saccharomyces cerevisiae Rnr1 protein, sequence UniProt: P21524
HaloTag is derived from the haloalkane dehalogenase enzyme DhaA of Rhodococcus rhodochrous and can be incorporated to a protein of interest (POI) and facilitate cellular and biochemical analysis.. HaloTag is a trademark of Promega Corporation.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Recombinant proteins with HaloTag
Expected Species:
Recombinant proteins with HaloTag
Immunogen:
KLH-conjugated peptide derived from DhaA of Rhodococcus rhodochrous, so called HaloTag .
Expression system for standard: CHO; Immunogen sequence: M1-F496
Applications:
ELISA
Additional Info:
The Quick ELISA kits, assay takes less than 1.5 hours. Detect Mouse Angiopoietin-2 with <10pg/ml sensitivity Compatible samples: cell culture supernatants, cell lysates, serum and plasma (heparin, EDTA). This is a TMB colorimetric sandwich ELISA kit with short assay time and quick experiment set up.
Biosite Brand:
BioSite ELISA
Species Reactivity:
mouse
Cross Reactivity:
There is no detectable cross-reactivity with other relevant proteins.
LEA (Late embryogenesis abundant) proteins are very hydrophilic proteins, described over 25 years ago as accumulating during late stages of plant seed development. Found in vegetative plant tissues following exposure to environmental stress.Synonymes: Putative late embryogenesis abundant protein LEA.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana (recombinant LEA6)
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana LEA6 protein sequences, UniProt: O64820, TAIR: At2g23110, UniProt: Q8S8R1 TAIR: AT2G23120 and UniProt: O23658, TAIR: AT2G33690
EGFP is an Energy-transfer acceptor. Its role is to transduce the blue chemiluminescence of the protein aequorin into green fluorescent light by energy transfer. Fluoresces in vivo upon receiving energy from the Ca(2+)-activated photoprotein aequorin. Contains a chromophore consisting of modified amino acid residues. The chromophore is formed by autocatalytic backbone condensation between Xaa-N and Gly-(N+2), and oxidation of Tyr-(N+1) to didehydrotyrosine. Maturation of the chromophore requires nothing other than molecular oxygen.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lypholized antibody at 4 °C. After reconstitution keep aliquots at -20 °C for a higher stability. Avoid repetitive freeze/thaw cycles. Centrifuge briefly to remove any insoluble material.Expiry date: 12 months after purchase if unopened
Host Animal:
Rabbit
Species Reactivity:
GFP, EGFP
Immunogen:
Recombinant GFP from Aequorea coerulescens (belt jellyfish) overexpressed and purified from E.coli, UniProt: Q6YGZ0
AKIN10 (E.C.= 2.7.11.1) is a catalytic subunit of the putative trimeric SNF1-related protein kinase (SnRK) complex, which may play a role in a signal transduction cascade regulating gene expression and carbohydrate metabolism in higher plants. Synonymes: AKIN alpha-2
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica oleracea, Brassica napus, Camelina sativa, Capsella rubella, Eutrema salsugineum, Raphanus sativusSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from C-terminal part of Arabidopsis thaliana AKIN10 sequence UniProt: Q38997, TAIR: At3g01090
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Nucleaoprotein (N) of Novel Coronavirus SARS-CoV-2/ 2019-nCoV (human) plays a fundamental role during virion assembly through packaging of the positive strand viral genome RNA into a helical ribonucleocapsid (RNP).Alternative names: NC, Protein N, Nucleocapsid protein
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80°C. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Human Nucleoprotein (N) of Novel Coronavirus SARS-CoV-2/ 2019-nCoV
Immunogen:
Recombinant Human Novel Coronavirus Nucleoprotein (N) (1-419aa), UniProt: P0DTC9
Affinity chrompatography purified in 10 mM PBS, pH 7.4, 50 % glycerol, 0.03% Proclin 300.
Molecular Weight:
48 | 55 kDa
Special application note:
This is a detection antibody, which can be combined with Capture antibody:AS21 4576 | Anti-Nucleoprotein (N) of Novel Coronavirus SARS-CoV-2/ 2019-nCoV (human), monoclonal antibodies and Positive control: AS20 4388 | Human Novel Coronavirus Nucleoprotein(N)
Nucleaoprotein (N) of Novel Coronavirus SARS-CoV-2/ 2019-nCoV (human) plays a fundamental role during virion assembly through packaging of the positive strand viral genome RNA into a helical ribonucleocapsid (RNP).Alternative names: NC, Protein N, Nucleocapsid protein
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80°C. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Human Nucleoprotein (N) of Novel Coronavirus SARS-CoV-2/ 2019-nCoV
Immunogen:
Recombinant Human Novel Coronavirus Nucleoprotein (N) (1-419aa), UniProt: P0DTC9
Affinity chrompatography purified in 10 mM PBS, pH 7.4, 50 % glycerol, 0.03% Proclin 300.
Molecular Weight:
48 | 55 kDa
Special application note:
This product is a capture antibody, which can be combined with Detection antibody: AS21 4577 | Anti-Nucleoprotein (N) of Novel Coronavirus SARS-CoV-2/ 2019-nCoV (human), monoclonal antibodiesand Positive control: AS20 4388 | Human Novel Coronavirus Nucleoprotein(N)
Based on IEP this antibody reacts with: F(ab')2 fragment of human IgG. Based on IEP no reactivity is observed to: Fc fragment of human IgGnon-immunoglobulin human serum proteinsserum proteins from bovine, horse and mouse
Application Details:
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified goat IgG.
Special application note:
Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 0.05 % (w/v) of sodium azide as preservative. It is a clear, colourless liquid, filter sterilized.Antibody purity ≥95% based on SDS-PAGE.
Based on IEP this antibody reacts with: F(ab')2 fragment of human IgG. Based on IEP no reactivity is observed to: non-immunoglobulin human serum proteinsFc fragment of human IgG
Application Details:
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified goat IgG.
Special application note:
Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 0.05 % (w/v) of sodium azide as preservative. It is a clear, colourless liquid, filter sterilized.Antibody purity ≥95% based on SDS-PAGE.
The Alzheimer amyloid precursor protein (APP) is a transmembrane protein whose abnormal processing is associated with the pathogenesis of Alzheimer’s disease. APP695 lacking the protease inhibitor domain is the predominant form in neuronal tissues. APP695 is cleaved by caspases into the 664-residue amino (N)-terminal fragment that lacks the carboxyl C-terminal 31-residues (APP delataC31) and the 31-residues C-terminal fragment (APP-C31). APP delta C31 potentially plays pathophysiological roles in neuronal death.
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Human, mouse, rat
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide corresponding to the C-terminal of the caspase 3-cleaved human APP (aa 658-664 of human APP695) UniProt: P05067
Applications:
ELISA (ELISA), Immunolocalisation (IL), Western blot (WB)
Nishimura et al (2003). Upregulation and antiapoptotic role of endogenous Alzheimer amyloid precursor protein in dorsal root ganglion neurons. Exp Cell Res. 2003 Jun 10;286(2):241-51. doi: 10.1016/s0014-4827(03)00066-1. PMID: 12749853.Nishimura et al. (2002) Cell death induced by a caspase-cleaved transmembrane fragment of the Alzheimer amyloid precursor protein. Cell Death Differ. 2002 Feb;9(2):199-208. doi: 10.1038/sj.cdd.4400931. PMID: 11840170.
The Alzheimer Amyloid Precursor Protein (APP) is a transmembrane protein whose abnormal processing is associated with the pathogenesis of Alzheimer’s disease. APP695 lacking the protease inhibitor domain is the predominant form in neuronal tissues. APP695 is cleaved by caspases into the 664-residue amino (N)-terminal fragment that lacks the carboxyl C-terminal 31-residues (APPC31) and the 31-residues C-terminal fragment (APP-C31). Both fragments might be potent inducers of neuronal apoptosis. An antibody (named ACT1) against the N-terminus of caspase 3-generated APP C-terminal 31 aa of human APP695 (APP-C31 ) was raised in rabbit.
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Human, Mouse, Rat
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Synthetic peptide corresponding to the N-terminal of human caspase 3-generated APP C-terminal 31 amino acids (aa 665-670) UniProt: P05067
Applications:
ELISA (ELISA), Immunolocalisation (IL), Western blot (WB)
Nishimura et al. (2002) Cell death induced by a caspase-cleaved transmembrane fragment of the Alzheimer amyloid precursor protein. Cell Death Differ. 2002 Feb;9(2):199-208. doi: 10.1038/sj.cdd.4400931. PMID: 11840170.
Caspases are a family of cysteine proteases which play essential roles in apoptosis. Among them, Caspase 3 is a frequently activated death protease, catalyzing the specific cleavage of many key cellular proteins. Caspase 3 is synthesized as an inactive 32 kDa pro-enzyme which undergo proteolytic processing in response to apoptotic stimulation to produce the active form which consists of the p20/p17, and p12 subunits. Caspase 3 is the predominant caspase involved in the cleavage of Alzheimer amyloid precursor protein (APP), which is associated with neuronal death in Alzheimer ‘s disease. An antibody (named ACP3) against activated caspase 3 was raised in rabbit. This antibody recognizes the active form of human caspase 3, p20/p17 subunit but does not recognize the proenzyme p32.
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Human, Mouse and Rat
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide corresponding to the human caspase 3 cleavage site, 6 aa (CGIETD) UniProt: P42574
Applications:
ELISA (ELISA), Immunolocalisation (IL), Western blot (WB)
The antibody does not react with the proenzyme p32
Application Details:
1: 500 - 1: 1000 (IL), 1:3000-1:1000 (WB)
Purity:
Serum. Contains 0.05 % sodium azide.
Molecular Weight:
31,6 | 17 and 19 kDa
Selected references:
Nishimura et al (2003). Upregulation and antiapoptotic role of endogenous Alzheimer amyloid precursor protein in dorsal root ganglion neurons. Exp Cell Res. 2003 Jun 10;286(2):241-51. doi: 10.1016/s0014-4827(03)00066-1. PMID: 12749853.Nishimura et al. (2002) Cell death induced by a caspase-cleaved transmembrane fragment of the Alzheimer amyloid precursor protein. Cell Death Differ. 2002 Feb;9(2):199-208. doi: 10.1038/sj.cdd.4400931. PMID: 11840170.
Glyoxalase I (GLO1) is an enzyme that plays a role in the detoxification of methylglyoxal (MG), a side-product of glycolysis, via condensation with glutathione to produce S-lactoyl-glutathione. GLO1 is a zinc metalloenzyme whose crystal structure has been solved. The bacterial and yeast enzymes are monomeric while the mammalian one is homodimeric and its sequence is well conserved. GLO1 is found over-expressed in some tumors. GLO1 has also been suggested to be involved in anxiety diseases, autism, and Alzheimer’s disease.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rat
Species Reactivity:
Human, simian, mouse
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Recombinant, full length mouse GLO1 UniProt: Q9CPU0 fused to GST
Applications:
ELISA (ELISA), Immunofluorescence (IF), Western blot (WB)
Jiang et al. (2018). Role of the Glyoxalase System in Alzheimer's Disease. J Alzheimers Dis. 2018;66(3):887-899. doi: 10.3233/JAD-180413. PMID: 30400091.Hovatta et al. (2005) Glyoxalase 1 and glutathione reductase 1 regulate anxiety in mice. Nature. 2005 Dec 1;438(7068):662-6. doi: 10.1038/nature04250. Epub 2005 Oct 23. PMID: 16244648.Junaid et al. (2004) Proteomic studies identified a single nucleotide polymorphism in glyoxalase I as autism susceptibility factor. Am J Med Genet A. 2004 Nov 15;131(1):11-7. doi: 10.1002/ajmg.a.30349. PMID: 15386471; PMCID: PMC1360505.
CALS12/PMR4 (Callose synthase 12) is involved in sporophytic and gametophytic development and required for normal leaf development and callose formation induced by wounding and pathogen attack. Alternative names: 1,3-beta-glucan synthase, Protein GLUCAN SYNTHASE-LIKE 5, Protein POWDERY MILDEW RESISTANT 4.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Capsella rubella, Camelina sativa, Eutrema salsugineum, Brassica napus, Brassica oleracea, Brassica rapa, Tarenaya hasslerianaSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana CALS12 protein sequence, UniProt: Q9ZT82 , TAIR: At4g03550
PhyB (Phytochrome B) is a Red/far-red photoreceptor involved in the regulation of de-etiolation. Protein exists in two inter-convertible forms: Pr and Pfr (active). Involved in the light-promotion of seed germination and in the shade avoidance response. Alternative names: Protein LONG HYPOCOTYL 3, Protein OUT OF PHASE 1, OOP1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Arabis alpina, Camelina sativa, Capsella rubella, Brassica napus, Brassica oleracea, Eutrema salsugineum, Raphanus sativusSpecies of your interest not listed? Contact us
DNA methylation is a type of chemical modification of DNA that can be inherited and subsequently removed without changing the original DNA sequence. Therefore it is part of the epigenetic code and is also the most well characterized epigenetic mechanism. DNA methylation results in addition of a methyl group to DNA — for example, to the number 5 carbon of the cytosine pyrimidine ring — which involves reduction in gene expression. In adult somatic tissues, DNA methylation typically occurs in a CpG dinucleotide context; non-CpG methylation is prevalent in embryonic stem cells.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
DNA methylation is a type of chemical modification of DNA that can be inherited and subsequently removed without changing the original DNA sequence. Therefore it is part of the epigenetic code and is also the most well characterized epigenetic mechanism. DNA methylation results in addition of a methyl group to DNA — for example, to the number 5 carbon of the cytosine pyrimidine ring — which involves reduction in gene expression. In adult somatic tissues, DNA methylation typically occurs in a CpG dinucleotide context; non-CpG methylation is prevalent in embryonic stem cells.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Purified IgM in PBS. Contains 50 % glycerol, filter sterilized.
Selected references:
Sharif et al. (2007) The SRA protein Np95 mediates epigenetic inheritance by recruiting Dnmt1 to methylated DNA. Nature. 2007 Dec 6;450(7171):908-12. doi: 10.1038/nature06397. Epub 2007 Nov 11. PMID: 17994007.Nishiyama et al. (2002) A chloroplast-resident DNA methyltransferase is responsible for hypermethylation of chloroplast genes in Chlamydomonas maternal gametes. Proc Natl Acad Sci U S A. 2002 Apr 30;99(9):5925-30. doi: 10.1073/pnas.082120199. PMID: 11983892; PMCID: PMC122878.Sano, Imokawa & Sager (1988) Detection of heavy methylation in human repetitive DNA subsets by a monoclonal antibody against 5-methylcytosine. Biochim Biophys Acta. 1988 Nov 10;951(1):157-65. doi: 10.1016/0167-4781(88)90036-x. PMID: 2847796.Sano, Royer & Sager (1980) Identification of 5-methylcytosine in DNA fragments immobilized on nitrocellulose paper. Proc Natl Acad Sci U S A. 1980 Jun;77(6):3581-5. doi: 10.1073/pnas.77.6.3581. PMID: 6251470; PMCID: PMC349661.
In the eukaryotic cells, DNA is packaged repetitively into nucleosomes by means of interactions among two molecules of four classes of histone, H2A, H2B, H3 and H4. Each of the histone proteins has an evolutionarily conserved amino-terminal ‘tail’ that protrudes from the nucleosome. This tail is the target of numerous diverse signaling pathways, resulting in the addition of many post-translational modifications. These modifications include phosphorylation, acetylation, methylation, ADP-ribosylation and mono-ubiquitination. Many important new modifications within the structured core and the carboxy-terminal tail regions of histones are also being identified. It is becoming increasingly clear that these modifications represent crucial regulatory events that govern the accessibility and function of the genome.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
ChIP method for this antibody is described in Maruyama et al. (2006).
Application Details:
1 : 1000 (WB)
Purity:
Serum. Contains 0.05 % sodium azide.
Molecular Weight:
13,8 | 17, 24-25 kDa (unmodified and mono-ubiquinated H2B)
Selected references:
Maruyama et al (2006). Histone H2B mutations in inner region affect ubiquitination, centromere function, silencing and chromosome segregation. EMBO J. 2006 Jun 7;25(11):2420-31. doi: 10.1038/sj.emboj.7601110. Epub 2006 May 11. PMID: 16688222; PMCID: PMC1478186.
Tubulin is the major constituent of microtubules. There are three members (alpha, beta and gamma) and two subtypes in the tubulin family. Of these members, beta tubulin (449 aa, 51 kDa) is found at microtubule organizing centers (MTOC) such as the spindle poles or the centrosome, suggesting that it is involved in the minus-end nucleation of microtubule assembly during cell cycle.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Schizosaccharomyces pombe
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated C-terminal peptide C-YEIEEEKEPLEY-OH from beta tubulin of Schizosaccharomyces pombe, UniProt: P05219
Applications:
ELISA (ELISA), Immunofluorescence (IF), Western blot (WB)
Immunogen affinity purified serum in PBS and 50 % glycerol, filter sterilized.
Molecular Weight:
51 | 45 kDa
Selected references:
Fedyanina et al. (2009) Tubulin heterodimers remain functional for one cell cycle after the inactivation of tubulin-folding cofactor D in fission yeast cells. Yeast. 2009 Apr;26(4):235-47. doi: 10.1002/yea.1663. PMID: 19330768; PMCID: PMC5705012.
Rad22 protein of Schizosaccharomyces pombe (469 aa, 52 kDa) is a functional and structural homologue of Saccharomyces cerevisiae and human Rad52 proteins, which play a major role together with Rhp51 in genetic recombination and recombination repair, by mediating strand annealing reaction between homologous DNA strands.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces pombe
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Purified, full length, recombinant Rad22 protein from Saccharomyces cerevisiae, UniProt: P36592 overexpressed in E. coli
Applications:
ELISA (ELISA), Immunofluorescence (IF), Immunoprecipiatation (IP), Western blot (WB)
Lehmann (1996). Molecular biology of DNA repair in the fission yeast Schizosaccharomyces pombe. Mutat Res. 1996 Aug 8;363(3):147-61. doi: 10.1016/0921-8777(96)00017-1. PMID: 8765156.
Rhp51 protein of Schizosaccharomyces pombe (fission yeast) is a functional and structural homolog of E.coli RecA protein and Rad51 proteins of eukaryotes, which play a major role in genetic recombination and recombination repair by mediating strand exchange reaction between homologous DNA strands.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces pombe
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Purified, full length, recombinant Rhp51 protein from Saccharomyces pombe, UniProt: P36601
Applications:
Chromatin immunoprecipitation (ChIP), Immunoprecipitation (IP),Immunofluorescence (IF), Western blot (WB)
Akamatsu et al. (2007) Fission yeast Swi5/Sfr1 and Rhp55/Rhp57 differentially regulate Rhp51-dependent recombination outcomes. EMBO J. 2007 Mar 7;26(5):1352-62. doi: 10.1038/sj.emboj.7601582. Epub 2007 Feb 15. PMID: 17304215; PMCID: PMC1817630.Lambert et al. (2005). Gross chromosomal rearrangements and elevated recombination at an inducible site-specific replication fork barrier. Cell. 2005 Jun 3;121(5):689-702. doi: 10.1016/j.cell.2005.03.022. PMID: 15935756. (Immunoflourescence)Akamatsu et al. (2003) Two different Swi5-containing protein complexes are involved in mating-type switching and recombination repair in fission yeast. Proc Natl Acad Sci U S A. 2003 Dec 23;100(26):15770-5. doi: 10.1073/pnas.2632890100. Epub 2003 Dec 8. PMID: 14663140; PMCID: PMC307643. (Immunoprecipitation, Western Blot)Kibe et al. (2003). Fission yeast Rhp51 is required for the maintenance of telomere structure in the absence of the Ku heterodimer. Nucleic Acids Res. 2003 Sep 1;31(17):5054-63. doi: 10.1093/nar/gkg718. PMID: 12930956; PMCID: PMC212814. (ChIP)
This protein is an auxiliary protein of DNA polymerase delta and is involved in the control of eukaryotic DNA replication by increasing the polymerase's accessibility during elongation of the leading strand. Involved in DNA repair and recombination.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C and avoid temperature below -25°C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Recombinant PCNA protein from Saccharomyces cerevisiae, UniProt: P15873
Applications:
Chromatin immunoprecipitation (ChIP), Inmunoprecipitation (IP), Western blot (WB)
Subunit of heterotrimeric Replication Protein A (RPA); RPA is a highly conserved single-stranded DNA binding protein complex involved in DNA replication, repair, recombination; RPA protects against inappropriate telomere recombination, and upon telomere uncapping, prevents cell proliferation by a checkpoint-independent pathway; with Sgs1p-Top2p-Rmi1p, stimulates DNA catenation/decatenation activity of Top3p; protein abundance increases in response to DNA replication stress.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Recombinant Rfa3 protein from Saccharomyces cerevisiae, UniProt: P26755
Rfa1 (Replication Factor A protein 1) as part of the replication protein A (RPA/RP-A), a single-stranded DNA-binding heterotrimeric complex, may play an essential role in DNA replication, recombination and repair. Binds and stabilizes single-stranded DNA intermediates, preventing complementary DNA reannealing and recruiting different proteins involved in DNA metabolism. Binds to single-stranded sequences participating in DNA replication in addition to those mediating transcriptional repression (URS1) and activation (CAR1). Stimulates the activity of a cognate strand exchange protein (SEP1). It cooperates with T-AG and DNA topoisomerase I to unwind template DNA containing the simian virus 40 origin of DNA replication.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Purified, recombinant Rfa1 protein (without a tag) from Saccharomyces cerevisiae, UniProt: P22336
S. cerevisiae Rad 51 protein (400 aa, 43 kDa) is a functional and structural homolog of E.coli RecA and human Rad51 proteins and plays a central role in DNA homologous recombination and recombination repair by promoting homologous DNA strand exchange reaction. Dmcl, Rad55, Rad57 are paralogs of Rad51 and they form complex with Rad51 and Rad52 in mediating recombination processes.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Purified, full length, recombinant and HIS tagged RAD51 protein from Saccharomyces cerevisiae, UniProt: P25454
Applications:
ELISA (ELISA), Chromatin immunoprecipitation (ChIP), Immunofluorescence (IF), Immunoprecipitation (IP), Western blot (WB)
Cyclobutane Pyrimidine Dimer photolyase (Deoxyribodipyrimidine photo-lyase) is involved in repair of UV radiation-induced DNA damage. Catalyzes the light-dependent monomerization (300-600 nm) of cyclobutyl pyrimidine dimers (in cis-syn configuration), which are formed between adjacent bases on the same DNA strand upon exposure to ultraviolet radiation. Upon absorption of visible light electrons are transferred from Trp-307 through Trp-360 to Trp 383, and from there to FADH, giving rise to the fully reduced catalytic FADH .
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Purified, full length, recombinant DNA photolyase protein from E.coli, UniProt: P00914
Applications:
ELISA (ELISA), Immunoprecipitation (IP), Western blot (WB)
E. coli DNA polymerase 1 (928 aa; 103 kDa) is encoded by polA gene and involved in DNA replication and repair. In addition to polymerase activity, this DNA polymerase exhibits 3' to 5' and 5' to 3' exonuclease activity. It is able to utilize nicked circular duplex DNA as a template and can unwind the parental DNA strand from its template.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Purified, full length, recombinant POL I protein from E.coli, UniProt: P00582
The products of umuD , umuC , and recA genes (SOS genes) are required for mutagenesis induced by radiation or chemical agents. Transcription of these SOS genes is repressed by a repressor, LexA protein in uninduced cells. Exposure of cells to DNA-damaging agents activates RecA protein to promote proteolytic cleavage of LexA protein. Inactivation of LexA protein by the cleavage consequently derepresses the SOS genes, umuD, C and recA . UmuD protein is then auto-cleaved, which is promoted by RecA protein ssDNA in a ATP-dependent manner. The processed UmuD protein is the active form for mutagenesis and the UmuD-UmuC complex functions as an error-prone translesion DNA polymerase.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C and make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Immunogen:
Highly purified, full length, recombinant UmuD protein from E.coli, UniProt: P0AG11
Shinagawa et al. (1998). RecA protein-dependent cleavage of UmuD protein and SOS mutagenesis. Proc Natl Acad Sci U S A. 1988 Mar;85(6):1806-10. doi: 10.1073/pnas.85.6.1806. PMID: 3126496; PMCID: PMC279868.
E. coli RuvC protein (19 kDa) is a structurally specific endonuclease which binds specifically to the Holliday structure, an intermediate of recombination, at the late stage of homologous recombination and recombination repair and introduces a nick in the symmetrical point of the Holliday junction cleaving and resolving the recombinant.
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at -20 °C or -80°Cfor a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
RuvC protein is full length, highly purified (over 95 %, SDS-PAGE), recombinant without a tag at a concentration of 1 mg/ml (determined by BCA method). UniProt: P0A814
Purity:
Contans 50% glycerol, 10 mM Tris-HCl (pH 7,5), 2 mM EDTA, 100 mM NaCl, 5 mM mercaptoethanol. Over 95 % pure by SDS-PAGE.
Molecular Weight:
18,7 | 19 kDa
Selected references:
Shinagawa & Iwasaki (1996). Processing the holliday junction in homologous recombination. Trends Biochem Sci. 1996 Mar;21(3):107-11. PMID: 8882584.Iwasaki et al. (1991) Escherichia coli RuvC protein is an endonuclease that resolves the Holliday structure. EMBO J. 1991 Dec;10(13):4381-9. PMID: 1661673; PMCID: PMC453191.
Special application note:
This product can be used in:in vitro functional studies. RuvC cleaves recombination intermediate at Holiday JunctionAs a positive control in Western blot and standard in ELISA.
For the development of sandwich ELISA kit to measure mouse CXCL4/PF4 in cell culture supernatants, cell lysates, tissue homogenates, serum and plasma (heparin, EDTA).
Product Type:
Antibodies Primary
Storage Temp:
-20°C
Immunogen:
Expression system for standard: E.coli; Immunogen sequence: V30-S105
Applications:
ELISA
Additional Info:
For the development of sandwich ELISA kit to measure mouse CXCL4/PF4 in cell culture supernates, cell lysates, tissue homogenates, serum and plasma (heparin, EDTA).
Biosite Brand:
BioSite ELISA
Species Reactivity:
mouse
Cross Reactivity:
There is no detectable cross-reactivity with other relevant proteins.
E. coli RuvC protein is a structurally specific endonuclease which binds specifically to the Holliday structure, an intermediate of recombination, at the late stage of homologous recombination and recombination repair and introduces nicks at the symmetrical points of the Holliday junction, cleaving and resolving the recombinant.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 6 monthss, afterwards at -80 C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Immunogen:
Purified, full length, recombinant RuvC protein from E.coli, UniProt: P0A814
Ichiyanagi et al. (1998). Mutational analysis on structure-function relationship of a holliday junction specific endonuclease RuvC. Genes Cells. 1998 Sep;3(9):575-86. doi: 10.1046/j.1365-2443.1998.00213.x. PMID: 9813108.Shinagawa & Iwasaki (1996). Processing the holliday junction in homologous recombination. Trends Biochem Sci. 1996 Mar;21(3):107-11. PMID: 8882584.Saito et al (1995). Identification of four acidic amino acids that constitute the catalytic center of the RuvC Holliday junction resolvase. Proc Natl Acad Sci U S A. 1995 Aug 1;92(16):7470-4. doi: 10.1073/pnas.92.16.7470. PMID: 7638215; PMCID: PMC41361.
E. coli RuvB protein forms a complex with RuvA protein at the late stage of homologous recombination and recombination repair and binds specifically to the Holliday structure which is the intermediate of recombination, allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region.
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at -20 °C or -80°Cfor a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
RuvB protein is full length, highly purified (over 95 %, SDS-PAGE), recombinant. UniProt: P0A812
Purity:
Contans 50% glycerol, 10 mM Tris-HCl (pH 7,5), 2 mM EDTA, 100 mM NaCl, 5 mM mercaptoethanol. Over 95 % pure by SDS-PAGE.
Molecular Weight:
37 kDa
Selected references:
Mazina et al. (2012) Polarity and bypass of DNA heterology during branch migration of Holliday junctions by human RAD54, BLM, and RECQ1 proteins. J Biol Chem. 2012 Apr 6;287(15):11820-32. doi: 10.1074/jbc.M112.341347. Epub 2012 Feb 22. PMID: 22356911; PMCID: PMC3320930.Han et al. (2006). Direct observation of DNA rotation during branch migration of Holliday junction DNA by Escherichia coli RuvA-RuvB protein complex. Proc Natl Acad Sci U S A. 2006 Aug 1;103(31):11544-8. doi: 10.1073/pnas.0600753103. Epub 2006 Jul 24. PMID: 16864792; PMCID: PMC1544206.Iwasaki et al. (1992) Escherichia coli RuvA and RuvB proteins specifically interact with Holliday junctions and promote branch migration. Genes Dev. 1992 Nov;6(11):2214-20. doi: 10.1101/gad.6.11.2214. PMID: 1427081.
Special application note:
This product can be used in:in vitro functional studies. RuvA and RuvB are forming a complex that promotes Holiday junction ( a recombination intermediate) branch-migration by using ATP hydrolysis energy.As a positive control in Western blot and standar in ELISA.
RuvB protein of Escherichia coli forms a complex with RuvA protein and the complex promotes branch migration of Holliday junction at the late stage of homologous recombination and recombination repair. RuvB is a DNA motor protein which possesses the ATPase activity, activated by DNA and RuvA protein. RuvB in the absence of ATP, it predominantly occurs in a monomer form. In the presence of ATP, it forms dimer and hexamer depending upon the concentration. With RuvA and Holliday junction., it forms a double hexamer.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor up to 6 monthss, afterwards at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Immunogen:
Purified, full length, recombinant RuvB protein from E.coli, UniProt: P0A812
RuvA protein of Escherichia coli binds specifically to the Holliday structure which is the intermediate of recombination at the late stage of homologous recombination and recombination repair and forms a complex with RuvB motor protein allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region. In solution, it forms a tetramer and binds to the cross-like DNA of the Holliday junction from below and above holding it in between.
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at 4°Cor -20 °C for a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
RuvA protein is full length, highly purified (over 90 %, SDS-PAGE). UniProt: P0A809
Purity:
Contains 50% glycerol, 10 mM Tris-HCl (pH 7,5), 2 mM EDTA, 100 mM NaCl, 5 mM mercaptoethanol. Over 90 % pure by SDS-PAGE.
Molecular Weight:
22 kDa (monomer)
Selected references:
Han et al. (2006). Direct observation of DNA rotation during branch migration of Holliday junction DNA by Escherichia coli RuvA-RuvB protein complex. Proc Natl Acad Sci U S A. 2006 Aug 1;103(31):11544-8. doi: 10.1073/pnas.0600753103. Epub 2006 Jul 24. PMID: 16864792; PMCID: PMC1544206.Iwasaki et al. (1992) Escherichia coli RuvA and RuvB proteins specifically interact with Holliday junctions and promote branch migration. Genes Dev. 1992 Nov;6(11):2214-20. doi: 10.1101/gad.6.11.2214. PMID: 1427081.
Special application note:
This product can be used in functional studies as Holliday junction specific binding protein, which promotes Holliday-junction branch migration in combination with RuvB protein
RuvA protein of Escherichia coli binds specifically to the Holliday structure which is the intermediate of recombination at the late stage of homologous recombination and recombination repair, and forms a complex with RuvB motor protein, allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region. In solution, it forms a tetramer and binds to the cross-like DNA of the Holliday junction from below and above, holding it in between
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor up to 6 monthss, for longer storage-80°Cis recommended; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Immunogen:
Purified, full length RuvA protein of Escherichia coli, UniProt: P0A809
E. coli RecA protein is a very important enzyme for homologous recombination and recombinational repair. Its synthesis is induced by SOS response caused by DNA damage. RecA protein has multiple functions such as single stranded DNA dependent ATPase activity, DNA annealing activity, formation of D-loop and Holliday structure in homologous recombination reaction, and coprotease activities that promote self-cleavages of LexA repressor, lambda phage repressor and UmuD protein. RecA protein binds to single and double stranded DNA for nucleofilament formation. It carries out a central role in homologous recombination.
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at -20 °C or -80°Cfor a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
RecA protein is full length, highly purified (over 90 %, SDS-PAGE) by several steps of chromatography. Provided at a concentration of 1 mg/ml estimated by BCA method. UniProt: P0A7G6
Purity:
Contains 50% glycerol, 20 mM Tris-HCl (pH 8), 1 mM EDTA, 150 mM KCl, 1 mM DTT. Over 90 % pure, by SDS-PAGE
Molecular Weight:
38 kDa
Selected references:
Ishibashi, Oura S & Umemura (2017) Adsorption of DNA binding proteins to functionalized carbon nanotube surfaces with and without DNA wrapping. Eur Biophys J. 2017 Sep;46(6):541-547. doi: 10.1007/s00249-017-1200-3. Epub 2017 Feb 15. PMID: 28204854.Oura et al. (2015) Biomolecular recognition ability of RecA proteins for DNA on single-walled carbon nanotubes. Colloids Surf B Biointerfaces. 2015 Feb 1;126:496-501. doi: 10.1016/j.colsurfb.2015.01.002. Epub 2015 Jan 10. PMID: 25612818.
RecA (Recombinase A) plays critically important roles in homologous recombination, recombination repair and regulation of cellular responses to DNA damage (SOS response). RecA promotes auto-cleavage of LexA repressor by its coprotease activity after DNA damage, and induces many proteins related to DNA repair including RecA itself.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Immunogen:
Hihgly purified, full length (352 amino acids) RecA protein of E.coli, UniProt: P0A7G6
Applications:
ELISA (ELISA), Indirect immunofluorescent (IF), Immunoprecipitation (IP), Western blot (WB)
Escherichia coli LexA protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA). LexA‘s self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As a result, the expression of genes belonging to the S
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at -20 °C or -80°Cfor a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
LexA protein is full length, highly purified (over 90 %, SDS-PAGE) provided at a concentration of 1 mg/ml estimated by BCA method. UniProt: P0A7C2
Purity:
Contains 50% glycerol, 10 mM Tris-HCl (pH 7,5), 2 mM EDTA, 100 mM NaCl, 1 mM DTT. Over 90 % pure by SDS-PAGE.
Molecular Weight:
22,3 | 23 kDa
Special application note:
This product can be used in:Functional studies of E.coli SOS response. This product will bind to SOS box in vitro and repress the expression of the genes belonging to SOS regulationWestern blot as a positive control, to confirm that the bait construct is expressed in yeast two-hybrid sstem using lexA genecontrol in ChIP in combination with anti-LexA antibodies
LexA represor binds specifically to the SOS-box sequence and represses the genes belonging to the SOS regulation. In response to DNA damage, RecA protein is activated by ss-DNA accumulated in the damaged cells and promotes autocleavage of LexA repressor by its coprotease activity. As a result, DNA repair genes and error prone polymerases are induced, and DNA damage is repaired and mutation is induced (1). The lexA gene is used for yeast two-hybrid experiments as a bait to identify the protein-protein interaction in vivo.Alternative names: exrA, spr, tsl, umuA
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Hishida et al (2004) Role of the Escherichia coli RecQ DNA helicase in SOS signaling and genome stabilization at stalled replication forks. Genes Dev. 2004 Aug 1;18(15):1886-97. doi: 10.1101/gad.1223804. PMID: 15289460; PMCID: PMC517408.
Special application note:
This product can be used in:studies of SOS regulation in E.coli detection of bait constructs in yeast two-hybrid systemimmunolocalization of LexA fusion proteins (fixed with 4 % formaldehyde)immunoprecipiation and ChIP
Alternative oxidases (AOX) are quinol oxidases located in the inner mitochondrial membrane of plants. They function as terminal oxidases in the alternate electron transport pathway, oxidizing ubiquinone to reduce oxygen to water.
Product Type:
Antibody
Antibody Type:
Polyclonal
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from Arabidopsis thaliana AOX2 protein sequence, UniProt: O22049 , TAIR: At5g64210
Cat2 (Catalase 2) is an enzyme which occurs in almost all aerobically respiring organisms and serves to protect cells from the toxic effects of hydrogen peroxide.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
The anti-Myc tag is a primary antibody which is used to detect proteins containing the Myc epitope tag. The Myc tag contains the amino acid sequence EQKLISEEDL, corresponding to amino acids 410-419 of human Myc.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Myc epitope tag, fused to N- or C-terminal of proteins
Immunogen:
KLH-conjugated synthetic peptide: EQKLISEEDL (Myc tag), derived from UniProt: Q6LBK7
The two Arabidopsis POLLUX-like homologs PEC1 and PEC2 represent plastid envelope membrane cation channels with K + conductivity that are required for the stress triggered Ca 2+ release into the stroma.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Camelina sativa, Capsella rubella, Nicotiana benthamiana, Noccaea caerulescens, Pisum sativum, Raphanus sativus, Species of your interest not listed? Contact us
Immunogen:
The soluble domain 466 (M244 until stop codon, ≈ 64 kDa) was cloned into pET16b and transformed into BLR 21 for 467 expression in Escherichia coli UniProt: Q8VZM7-1, TAIR: At5g02940
V lkner et al (2021) Two plastid POLLUX ion channel-like proteins are required for stress-triggered stromal Ca2+release, Plant Physiology, Volume 187, Issue 4, December 2021, Pages 2110–2125, https://doi.org/10.1093/plphys/kiab424
Special application note:
This antibody is recognizing PEC1, but not PEC2 or DMI1
Strep-tag II is a synthetic peptide consisting of eight amino acids (Trp-Ser-His-Pro-Gln-Phe-Glu-Lys) and this peptide sequence shows high affinity towards Strep-Tactin , a specifically engineered streptavidin, and can be N- or C- terminally fused to recombinant proteins.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Strep-tag II-proteins
Immunogen:
KLH-conjugated synthetic peptide Strep-tag II epitope tag, sequence: ASWSHPQFEKGA
mNeonGreen (Fluorescent Protein) is a new bright monomertic yellow-green fluorescent, with low conservation level to GFP. It has an excitation maximum at 506 nm and an emission maximum at 517 nm and therefore is compatible with the most GFP filter sets. mNeonGreen is 3x brighter compare to GFP, more stable and does not bleach so fast as GFP, which makes it very suitable for confocal and super resolution microscopy, for fusion proteins with low expression levels. It can be used in bicistronic vectors, which will allow simultaneous expression of two proteins separately, from the same RNA transcript. mNeonGreen has MW of 26.6 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
mNG tag in plant (Arabidopsis thaliana) and algal vectors (Chlamydomonas reinhardtii)
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from synthetic peptide, UniProt: A0A1S4NYF2 from common lancelet Branchiostoma lanceolatum
This antibody is detecting protein sequence of mNG tag in plant and algal vectors.This antibody is also reacting to some degree with YFP and mCherry.
Application Details:
1 g/1ml (IF), 1 : 1000 - 1: 5000 (WB)
Purity:
Immunogen affinity purified serum, in PBS pH 7.4.
Reconstitution:
For reconstitution add 50 l, of sterile water.
Molecular Weight:
Depends upon used fusion partner
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known.
Selected references:
To be added when available, antibody available in November 2021.
Special application note:
The peptide used to elicit this antibody is conserved in the following expression vectors: dCas9-P2A-DHFR(TSc3)-T2A-mNeonGreen [Cloning vector pBM020]Cas9-P2A-DHFR(TSc3)-T2A-mNeonGreen [Cloning vector pBM006]mNeonGreen4-tDeg [Cloning vector pminiCMV-mNeonGreen4-tDeg]ER-localized mNEONGREEN [Binary vector pKT-NM-erNEON]mNeonGreen-3xFLAG [Cloning vector pLM160-mNeonGreen]mNeonGreen-ty1 [Cloning vector pSAG1-mNeonGreen_TUB1-dTomato]mNeonGreen, partial [Binary vector pRATIO2131]The peptide used to elicit this antibody is not conserved in GFP protein sequence. Antibody is also recognzing mCheery sequence.
HSP23.5 (Heat shock protein 23.5 (mitochondrial) is involved in plant heat shock response.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
MnSOD3 (Superoxide dismutase) is an chloroplastic enzyme which destroys radicals which are normally produced within the cells and which are toxic to biological systems. It is induced under Fe limitation, Mn Deficiency, and H2O2 stress as shown by Page et al. (2012).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii
Expected Species:
green algaeSpecies of your interest not listed? Contact us
Immunogen:
Recombinant MnSOD3 of Chlamydomonas reinhardtii, product of a MSD3 gene Cre16.g676150; Phytozome
Specific extraction method requires to be applied, check as published in Page et al. (2012).MnSOD3 can be only detected in Fe-limited cells (0.5 or 0.2 mM added Fe) (i.e., samples exhibiting the novel MnSOD activity) but not in cells grown with higher concentrations of added Fe.
Application Details:
1: 1000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
32 | 35 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Page et al. (2012) Fe sparing and Fe recycling contribute to increased superoxide dismutase capacity in iron-starved Chlamydomonas reinhardtii. Plant Cell. 2012 Jun;24(6):2649-65. doi: 10.1105/tpc.112.098962. Epub 2012 Jun 8. PMID: 22685165; PMCID: PMC3406916.
VSP (Vegetative storage protein 1) may function as somatic storage protein during early seedling development. Expression of VSP1 is enhanced by wounding and protein is localized to vacuole.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Full length, purified recombinant His6-tagged VSP1 of Arabidopsis thaliana UniProt: O49195, TAIR: At5g24780
Reactivity of this antibody to VSP2 has not been determined, Sequence conservation of VSP1 and VSP2 is 86 % therefore, it is most likely that this antibody will also recognize VSP2,
Application Details:
1: 1000 - 1: 2000 (WB)
Purity:
Total IgG, purified on Protein A in PBS, 50 % glycerol, filter sterilized.
Molecular Weight:
28 | 27 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Matsushima et al. (2002). An endoplasmic reticulum-derived structure that is induced under stress conditions in Arabidopsis.Plant Physiol. 2002 Dec;130(4):1807-14. doi: 10.1104/pp.009464.
Arabidopsis thaliana auxin efflux carrier component AtPIN2 encoded by the AtPIN2 gene (also known as EIR1 and AGR1). AtPIN proteins are asymmetrically localized within plant plasma membranes and mediate polar auxin transport. AtPIN2 is a key regulator of the response of Arabidopsis roots to gravity. Alternative names: Auxin efflux carrier AGR, Ethylene-insensitive root 1, AtEIR1, Polar-auxin-transport efflux component AGR1, Protein AGRAVITROPIC 1, AtAGR1, Protein WAVY 6.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Beta vulgaris, Brassica napus, Camelina sativa, Cannabis sativa, Capsella rubella, Cucumis melo, Eucalyptus grandis, Eutrema salsugineum, Glycine max, Malus domestica, Morus notabilis, Prunus dulcis, Raphanus sativus, Spinacia oleracea, Vitis vinifera Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated mixture of two synthetic peptides derived from AtPIN2 sequence, UniProt:Q9LU77, TAIR:At5g57090
Beta-galactosidase is an exoglycosidase which hydrolyzes the β-glycosidic bond formed between agalactose and its organic moiety. It may also cleave fucosides and arabinosides but with much lower efficiency. It is an essential enzyme in the human body. Deficiencies in the protein can result ingalactosialidosis or Morquio B syndrome. In E. coli , the gene of β-galactosidase, the lacZ gene, is present as part of the inducible system lac operon which is activated in the presence of lactose when glucose level is low. It is commonly used in molecular biology as a reporter marker to monitor gene expression. It also exhibits a phenomenon called α-complementation which forms the basis for the blue/white screening of recombinant clones. This enzyme can be split in two peptides, LacZα and LacZΩ, neither of which is active by itself but when both are present together, spontaneously reassemble into a functional enzyme. This property is exploited in many cloning vectors where the presence of the lacZα gene in a plasmid can complement in trans another mutant gene encoding the LacZΩ in specific laboratory strains of E. coli . However, when DNA fragments are inserted in the vector, the production of LacZα is disrupted, the cells therefore show no β-galactosidase activity. The presence or absence of an active β-galactosidase may be detected by X-gal, which produces a characteristic blue dye when cleaved by β-galactosidase, thereby providing an easy means of distinguishing the presence or absence of cloned product in a plasmid. E. coli β-Galactosidase consists of 1,024 amino acids with molecular mass of 116 kDa and functional form is a homotetramer.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C, Avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube. , Do not store this antibody below -20 °C
Host Animal:
Rabbit
Species Reactivity:
Beta galactosidase (E.coli) and beta galactosidase tagged proteins
Immunogen:
Full length Beta galactosidase from E.coli UniProt: B7UJI9
Applications:
ELISA (ELISA), Immunofluorescence (IF), Immunoprecipitation (IP), Western blot (WB)
GST (Glutathione S-Transferase) is a 26kDa protein encoded by the parasitic helminth Schistosoma japonicum and widely used in the pGEX family of GST plasmid expression vectors as a fusion protein with foreign proteins.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at -20 °C, Avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
GST-tagged recombinant proteins
Immunogen:
Recombinant GST of Schistosoma japonicum UniProt: P08515
Applications:
Immunofluorescence (IF), Immunoprecipitation (IP), Western blot (WB)
GST-tag (glutathione S-transferase) is a tag added to N-terminus of a protein of interest as a fusion protein to unable purification and detection. The tag is 220 amino acid long, ca. 26 kDa which makes it quite large compare to Myc or FLAG tags.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
GST-tag
Immunogen:
Recombinant, full size GST, amino acids 1-212, NCBI: AAA57089
Applications:
ELISA (ELISA), Immunoprecipitation (IP), Western blot (WB)
The antigen-specific T cell receptor (TCR) is composed of either alpha and beta subunit, or gamma and delta subunit. Majority of T cells present in the blood, lymph and secondary lymphoid organs express TCR alpha/beta heterodimers, whereas the T cells expressing TCR gamma/delta heterodimers are localized mainly in epithelial tissues and at the sites of infection. The subunits of TCR heterodimers are covalently bonded and in the endoplasmic reticulum they associate with CD3 subunits to form functional TCR-CD3 complex. Lack of expression of any of the chains is sufficient to stop cell surface expression._x000D_
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on vial label.
Immunogen:
Affinity purified TCR from DO-11.10 T cell hybridoma_x000D_
Applications:
FC,IP,IHC,ICC,FA
Additional Info:
The Armenian hamster monoclonal antibody H57-597 reacts specifically with beta subunit of TCR alpha/beta. This antibody does not crossreact with TCR gamma/delta type and has been used as TCR alpha/beta phenotypic marker._x000D_
GFP (Green fluorescent protein) was originally identified in photo organs on jellyfish Aequorea victoria. It is a naturally fluorescent protein which emits green light at a maximum wavelength of 509 nm when excited by blue or UV light. It is extensively used in laboratory as a reporter molecule to label and study cellular and subcellular proteins in living cells using a wide range of applications. Antibodies to GFP protein are used in immunoblotting and ELISA. GFP protein has molecular weight of 27 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
EGFP, S65T-GFP, RS-GFP, YFP
Immunogen:
Recombinant, His-tagged EGFP protein from Aequorea victoria, UniProt: P42212
Applications:
Immunofluorescence (IF), Immunoprecipitation (IP), Western blot (WB)
Tatsumi et al. (2017). G196 epitope tag system: a novel monoclonal antibody, G196,recognizes the small, soluble peptide DLVPR with high affinity. Sci Rep. 2017 Mar 7;7:43480.doi: 10.1038/srep43480. (Immunofluorescence, Western blot)
GFP (Green fluorescent protein) was originally identified in photo organs on jellyfish Aequorea victoria. It is a naturally fluorescent protein which emits green light at a maximum wavelength of 509 nm when excited by blue or UV light. It is extensively used in laboratory as a reporter molecule to label and study cellular and subcellular proteins in living cells using a wide range of applications. Antibodies to GFP protein are used in immunoblotting and ELISA. GFP protein has molecular weight of 27 kDa.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid, 1mg/ml.
Storage Temp:
Store at -20 °C, Avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rat
Species Reactivity:
Native GFP, Recombinant GFP (E,coli), all variants of GFP, including EGFP
Immunogen:
Recombinant GFP protein from Aequorea victoria, UniProt: P42212
Applications:
Chromatin immunoprecipitation (ChIP), ELISA (ELISA), Immunofluorescence (IF), Immunoprecipitation (IP), Western blot (WB)
Immunoglobulin Protein A purified in PBS, 50 % glycerol, filter sterilized.
Selected references:
Maehara et al. (2015). issue-specific expression of histone H3 variants diversified after species separation. Epigenetics Chromatin. 2015 Sep 17;8:35. doi: 10.1186/s13072-015-0027-3. (ChIP)Okazaki et al. (2012). Nuclear localization signal in a cancer-related transcriptional regulator protein NAC1. Carcinogenesis. 2012 Oct;33(10):1854-62.doi: 10.1093/carcin/bgs193. (Immunoprecipiation)
Actin-related proteins (ARPs) are found in the nuclei of all eukaryotic cells, but their functions are generally understood only in the context of their presence in various yeast and animal chromatin-modifying complexes. Arabidopsis ARP8 shows 30 and 29% amino acid identity to yeast actin and Arabidopsis ACT2 in the regions of alignment, respectively. Because it is not closely related to yeast or human ARP8 and shows similar weak homology to yeast ARP8 and ARP9, the Arabidopsis ARP8 is considered a plant-specific orphan ARP.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -80 C; Avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Antibody is recognizing following epitope, amino acids 447-471: SNLSIFPGPWCITRKQFRRKSRLMWThis antibody is recognizing the full-length 52 kDa recombinant ARP8 protein expressed in Escherichia coli as well as endogenous ARP8 of identical molecular weight in Arabidopsis thaliana extracts from different tissues: all vegetative and reproductive organs examined including seedlings, roots and siliques, with higher concentrations of the protein detected in developing flower buds and flowers within the inflorescence.
Application Details:
assay dependent
Conjugation:
IgG1
Isotype:
IgG1
Purity:
Cell culture supernatant
Molecular Weight:
52 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Kandasamy et al. (2008). ACTIN-RELATED PROTEIN8 encodes an F-box protein localized to the nucleolus in Arabidopsis. Plant Cell Physiol. 49(5):858-63. doi: 10.1093/pcp/pcn053.
Actin-related proteins (ARPs) are found in the nuclei of all eukaryotic cells, but their functions are generally understood only in the context of their presence in various yeast and animal chromatin-modifying complexes. Arabidopsis ARP8 shows 30 and 29% amino acid identity to yeast actin and Arabidopsis ACT2 in the regions of alignment, respectively. Because it is not closely related to yeast or human ARP8 and shows similar weak homology to yeast ARP8 and ARP9, the Arabidopsis ARP8 is considered a plant-specific orphan ARP.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -80 C; Avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica rapa, Camelina sativa, Capsella rubella, Eutrema salsugineum, Raphanus sativusSpecies of your interest not listed? Contact us
Antibody is recognizing following epitope, amino acids 2-26: aa 2-ILKKVWG SVWNRSNSGKDLVNHQRA-26 This antibody is recognizing the full-length 52 kDa recombinant ARP8 protein expressed in Escherichia coli as well as endogenous ARP8 of identical molecular weight in Arabidopsis thaliana extracts from different tissues: all vegetative and reproductive organs examined including seedlings, roots and siliques, with higher concentrations of the protein detected in developing flower buds and flowers within the inflorescence.
Application Details:
assay dependent
Conjugation:
IgG1
Isotype:
IgG1
Purity:
Cell culture supernatant
Molecular Weight:
52 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Kandasamy et al. (2008). ACTIN-RELATED PROTEIN8 encodes an F-box protein localized to the nucleolus in Arabidopsis. Plant Cell Physiol. 49(5):858-63. doi: 10.1093/pcp/pcn053.
Actin-related proteins (ARPs) are found in the nuclei of all eukaryotic cells, but their functions are generally understood only in the context of their presence in various yeast and animal chromatin-modifying complexes. Arabidopsis thaliana ARP6 is a clear homolog of other eukaryotic ARP6s, including Saccharomyces cerevisiae ARP6, which was identified as a component of the SWR1 chromatin remodeling complex. Arabidopsis ARP6 is localized to the nucleus during interphase but dispersed away from the chromosomes during cell division. ARP6 expression was observed in all vegetative tissues as well as in a subset of reproductive tissues. Null mutations in ARP6 caused numerous defects, including altered development of the leaf, inflorescence, and flower as well as reduced female fertility and early flowering in both long- and short-day photoperiods.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -80 C; Avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Arabidopsis thaliana
Immunogen:
ARP6 of Arabidopsis thaliana, UniProt: Q8LGE3, TAIR: At3g33520
Applications:
ELISA (ELISA), Immunoflourescence (IF), Western blot (WB)
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Deal et al. (2005). The nuclear actin-related protein ARP6 is a pleiotropic developmental regulator required for the maintenance of FLOWERING LOCUS C expression and repression of flowering in Arabidopsis. Plant Cell Oct;17(10):2633-46. doi:10.1105/tpc.105.035196.
Phytochrome is a photomorphogenically active pigment that modulates plant growth and development with respect to incident light intensity and wavelength distribution. It exists in two forms: an inactive, red-absorbing form (Pr),4 and an active far-red-absorbing form (Pfr). When either absorbs light, it is photoconverted to the other. Phytochrome is a dimeric, water-soluble, relatively labile chromoprotein with similar, if not identical, monomers of about 124 kDa each. It is also a relatively low abundance protein, even under the best of conditions. Genetic manipulation of phytochrome expression in plants leads to plants requiring less light and able to divert more energy to the production of fruits and seeds. For its physicochemical characterization, it has therefore been difficult to utilize techniques that require large quantitites of highly purified protein. Consequently, indirect methods for elucidating its structure/function relationships are especially important. These could also be applicable to fabaceae and closely related families.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -80 C; Avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Avena sativa, Pisum sativum
Expected Species:
graminae, fabaceaeSpecies of your interest not listed? Contact us
Immunogen:
Phytochrome
Applications:
ELISA (ELISA), Competitive ELISA, Immunoflourescence (IF), Immunoprecipiation (IP), Western blot (WB)
Epitope for this antibody is located at 36 kDa from N-terminus and very near the site of chromophore attachment
Application Details:
assay dependent
Purity:
Cell culture supernatant
Molecular Weight:
124 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Pratt et al. (1988). Mapping of antigenic domains on phytochrome from etiolated Avena sativa L. by immunoblot analysis of proteolytically derived peptides. Arch Biochem Biophys. 267(2):723-35. doi: 10.1016/0003-9861(88)90081-1.Cordonnier et al. (1983). Production and purification of monoclonal antibodies to Pisum and Avena phytochrome. Planta. 158(4):369-76. doi: 10.1007/BF00397340.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Pattathil et al. (2015). Insights into plant cell wall structure, architecture, and integrity using glycome profiling of native and AFEXTM-pre-treated biomass. J Exp Bot. Jul;66(14):4279-94.doi: 10.1093/jxb/erv107.
Mannan is one of the major constituent groups of hemicellulose in the wall of higher plants. It comprises linear or branched polymers derived from sugars such as D-mannose, D-galactose, and D-glucose.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
Host Animal:
Mouse
Species Reactivity:
gum and acetylated mannan from Lycopersicum esculentum
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Pattathil et al. (2015). Insights into plant cell wall structure, architecture, and integrity using glycome profiling of native and AFEXTM-pre-treated biomass. J Exp Bot. Jul;66(14):4279-94.doi: 10.1093/jxb/erv107.
Xyloglucan is a hemiceullose or polysaccharide that is found in the primary cell wall of all vascular plants. Xyloglucan binds to the surface of cellulose microfibrils and may link them together.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
The reactivity of the antiserum is directed to the subclass IgG2a. It reacts with IgG2a of the allelic types Igh-1a and Igh-1b, which include BALB/C, C57Bl, CBA/J, SJL/J and SM/J. hen used for the identification of IgG2a in other mouse strains the reaction may be weaker. The immunoconjugate contains antibodies to iso and allospecific determinants. It does not react with other subclasses of IgG, IgG/Fab fragments, IgM and IgA or any non-Ig protein in mouse serum, as tested by immunoelectrophoresis and double radial immunodiffusion.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
The lyophilized conjugate is shipped at ambient temperature and may be stored at 4 C; prolonged storage at or below -20 °C. It is reconstituted by adding 1 ml sterile distilled water, spun down to remove insoluble particles, divided into small aliquots, frozen and stored at or below -20 °C. Prior to use, an aliquot is thawed slowly at ambient temperature, spun down again and used to prepare working dilutions by adding sterile phosphate buffered saline (PBS, pH 7,2). Repeated thawing and freezing should be avoided. Working dilutions should be stored at 4 C, not refrozen, and preferably used the same day. If a slight precipitation occurs upon storage, this should be removed by centrifugation. It will not affect the performance of the immunoconjugate. Lyophilized at +4 C--at least 10 years. Reconstituted at or below -20 C--3-5 years. Reconstituted at +4 C--7 days.
Host Animal:
Goat
Species Reactivity:
Mouse IgG2a
Immunogen:
Pools of purified homogenous IgG2a isolated from pooled mouse sera belonging to the allelic types Igh- 1a and Igh-1b, Freund's complete adjuvant is used in the first step of the immunization procedure,
Applications:
Dot blot (Dot), ELISA (ELISA), Immunohistochemistry (paraffin) (IHC), Western blot (WB)
This immunoconjugate is not species-specific since inter-species cross-reactivity is a normal feature of antisera to immunoglobulins, However this conjugate has been passed over appropriate immuno-adsorbents to remove antibodies cross-reacting with Human immunoglobulins, This renders it specific for use in test systems containing material of Human origin (e,g, Human tissue/Mouse monoclonal antibody to a Human tissue constituent/anti Mouse Ig isotype-specific immunoconjugate
For reconstitution add 1 ml of sterile water, Let it stand for 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
This immunoconjugate is not species-specific since inter-species cross-reactivity is a normal feature of antisera to immunoglobulins, However this conjugate has been passed over appropriate immunoadsorbents to remove antibodies cross-reacting with Human immunoglobulins, This renders it specific for use in test systems containing material of Human origin (e,g, Human tissue/Mouse monoclonal antibody to a Human tissue constituent/anti Mouse Ig isotype-specific immunoconjugate
Phosphorylation is a post-translational modification of proteins in which a phosphate group is covalently bound to a serine, threonine or a thyrosine residue by a protein kinase. Phosphorylation of a protein can result in activation or inhibition of a proteins function and is thereby a regulatory mechanisms of protein activation.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at 2-8 C; add sodium azide to 0,05% for porlonged storage, Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Immunoglobulin Protein A purified in a 10 mM ammonium bicarbonate buffer, with 2 mg of BSA.
Reconstitution:
Recommended antibody concentration: 0.5 mg/ml (when dissolved at 0.5 mg/ml, the BSA concentration will be 1%). Recommended to dissolve in; 100 mM PBS or Tris-HCl, pH 7.0 Additional sodium azide ( up to 0.05%) is recommended for long term storage. For a 0.5 mg/ml antibody concentration in 1% BSA, dissolve in 200 μl buffer.
Fluorescent proteins, like BFP, can be used as protein "tags" to study the subcellular localization of proteins and/or their translocation upon stimulation and/or as markers for transfections in transient and stable expression systems.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at 2-8 C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
BFP
Immunogen:
Recombinant EBFP (NCBI accession number AX_766758 REGION: 1-717, expression vector pGEX-1N), expressed in E.coli.
Immunoglobulin Protein A purified in a 10 mM ammonium bicarbonate buffer, with 2 mg of BSA.
Reconstitution:
Recommended antibody concentration: 0.5 mg/ml (when dissolved at 0.5 mg/ml, the BSA concentration will be 1%). Recommended solvent; 100 mM PBS or Tris-HCl, pH 7.0 •Additional sodium azide ( up to 0.05%) is recommended for long term storage. •For a 0.5 mg/ml antibody concentration in 1% BSA, dissolve in 200 μl buffer.
The antigen-specific T cell receptor (TCR) is composed of either alpha and beta subunit, or gamma and delta subunit. Majority of T cells present in the blood, lymph and secondary lymphoid organs express TCR alpha/beta heterodimers, whereas the T cells expressing TCR gamma/delta heterodimers are localized mainly in epithelial tissues and at the sites of infection. The subunits of TCR heterodimers are covalently bonded and in the endoplasmic reticulum they associate with CD3 subunits to form functional TCR-CD3 complex. Lack of expression of any of the chains is sufficient to stop cell surface expression._x000D_
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on vial label.
Immunogen:
Affinity purified TCR from DO-11.10 T cell hybridoma_x000D_
Applications:
FC,IP,IHC,ICC,FA
Additional Info:
The Armenian hamster monoclonal antibody H57-597 reacts specifically with beta subunit of TCR alpha/beta. This antibody does not crossreact with TCR gamma/delta type and has been used as TCR alpha/beta phenotypic marker._x000D_
Fluorescent proteins, like EBFP, can be used as protein "tags" to study the subcellular localization of proteins and/or their translocation upon stimulation and/or as markers for transfections in transient and stable expression systems.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at 2-8 C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
BFP, GFP, YFP
Immunogen:
Recombinant EBFP (NCBI accession number AX_766758 REGION: 1-717, expression vector pGEX-1N), expressed in E.coli.
Immunoglobulin Protein A purified in a 10 mM ammonium bicarbonate buffer, with 2 mg of BSA.
Reconstitution:
Recommended antibody concentration: 0.5 mg/ml (when dissolved at 0.5 mg/ml, the BSA concentration will be 1%). Recommended solvent; 100 mM PBS or Tris-HCl, pH 7.0 •Additional sodium azide ( up to 0.05%) is recommended for long term storage. •For a 0.5 mg/ml antibody concentration in 1% BSA, dissolve in 200 μl buffer.
Tubulin beta (TUB) together with alpha tubulin is making up microtubules.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 4 C; Do not freeze. Do not exceed exipry date is provided on the tube. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
human, mouse, pig
Expected Species:
Plants Species of your interest not listed? Contact us
Immunogen:
Beta-tubulin purified from porcine brain, UniProt: Q9H4B7
Applications:
Immunocytochemistry (ICC), Immunohistochemistry on frozen sections (IHC), Western blot (WB)
This antibody is recognizing N-terminal structural domain of beta tubulin.Recommended secondary antibody for Western blot is: goat anti mouse IgM AS16 3497Metal induced stress affected the expression of tubulin alpha and gamma, and that therefore, these proteins cannot be used as a loading control under that type of conditions. More information can be found here.
Application Details:
2-8 g/ml (ICC), 1 g/ml (WB)
Conjugation:
IgM
Isotype:
IgM
Purity:
Purified by precipitation and affinitychromatography in TBS. Contains 15 mM sodium azide.
Molecular Weight:
50,3 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Tubulin alpha (TUA) together with beta tubulin is making up microtubules.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 4 C; Do not freeze. Do not exceed exipry date is provided on the tube. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
This antibody is recognizing defined epitope (amino acid 65-97) on N-terminal structural domain of alpha tubulin.Recommended secondary antibody, goat anti-mouse IgG1, HRP conjugated AS16 3715
Application Details:
1 : 500 (ICC), 1-4 g/ml /FlowCyt), 1-4 g/ml (WB)
Conjugation:
IgG1
Isotype:
IgG1
Purity:
Immunoglobulin Protein A purified in PBS. Contain 15 mM sodium azide.
Molecular Weight:
51 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Liu et al. (2022) Identification of positive and negative regulators of antiviral RNA interference in Arabidopsis thaliana. Nat Commun. 2022 May 30;13(1):2994. doi: 10.1038/s41467-022-30771-0. PMID: 35637208; PMCID: PMC9151786.
Special application note:
Metal induced stress affected the expression of tubulin, and that therefore, this protein cannot be used as a loading control under that type of conditions, data in application example,
Recombinant protein rVes v 5 is expressed in S2 cells (Drosophila). DNA sequence encoding 218 AAs was fused with Strep-tag at the N-terminus. A calculated molecular mass of recombinant protein is 24,9 kDa.
Product Type:
Antibodies Primary
Storage Temp:
Store at -20°C to -80°C. Reconstitute in sterile deionized water. Use reconstituted product immediately or aliquot for further storage at -20°C to -80°C.
Applications:
ELISA,FC
Additional Info:
The protein was purified by ionex and affinity chromatography, using Strep-tag. Endotoxin was removed using a specific endotrap carrier. Product was lyophilized after purification.
Tubulin gamma chain is essential for the control of microtubular network. It is found at microtubule organizing centers (MTOC) such as the spindle poles
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 4 C; Do not freeze. Do not exceed exipry date is provided on the tube. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
KLH-conjugated gamma-tubulin peptide EYHAATRPDYISWGTQ, amino acids 434-449. UniProt: P23258The epitope was located in the aminoacid sequence PDYISW (aa441-446 in human), which is identical for gamma-tubulin 1 and gamma-tubulin 2.
This antibody recognizes C-terminus (amino acids 434-449 in human) of gamma-tubulin, a 48 kDa structural constituent of cytoskeleton and microtubule organizing center (MTOC). The epitope which this antibody is recognizing is conserved in Arabidopsis thaliana Tubulin gamma-1 chain, UniProt: P38557, Gene ID: At3g61650 and Tubulin gamma-2 chain, UniProt: P38558, Gene ID: At5g05620Recommended secondary antibody: goat anti-mouse IgG1 AS16 3715
LUC (Luciferase) from Photinus pyralis (Common eastern firefly) (Lampyris pyralis), light producing beetle is an enzyme in the light production. Luciferase enzymes are used in bioluminescene assay systems and display an inherent light emission, which makes them suitable for multiplex analyses, including in vivo imaging, cell viability.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at 4°C(short term) or -20 °C (long term); once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Luciferase from Photinus pyralis
Immunogen:
Purified Luciferase from Photinus pyralis UniProt: P08659
Applications:
ELISA (ELISA), Indirect Immunofluorescence (IF), Western blot (WB)
This product is intended for use in precipitating and non-precipitating antibody-binding assays; to prepare an insoluble immuno-affinity adsorbent and for labelling with a marker of chosed by the customer.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at 4°C(short time) or -20 °C (log term); once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Aspergillus niger
Immunogen:
Purified Glucose oxidase of Aspergillus niger, UniProt: P13006
Applications:
ELISA (ELISA), Immunofluorescence (IF), Western blot (WB)
Protein L is a 36 kDa immunoglobulin-binding protein isolated from the bacteria Peptostreptococcus magnus. Unlike Protein A and Protein G, which bind to the Fc region of immunoglobulins (antibodies), Protein L binds antibodies through light chain interactions. Protein L binds a wider range of antibody classes than Protein A or G. Protein L binds to representatives of all antibody classes, including IgG, IgM, IgA, IgE and IgD.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Recombinant protein rVes v 2 is expressed in S2 cells (Drosophila). DNA sequence encoding 345 AAs was fused with Strep-tag at the N-terminus. A calculated molecular mass of recombinant protein is 40,44 kDa.
Product Type:
Antibodies Primary
Storage Temp:
Store at -20°C to -80°C. Reconstitute in sterile deionized water. Use reconstituted product immediately or aliquot for further storage at -20°C to -80°C.
Applications:
ELISA
Additional Info:
The protein was purified by ionex and affinity chromatography, using Strep-tag. Endotoxin was removed using a specific endotrap carrier. Product was lyophilized after purification.
Protein L is an immunoglobulin-binding protein isolated from the bacteria Peptostreptococcus magnus. Unlike Protein A and Protein G, which bind to the Fc region of immunoglobulins (antibodies), Protein L binds antibodies through light chain interactions. Protein L binds a wider range of antibody classes than Protein A or G. Protein L binds to representatives of all antibody classes, including IgG, IgM, IgA, IgE and IgD.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Protein L is a 36 kDa immunoglobulin-binding protein isolated from the bacteria Peptostreptococcus magnus. Unlike Protein A and Protein G, which bind to the Fc region of immunoglobulins (antibodies), Protein L binds antibodies through light chain interactions. Protein L binds a wider range of antibody classes than Protein A or G. Protein L binds to representatives of all antibody classes, including IgG, IgM, IgA, IgE and IgD.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Protein G is a bacterial protein derived from the cell wall of certain strains of b-hemolytic Streptococcci. It binds with high affinity to the Fc portion of various classes and subclasses of immunoglobulins from a variety of species. Protein G binds to all IgG subclasses from human, mouse and rat species. It also binds to total IgG from guinea pig, rabbit, goat, cow, sheep, and horse. Protein G binds preferentially to the Fc portion of IgG, but unlike Protein A, can also bind to the Fab region, making it useful for purification of F(ab') fragments of IgG. Due to its affinity for the Fc region of many mammalian immunoglobulins, protein G is considered a universal reagent in biochemistry and immunology.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
Streptococcus sp.
Immunogen:
Recombinant protein G, lacking the albumin binding region,
Mouse CRP / C Reactive Protein / PTX1 Quick ELISA Kit (90 minutes, 96 Tests). Quantitate Mouse Crp in cell culture supernatants, cell lysates, serum and plasma (heparin, EDTA). Sensitivity: 10pg/ml.
Product Type:
Assay & Detection
Storage Temp:
-20°C
Immunogen:
Expression system for standard: NS0; Immunogen sequence: H20-S225
Applications:
ELISA
Additional Info:
The Quick ELISA kits, assay takes less than 1.5 hours. Detect Mouse Crp with <10pg/ml sensitivity Compatible samples: cell culture supernatants, cell lysates, serum and plasma (heparin, EDTA). This is a TMB colorimetric sandwich ELISA kit with short assay time and quick experiment set up.
Biosite Brand:
BioSite ELISA
Species Reactivity:
mouse
Cross Reactivity:
There is no detectable cross-reactivity with other relevant proteins.
Protein A is a surface protein of S. aureus which binds IgG molecules by their Fc region. In serum, the bacteria will bind IgG molecules in the wrong orientation on their surface, which hinders opsonization and phagocytosis. Mutants of S. aureus lacking protein A are more efficiently phagocytosed in vitro and mutants in infection models have diminished virulence. Due to its affinity for the Fc region of many mammalian immunoglobulins, protein A is considered a universal reagent in biochemistry and immunology.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Protein A is a surface protein of S. aureus which binds IgG molecules by their Fc region. In serum, the bacteria will bind IgG molecules in the wrong orientation on their surface, which hinders opsonization and phagocytosis. Mutants of S. aureus lacking protein A are more efficiently phagocytosed in vitro and mutants in infection models have diminished virulence. Due to its affinity for the Fc region of many mammalian immunoglobulins, protein A is considered a universal reagent in biochemistry and immunology.
The specific activity of the anti-protein A-agarose was determined, For this lot, 1,1 mg protein A bound per ml agarose
Purity:
Immunogen affinity purified in PBS pH 7.2. Contains 0.075% sodium azide, coupled to immunoprecipiation gel.
Special application note:
Antibodies were isolated from immune eggs, affinity purified on a protein A column and conjugated to N- hydroxysuccinimide (NHS)-activated agarose beads, Beads were washed extensively with after the blocking of the residual NHS sites
Botulinum toxin is a toxin produced by the anaerobic, gram-positive, bacterium of the genus Clostridium (C. botulinum, C. butyricum, C. baratii and C. argentinense). These strains are widely distributed and can be found in soil and dust. Eight types of botulinum toxin are distinguished, named type A–H. Type A and B are capable of causing disease in humans (botulism) and have longest activity in vivo, and are also used commercially (BOTOX) and medically. Types C–G are less common; types E and F can cause disease in humans, while the other types cause disease in other animals. BotB is cleaved into two chains: heavy and light.Alternative name: Bontoxilysin-B
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
Botulinum Neurotoxin B from Clostridium botulinum
Immunogen:
Highly purified Botulinum Neurotoxin Type B (Clostridium botulinum)
Botulinum toxin is a toxin produced by the anaerobic, gram-positive, bacterium of the genus Clostridium (C. botulinum, C. butyricum, C. baratii and C. argentinense). These strains are widely distributed and can be found in soil and dust. Eight types of botulinum toxin are distinguished, named type A–H. Type A and B are capable of causing disease in humans (botulism) and have longest activity in vivo, and are also used commercially (BOTOX) and medically. Types C–G are less common; types E and F can cause disease in humans, while the other types cause disease in other animals. BotB is cleaved into two chains: heavy and light.Alternative name: Bontoxilysin-B
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
Botulinum Neurotoxin B fromClostridium botulinum
Immunogen:
Highly purified Botulinum Neurotoxin Type B (Clostridium botulinum)
Botulinum toxin is a toxin produced by the anaerobic, gram-positive, bacterium of the genus Clostridium (C. botulinum, C. butyricum, C. baratii and C. argentinense). These strains are widely distributed and can be found in soil and dust. Eight types of botulinum toxin are distinguished, named type A–H. Type A and B are capable of causing disease in humans (botulism) and have longest activity in vivo, and are also used commercially (BOTOX) and medically. Types C–G are less common; types E and F can cause disease in humans, while the other types cause disease in other animals. BotA is cleaved into two chains: heavy and light.Alternative name: Bontoxilysin-A
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
Botulinum toxin A heavy chain
Immunogen:
Purified Botulinum Neurotoxin Type A (Heavy Chain Binding Domain)
For direct ELISA coating with 2 g of Botulinium Toxin A is recommended combined with primary antibody dilution of 1: 10 000.For Western blot 0.5 g of non reduced holotoxin or heavy chains is recommended together with 1: 2000 dilution of a primary antibody.
HA-tag is derived from a human influenza hemagglutinin HA-molecule corresponding to amino acids 96-106 and is used as a general epitope tag in expression vectors. An anti-HA antibody can then be used to detect the protein on western blot or to immunoprecipitate the recombinant protein in binding studies with transfected cells.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
HA-tagged proteins
Immunogen:
KLH-conjugated synthetic petide YPYDVPDYA of influenza virus hemagglutinin.
Molar F/P ratio is 3,6 and indicates an average number of FITC molecules/IgY molecule as determined by the extinction values at 495 nm and 280 nm (OD495 and OD280), respectively
HA-tag is derived from a human influenza hemagglutinin HA-molecule corresponding to amino acids 96-106 and is used as a general epitope tag in expression vectors. An anti-HA antibody can then be used to detect the protein on western blot or to immunoprecipitate the recombinant protein in binding studies with transfected cells.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
HA-tagged proteins
Immunogen:
KLH-conjugated synthetic petide YPYDVPDYA of influenza virus hemagglutinin.
Applications:
ELISA (ELISA), Flow cytometry (Flowcyt), Western blot (WB)
Papain (EC=3.4.22.2) is a cysteine protease which belongs to peptidase C1 family. Can cause an allergic reaction in humans. Alternative names: Papaya proteinase I, allergen= Car p 1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Carica papaya
Expected Species:
Carica papaya
Immunogen:
native papain isolated and purified from Carica papaya
Applications:
ELISA (ELISA), Immunofluorescence (IF), Immunohistochemistry (IHC), Western blot (WB)
Biotin/IgG protein molar ration is approximately 6,2, No foreign proteins are added
Application Details:
1 : 1000-1 : 100 000 (ELISA), (IF), (IHC), (WB)
Purity:
Purified IgG in PBS. Contains 0.08% sodium azide.
Reconstitution:
For reconstitution add 0,5 ml of sterile destilled water
Molecular Weight:
38,9 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Antibody is labelled with biotin using N-hydroxysuccinimidobiotin, Antibody potency and purity has been evaluated by immunoelectrophoresis, single radial immunodiffusion (Ouchterlony), ELISA,immunoblotting and enzyme inhibition
Papain (EC=3.4.22.2) is a cysteine protease which belongs to peptidase C1 family. Can cause an allergic reaction in humans. Alternative names: Papaya proteinase I, allergen= Car p 1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Carica papaya
Expected Species:
Carica papaya
Immunogen:
native papain isolated and purified from Carica papaya
Applications:
ELISA (ELISA), Immunofluorescence (IF), Immunohistochemistry (IHC), Western blot (WB)
Biotin/IgG protein molar ration is approximately 6,2, No foreign proteins are added
Application Details:
1 : 1000-1 : 100 000 (ELISA), (IF), (IHC), (WB)
Purity:
Purified IgG in PBS. Contains 0.08% sodium azide.
Reconstitution:
For reconstitution add 0,5 ml of sterile destilled water
Molecular Weight:
38,9 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Antibody is labelled with biotin using N-hydroxysuccinimidobiotin, Antibody potency and purity has been evaluated by immunoelectrophoresis, single radial immunodiffusion (Ouchterlony), ELISA,immunoblotting and enzyme inhibition
His-Tag is a polyhistidine tag which consists of 6 histidine residues introduced on N- or C-terminus of the protein. The polyhistidine-tag can be used for recombinant protein detection using specific antibodies and it is not conjugated to any dye or enzyme.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
APP is an integral membrane protein found in any tissues and concentrated in the synapses of neurons. It is known as the precursor molecule generating amyloid beta (Aβ), and the amyloid fibrillar form is the primary component of amyloid plaques found in the brains of patients with Alzheimer's disease.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Human, mouse, rat
Expected Species:
Chicken, monkey and other species, please inquire.
Immunogen:
Synthetic peptide amino acids: 737-751 of human APP UniProt: P05067 or 85-99 of the C99 generated by secretases.
APP is an integral membrane protein found in many tissues and concentrated in the synapses of neurons. It is known as the precursor molecule generating amyloid beta (Aβ), and the amyloid fibrillar form is the primary component of amyloid plaques found in the brains of patients with Alzheimer's disease.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Human, mouse, rat
Immunogen:
Synthetic peptide (aa 653-662 of human APP) or 1-10 of the 4kDa Amyloid- peptide, The 4 kDa amyloid peptide is a 40 amino acid sequence that is cleaved of from the human amyloid A4 protein precursor (APP) and therefore the amino acids 1-10 of the peptide correspond to amino acids 653-662 of APP,
HA-tag is derived from a human influenza hemagglutinin HA-molecule corresponding to amino acids 96-106 and is used as a general epitope tag in expression vectors. An anti-HA antibody can then be used to detect the protein on western blot or to immunoprecipitate the recombinant protein in binding studies with transfected cells.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
HA-tagged proteins
Immunogen:
9 amono acid long synthetic petide to influenza virus hemagglutinin,
CAH6 (Carbonic anhydrase 6) is a zinc-containing metalloenzymes that catalyze the reversible hydration of CO2. There are three evolutionary not related families of carbonic anhydrases: alpha, beta and gamma. CAH6 belonds to the beta family and initially was localized to chloroplasts Mitra et al. (2004).However, lately localization to flagella has been confirmed Mackinder et al. 2017.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii
Expected Species:
Gonium pectorale, Volvox carteriSpecies of your interest not listed? Contact us
Immunogen:
Recombinant, full length CAH6 of Chlamydomonas reinhardtii, excised from the gel, UniProt: Q6S7R9
Lately localization to flagella has been confirmed for CAH6 Mackinder et al. 2017.Extraction method – harvest the cells and add SDS sample buffer.
Mackinder et al. 2017. A Spatial Interactome Reveals the Protein Organization of the Algal CO2-Concentrating Mechanism. Cell. 2017 Sep 21;171(1):133-147.e14. doi: 10.1016/j.cell.2017.08.044.Mitra et al. (2004). Identification of a new chloroplast carbonic anhydrase in Chlamydomonas reinhardtii. Plant Physiol. 2004 May;135(1):173-82.
BetaCA1 (Beta carbonic anhydrase 1) (chloroplastic) - is a zinc metalloenzyme that interconvert CO2 and HCO3 (-). Alternative names: ARABIDOPSIS THALIANA SALICYLIC ACID-BINDING PROTEIN 3, ATBCA1, ATSABP3, BETA CARBONIC ANHYDRASE 1, CA1, CARBONIC ANHYDRASE 1, SABP3, SALICYLIC ACID-BINDING PROTEIN 3.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Solanum lycopersicum Q5NE20 Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide, derived in the part C-terminus of BetaCA1 of Arabidopsis thaliana, UniProt: P27140, TAIR: At3g01500
Extraction method – Grind 50 mg of leaf tissue in a sterile microcentrifuge tube using a sterile plastic pestle. Add 132μL of Protein Extraction Buffer (1x TE, 1.2 %SDS, 2.7% sucrose, 7.5 μg mL-1 bromophenol blue) to the ground leaf tissue. Vortex the sample and keep on ice for 15 mins. Centrifuge at 14,000 rpm for five minutes using a benchtop centrifuge. Collect the supernatant and in a new sterile 0.5 ml microcentrifuge tube and discard the pellet.This antibody does not recognize betaCA2.
Application Details:
1 : 20 000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
37,5 | 25,3 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
DiMario et al. (2016). The Cytoplasmic Carbonic Anhydrases βCA2 and βCA4 Are Required for Optimal Plant Growth at Low CO2. Plant Physiol. 2016 May;171(1):280-93. doi: 10.1104/pp.15.01990.
FBPase1 (Fructose-1,6-bisphosphatase 1, chloroplastic (chloroplastic marker in photosynthetic tissues) involved in carbohydrate biosynthesis. Alternative names: D-fructose-1,6-bisphosphate 1-phosphohydrolase, HCEF1 (High Cyclic Electron Flow 1).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Abrus precatorius, Actinidia chinensis, Arabis nemorensis, Beta vulgaris, Brassica napus, Capsella rubella, Cephalotus follicularis, Eucalyptus grandis, Gossypium tomentosum, Hibiscus syriacus, Manihot esculenta, Morella rubra, Mucuna pruriens, Nelumbo nucifera, Parasponia andersonii, Populus sp., Prunus dulcis, Prunus persica, Salvia splendens, Syzygium oleaosum, Vitis vinifera Species of your interest not listed? Contact us
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Penzler et al. (2022) Commonalities and specialties in photosynthetic functions of PROTON GRADIENT REGULATION5 variants in Arabidopsis. Plant Physiol. 2022;190(3):1866-1882. doi:10.1093/plphys/kiac362Wang et al. (2022), Arabidopsis Ubiquitin-Conjugating Enzymes UBC4, UBC5, and UBC6 Have Major Functions in Sugar Metabolism and Leaf Senescence, Int. J. Mol. Sci. 2022, 23(19), 11143; https://doi.org/10.3390/ijms231911143Lim et al (2022). Arabidopsis guard cell chloroplasts import cytosolic ATP for starch turnover and stomatal opening. Nat Commun. 2022 Feb 3;13(1):652. doi: 10.1038/s41467-022-28263-2. PMID: 35115512; PMCID: PMC8814037.
MC4 (Metacaspase-4) is a cysteine protease that cleaves specifically after arginine or lysine residues. Does not cleave caspase-specific substrates. Plays a positive regulatory role in biotic and abiotic stress-induced programmed cell death. Alternative names: AtMCP2d,Metacaspase 2d
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube. Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Raphanus sativus, Noccaea caerulescensSpecies of your interest not listed? Contact us
Full length MC4 (zMC4) disappears upon wounding, Accumulation of specific lower weight bands of active MC4 subunits, p20) is not detected with this antibody
Application Details:
1 : 1000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
45,5 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
To be added when available, antibody released in November 2020.
ERD7 (Early Response to Dehydration ) and its homologs are important for plant stress responses and development and associated with modification of membrane lipid composition.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
To induce detectable levels of ERD7, plants need to be exposed to low temperature of 4 C for 24 h.The protein is detected in the microsomal fraction. (Barajas-Lopez et al, 2021)
Application Details:
1 : 2000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
49 | 58 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Barajas-Lopez et al. (2021) EARLY RESPONSE TO DEHYDRATION 7 Remodels Cell Membrane Lipid Composition during Cold Stress in Arabidopsis. Plant Cell Physiol. 2021 Mar 25;62(1):80-91. doi: 10.1093/pcp/pcaa139. PMID: 33165601.
CPK1 (CALCIUM-DEPENDENT PROTEIN KINASE1) is a calcium-dependent protein kinase that can phosphorylate phenylalanine ammonia lyase (PAL), a key enzyme in pathogen defense. Alternative names: AtCDPK 1, CDPK 1, Calcium-dependent protein kinase isoform AK1,
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Noccaea caerulescen, Triticum sp. Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana CPK1 protein sequence, UniProt: Q06850-1, TAIR AT5G04870
EPYC1 (Essential Pyrenoid Component 1), also known as Lci5, is localizing in the pyrenoid matrix, is of similar abundance as Rubisco and its function is scaffolding for the assembly of Rubisco in the pyrenoid.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardti
Expected Species:
Chlamydomonas reinhardtii
Immunogen:
KLH-conjugated peptide derived from Chlamydomonas reinhardtii EPYC1, C-terminal part UniProt: A0A2K3DA85
PGRL1 is a transmembrane protein present in thylakoids of higher plants and algae. Arabidopsis plants lacking PGRL1 show perturbation of cyclic electron transport (CEF) around photosystem I (PSI), similar to PGR5-deficient plants. PGRL1 has been shown to interact physically with PGR5 and associate with PSI (DalCorso et al., 2008). In Chlamydomonas reinhardtii, PGRL1 is part of a protein supercomplex, composed of PSI with its own light-harvesting complex (LHCI), the photosystem II light-harvesting complex (LHCII), the cytochrome b6/f complex (Cyt b6f), ferredoxin (Fd)-NADPH oxidoreductase (FNR), responsible of the energy balance of the two photosystems and of the switch between thylakoid linear and cyclic electron transport (Iwai et al., 2010). Synonymes: Ferredoxin-plastoquinone reductase 1
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Dichanthelium oligosanthes, Glycine soja, Gossypium arboreum, Klebsormidium nitens, Nelumbo nucifera, Noccaea caerulescens, Physcomitrium patens, Prunus dulcis, Prunus yedoensis, Rhizophora mucronatamm, Solanum chacoense, Trifolium medium, Zea mays, Vitis viniferaSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana PGRL1A UniProt: Q8H112, TAIR: At4g22890Peptide used to elicit this antibody is conserved in both isoforms PGRL1A and 1B of Zea mays
McKinnon et al. (2020). Membrane Chaperoning of a Thylakoid Protease Whose Structural Stability Is Modified by the Protonmotive Force. Plant Cell DOI: 10.1105/tpc.19.00797
Alzheimer's disease (AD) is the most prevalent neurodegenerative disease in the growing population of elderly people. A hallmark of AD is the accumulation of plaques in the brain of AD patients. The plaques predominantly consist of aggregates of amyloid-beta (Abeta), a peptide of 39-42 amino acids generated in vivo by specific, proteolytic cleavage of the amyloid precursor protein.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Human
Expected Species:
Bovine, Chicken, Dog, Porcine, Rabbit
Immunogen:
Synthetic peptide chosen from human Abeta (1-11) peptide DAEFRHDSGYE
Alzheimer's disease (AD) is the most prevalent neurodegenerative disease in the growing population of elderly people. A hallmark of AD is the accumulation of plaques in the brain of AD patients. The plaques predominantly consist of aggregates of amyloid-beta (Abeta), a peptide of 39-42 amino acids generated in vivo by specific, proteolytic cleavage of the amyloid precursor protein.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Human
Expected Species:
Bovine, Chicken, Dog, Porcine, Rabbit
Immunogen:
Synthetic peptide chosen from human Abeta (1-11) peptide DAEFRHDSGYE
Alzheimer's disease (AD) is the most prevalent neurodegenerative disease in the growing population of elderly people. A hallmark of AD is the accumulation of plaques in the brain of AD patients. The plaques predominantly consist of aggregates of amyloid-beta (Abeta), a peptide of 39-42 amino acids generated in vivo by specific, proteolytic cleavage of the amyloid precursor protein.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Human
Expected Species:
Bovine, Chicken, Dog, Porcine, Rabbit
Immunogen:
Synthetic peptide chosen from human Abeta (18-30) peptide VFFAEDVGSNKGA
RPSA or 30S ribosomal protein S1 (bacterial) is required for translation of most natural mRNAs.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
bacteria
Immunogen:
KLH-conjugated peptide derived from RPSA of E.coli, UniProt: P0AG67
LHCR4 (Protein fucoxanthin chlorophyll a/c protein) is a PSI supercomplex peripheral antenna protein, identified by proteome analysis as type‐R light‐harvesting complexes (LHCr4).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Phaeodactylum tricornutum
Expected Species:
Gambierdiscus australes, Madurella mycetomatisSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Phaeodactylum tricornutum LHCR4, UniProt: B7FQE1
RPS6A (40S ribosomal protein S6-1) is the major substrate of protein kinases in eukaryote ribosomes. Essential during gametogenesis.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Actinidia rufa, Ananas comosus, Beta vulgaris, Cajanus cajan, Capsicum chinense, Citrus clementina, Gossypium australe, Olea europaea subsp. europaea, Oryza sativa, Panicum miliaceum, Populus alba, Sesamum indicum, Senna tora, Solanum lycopersicum, Vigna unguiculataSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana RPS6A, UniProt: O48549, TAIR: At4g31700 phosphorylated at Ser240
NdbA (Thylakoid Localized Type 2 NAD(P)H Dehydrogenase) is localized to the thylakoid membrane and expressed at a very low level in the widl type under photoautotrophic growth. NdbA is induced substantially under light-activated heterotophic growth conditions.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Synechocystis sp. PCC 68
Expected Species:
Bacillus subtilis Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from NdbA protein sequence of Synechocystis sp. PCC 6803, UniProt:P73739 Chosen peptide is not conserved in NdbB and NdbC.
Protein extraction: harvested cells were suspended in a buffer containing 50 mM Hepes-NaOH, pH 7,5, 30 mM CaCl2, 800 mM sorbitol, 1 mM ε-amino-n-caproic acid, and the cells were broken by vortexing 6 1 min at 4 C in the presence of glass beads, Protein samples were solubilized in Laemmli buffer containing 6 M urea and separated on a gel in presence of 6M urea
Application Details:
1 : 2000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
49 | 46 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Huokko et al. (2019). Thylakoid Localized Type 2 NAD(P)H Dehydrogenase NdbA Optimizes Light-Activated Heterotrophic Growth of Synechocystis sp. PCC 6803. Plant Cell Physiol. 2019 Mar 7. pii: pcz044. doi: 10.1093/pcp/pcz044.
Malate synthase is involved in the synthesis of (S)-malate from isocitrate, where it catalyses the reaction: acetyl-CoA + glyoxylate + H(2)O = (S)-malate + CoA + H(+). This is part of the glyoxylate cycle, which is itself part of carbohydrate metabolism.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Nicotiana tabacum
Expected Species:
Arabidopsis thaliana, Cajanus cajan, Cinnamomum micranthum f. kanehirae, Cucumis sativus, Cucurbita maxima, Fagus sylvatica, Glycine max, Jatropha curcas, Morus notabilis, Mucuna pruriens, Parasponia andersonii, Populus alba x tremula, Theobroma cacao, Trema orientale Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Cucurbita maxima UniProt: P24571
Experimental contitions: 5 g of total protein extracted freshly from 3-4 weeks old plant leaves with a blender at 4 C in 300 mM Sorbitol, 50 mM HEPES, 5mM MgCl2. Separated on 10 % SDS-PAGE and blotted 1h to PVDF, semi-dry. Blot was blocked with 6 % milk for 1h 4 C with agitation. Blot was incubated in the primary antibody at a dilution of 1: 1 000 ON at 4 C with agitation. According to South et. al (2019).
Application Details:
1 : 1000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
65 kDa
Not reactive in:
Sorghum bicolor
Selected references:
South et. al (2019). Synthetic glycolate metabolism pathways stimulate crop growth and productivity in the field. Science 2019 Jan 4;363(6422), DOI: 10.1126/science.aat9077
PLGG1 (Plastidal glycolate/glycerate translocator) is a glycolate/glycerate transporter protein required for photorespiration Alternative names of protein: AtLrgB, LrgB, PLGG
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Nicotiana tabacum
Expected Species:
Arabidopsis thaliana, Noccaea caerulescensSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana UniProt: Q9FVQ4
Experimental contitions: 5 g of total protein extracted freshly from 3-4 weeks old plant leaves with a blender at 4 C in 300 mM Sorbitol, 50 mM HEPES, 5mM MgCl2. Separated on 10 % SDS-PAGE and blotted 1h to PVDF, semi-dry. Blot was blocked with 6 % milk for 1h 4 C with agitation. Blot was incubated in the primary antibody at a dilution of 1: 1 000 ON at 4 C with agitation. According to South et. al (2019).
RPS6A (40S ribosomal protein S6-1) is the major substrate of protein kinases in eukaryote ribosomes. Essential during gametogenesis.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Actinidia rufa, Ananas comosus, Beta vulgaris, Cajanus cajan, Capsicum chinense, Citrus clementina, Gossypium australe, Olea europaea subsp. europaea, Oryza sativa, Panicum miliaceum, Populus alba, Sesamum indicum, Senna tora, Solanum lycopersicum, Zea mays, Vigna unguiculataSpecies of your interest not listed? Contact us
RPS6A (40S ribosomal protein S6-1) is the major substrate of protein kinases in eukaryote ribosomes. Essential during gametogenesis.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Actinidia rufa, Ananas comosus, Beta vulgaris, Cajanus cajan, Capsicum chinense, Citrus clementina, Gossypium australe, Olea europaea subsp. europaea, Oryza sativa, Panicum miliaceum, Populus alba, Sesamum indicum, Senna tora, Solanum lycopersicum, Vigna unguiculataSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana RPS6A with phosphorylated Ser237, UniProt: O48549, TAIR: At4g31700
Curvature thylakoid 1B (CURT1B) belongs to a protein family, conserved in plants and cyanobaceria. There are four Arabidopsis thaliana CURT1 proteins: CURT1A,B,C and D. It is proposed that CURT1 proteins modify thylakoid architecture by inducing membrane curvature at grana margins.Alternative names: Photosystem I protein P, Thylakoid membrane phosphoprotein 14 kDa, PSAP
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Nicotiana tabacum, Zea mays Species of your interest not listed? Contact us
Curvature thylakoid 1D (CURT1D) belongs to a protein family, conserved in plants and cyanobaceria. There are four Arabidopsis thaliana CURT1 proteins: CURT1A,B,C and D. It is proposed that CURT1 proteins modify thylakoid architecture by inducing membrane curvature at grana margins.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Nicotiana tabacum, Zea maysSpecies of your interest not listed? Contact us
Curvature thylakoid 1C (CURT1C) belongs to a protein family, conserved in plants and cyanobaceria. There are four Arabidopsis thaliana CURT1 proteins: CURT1A,B,C and D. It is proposed that CURT1 proteins modify thylakoid architecture by inducing membrane curvature at grana margins.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Nicotiana tabacum, Zea maysSpecies of your interest not listed? Contact us
SCE1 (SUMO-conjugating enzyme SCE1) is a SUMO-conjugating enzyme which acts by accepting the SUMO proteins from the E1 SUMO-activating heterodimer SAE1/SAE2 and catalyzes its covalent attachment to other proteins with the E3 SUMO ligases SIZ1 and MMS21. Alternative names: Protein EMBRYO DEFECTIVE 1637, Protein hus5 homolog SUMO-conjugating enzyme 1, AtSCE1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Zea mays
Expected Species:
Cajanus cajan, Cicer arietinum , Corchorus capsularis, Gossypium hirsutum, Litchi chinensis, Medicago truncatula, Morus notabilis, Nelumbo nucifera, Nicotiana benthamiana, Nicotiana tabacum, Nicotiana sylvestris, Noccaea caerulescens, Phoenix dactylifera, Populus canadensis, Prunus yedoensis , Theobroma cacao, Triticum urartu , Zea mays, Zostera marina, Vigna radiataSpecies of your interest not listed? Contact us
Immunogen:
Full length, recombinant SCE1 of Arabidopsis thaliana, UniProt: Q42551-1, TAIR: At3g57870 overexpressed in E.coli
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Saracco et al. (2007). Genetic analysis of SUMOylation in Arabidopsis: conjugation of SUMO1 and SUMO2 to nuclear proteins is essential. Plant Physiol. 2007 Sep;145(1):119-34.
SAE1a (SUMO-activating enzyme subunit 1A) is the dimeric enzyme acts as an E1 ligase for SUMO1 and SUMO2. It mediates ATP-dependent activation of SUMO proteins and formation of a thioester with a conserved cysteine residue on SAE2. Functionally redundant with its paralog SAE1B. Alternative names: SUMO-activating enzyme subunit 1-1, Ubiquitin-like 1-activating enzyme E1A.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Zea mays
Expected Species:
Cajanus cajan, Cicer arietinum, Noccaea caerulescens, Parasponia andersonii, Trema orientale Species of your interest not listed? Contact us
Immunogen:
Recombinant, full length SAE1a of Arabidopsis thaliana, UniProt:Q8VY78-1, TAIR: At4g24940, overexpressed in E.coli
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Saracco et al. (2007). Genetic analysis of SUMOylation in Arabidopsis: conjugation of SUMO1 and SUMO2 to nuclear proteins is essential. Plant Physiol. 2007 Sep;145(1):119-34.
SUMO3 (Small ubiquitin-related modifier 3) is a small polypeptide that becomes covalently attached to various intracellular proteins leading to their post-translational modification.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
Full length SUMO3 of Arabidopsis thaliana, UniProt: Q9FLP5, TAIR: At5g55170
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Kurepa et al. (2003). The small ubiquitin-like modifier (SUMO) protein modification system in Arabidopsis. Accumulation of SUMO1 and -2 conjugates is increased by stress. J Biol Chem. 2003 Feb 28;278(9):6862-72.
NBR1 (Protein NBR1 homolog) is involved in selective autophagy process of damaged organelles, intracellular microbes, protein aggregates, cellular structures and specific soluble proteins. NBR1 mediates the process as an autophagic adapter. The protein has two UBA domains but only the C-terminal UBA domain bound ubiquitin.Alternative names: AtNBR1
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
For the development of sandwich ELISA kit to measure mouse Angiopoietin-1 in cell culture supernatants, cell lysates, serum and plasma (heparin, EDTA).
Product Type:
Antibodies Primary
Storage Temp:
-20°C
Immunogen:
Expression system for standard: NS0; Immunogen sequence: H16-F497
Applications:
ELISA
Additional Info:
For the development of sandwich ELISA kit to measure mouse Angiopoietin-1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).
Biosite Brand:
BioSite ELISA
Species Reactivity:
mouse
Cross Reactivity:
There is no detectable cross-reactivity with other relevant proteins.
ATG16 (Autophagy-related protein 16) may play a role in autophagy process.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
N-terminal part of of ATG16 of Arabidopsis thaliana UniProt: Q6NNP0, TAIR: At5g50230
ATG13a (Autophagy-related protein 13a) is involved in autophagy in a nutritional condition dependent manner. The ATG1-ATG13 protein kinase complex regulates downstream events required for autophagosome enclosure and/or vacuolar delivery. Alternative names: AtAPG13a.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Noccaea caerulescensSpecies of your interest not listed? Contact us
Immunogen:
Full length, recombinant ATG13a of Arabidopsis thaliana protein sequence UniProt: F4IXZ6, TAIR: At3g49590 with N-terminal HIS-tag.
Antibody may also recognise ATG13b; multiple bands observed due to phosphorylation
Application Details:
1 : 1000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
68,4 | 70-80 kDa
Not reactive in:
Oryza sativa
Selected references:
Suttangkakul et al. (2011). The ATG1/ATG13 protein kinase complex is both a regulator and a target of autophagic recycling in Arabidopsis. Plant Cell. 2011 Oct;23(10):3761-79. doi: 10.1105/tpc.111.090993.
ATG12b (Autophagy-related protein 12b) is an Ubiquitin-like protein involved in cytoplasm to vacuole transport (Cvt) and autophagy vesicles formation. Alternative names: Ubiquitin-like protein ATG12B, APG12-like protein b, AtAPG12b.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
Recombinant, full length ATG12b ofArabidopsis thaliana protein sequence UniProt: Q9LVK3-1, TAIR: At3g13970
This antibody may also recognise ATG12a; in wild-type, ATG12 is also conjugated to ATG5
Application Details:
1 : 3000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
10,4 | 12 and 50 kDa in wilde type plants and 12 kDa in some autophagy deficient mutants
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Chung et al. (2010). ATG8 lipidation and ATG8-mediated autophagy in Arabidopsis require ATG12 expressed from the differentially controlled ATG12A AND ATG12B loci. Plant J. 2010 May;62(3):483-93. doi: 10.1111/j.1365-313X.2010.04166.x.
ATG7 (Autophagy-related protein 7) is an E1-like activating enzyme involved in the 2 ubiquitin-like systems required for cytoplasm to vacuole transport (Cvt) and autophagy. Activates ATG12 for its conjugation with ATG5 and ATG8 for its conjugation with phosphatidylethanolamine. Acts in the senescence process, degradation of damaged peroxisomes and non-selective degradation of chlorophylls and photosynthetic proteins during stress-induced leaf yellowing.Alternative names: Ubiquitin-like modifier-activating enzyme atg7, ATG12-activating enzyme E1 atg7, AtAPG7, Protein PEROXISOME UNUSUAL POSITIONING 4.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica rapa, Capsella rubella , Citrus clementina, Noccaea caerulescens Species of your interest not listed? Contact us
Immunogen:
Recombinant ATG7 of Arabidopsis thaliana, UniProt: Q94CD5-1, TAIR: At5g45900, overexpressed in E.coli, collected in inclusion bodies, which were solubilized before immunization
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Doelling et al. (2002). The APG8/12-activating enzyme APG7 is required for proper nutrient recycling and senescence in Arabidopsis thaliana. J Biol Chem. 2002 Sep 6;277(36):33105-14.
Special application note:
Protein name was changed from APG7 to ATG7 after Doelling paper was published.
ATG5 (Autophagy protein 5) is a protein required for autophagy. Involved in a negative feedback loop that modulates NPR1-dependent salicylic acid (SA) signaling and limits senescence and immunity-related programmed cell death (PCD) in plants and a complete proteolysis of chloroplast stroma proteins in senescent leaves, in the degradation of damaged peroxisomes. Alternative names: Protein autophagy 5, AtAPG5.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Solanum lycopersicum, Solanum tuberosum
Immunogen:
Full length, recombinant ATG5 of Arabidopsis thaliana protein sequence UniProt: Q9FFI2-1, TAIR: At5g17290, overexpressed in E.coli
In wild-type plants almost all ATG5 is conjugated to ATG12.This item can be sold containing ProClin
Application Details:
1 : 3000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
38,5 | 50 kDa (in wilde type plants) and ca, 38 kDa in autophagy defective mutants
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Thompson et al. (2005). Autophagic nutrient recycling in Arabidopsis directed by the ATG8 and ATG12 conjugation pathways. Plant Physiol. 2005 Aug;138(4):2097-110.
ATG3 (Autophagy-related protein 3) is a E2 conjugating enzyme responsible for the E2-like covalent binding of phosphatidylethanolamine to the C-terminal Gly of ATG8. This step is required for the membrane association of ATG8. Alternative names: Autophagy-related E2-like conjugation enzyme ATG3, AtAPG3, Protein autophagy 3.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica campestris, Eutrema salsugineum, Helianthus annuus, Nicotiana tabacum, Noccaea caerulescens, Populus trichocarpa, Salvia splendens, Sisymbrium irio, Solanum tuberosum Species of your interest not listed? Contact us
Immunogen:
Full length recombinant ATG3 of Arabidopsis thaliana protein sequence UniProt: Q0WWQ1-1, TAIR: At5g61500, overexpressed in E.coli
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Phillips et al. (2008). The ATG12-conjugating enzyme ATG10 Is essential for autophagic vesicle formation in Arabidopsis thaliana. Genetics. 2008 Mar;178(3):1339-53. doi: 10.1534/genetics.107.086199.
ATG1a (Serine/threonine-protein kinase ATG1a) is a serine/threonine protein kinase involved in autophagy in a nutritional condition-dependent manner. The ATG1-ATG13 protein kinase complex regulates downstream events required for autophagosome enclosure and/or vacuolar delivery. Becomes a target of autophagy under nutrient starvation and connects autophagy to plant nutritional status. Alternative names: Autophagy-related protein 1a, AtAPG1a.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Noccaea caerulescensSpecies of your interest not listed? Contact us
Immunogen:
Full length, N-terminally HIS-tagged ATG1a of Arabidopsis thaliana protein sequence UniProt: Q94C95, TAIR: At3g61960, overexpressed in E.coli and injected as a gel piece
Antibody may also recognise ATG1b and ATG1c; does not recognise ATG1t, Suttangkakul et al. (2011).
Application Details:
1 : 1000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
69,6 | 70 kDa
Not reactive in:
Oryza sativa
Selected references:
Suttangkakul et al. (2011). The ATG1/ATG13 protein kinase complex is both a regulator and a target of autophagic recycling in Arabidopsis. Plant Cell. 2011 Oct;23(10):3761-79. doi: 10.1105/tpc.111.090993.
EIN3 (Ethylene insensitive 3) acts as a positive regulator in the ethylene response pathway and is required for ethylene responsiveness in adult plant tissues. Activated by phosphorylation by MPK3 and MPK6 (PubMed:18273012). Down-regulated by KIN10 that controls its protein stability under a phosphorylation-dependent manner. Alternative names: Protein ethylene insensitive 3.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Populus trichocarpa
Immunogen:
Recombinant EIN3 of Arabidopsis thaliana , UniProt: O24606, TAIR: At3g20770
Western blot condtions for anti-EIN3 antibodies are described in Smalle et al. 2002.Recommended membrane for blocking: nitrocellulose, blocking reagent: 10 % non-fat milk, antibody incubation buffer: PBS-T.
Application Details:
1 : 1000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
71,4 | 78 kDa
Not reactive in:
Medicago truncatula
Selected references:
Park et al. (2023) Ethylene-triggered subcellular trafficking of CTR1 enhances the response to ethylene gas. Nat Commun. 2023;14(1):365. Published 2023 Jan 23. doi:10.1038/s41467-023-35975-6Gagne et al. (2004). Arabidopsis EIN3-binding F-box 1 and 2 form ubiquitin-protein ligases that repress ethylene action and promote growth by directing EIN3 degradation. Proc Natl Acad Sci U S A. 2004 Apr 27;101(17):6803-8.
ABI5 (abscisic acid insensitive 5) is involved in ABA-regulated gene expression during seed development and subsequent vegetative stage and acts as the major mediator of ABA repression of growth. Binds to the embryo specification element and the ABA-responsive element (ABRE) of the Dc3 gene promoter and to the ABRE of the Em1 and Em6 genes promoters. Alternative names: ABI5, ABA INSENSITIVE 5, GIA1, GROWTH-INSENSITIVITY TO ABA 1, Dc3 promoter-binding factor 1, AtDPBF1, GROWTH-INSENSITIVITY TO ABA 1, bZIP transcription factor 39, AtbZIP39.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica oleracea Species of your interest not listed? Contact us
Immunogen:
Recombinant HIS-tagged, full length ABI5 in gel slice, of Arabidopsis thaliana UniProt: Q9SJN0-1, TAIR: At2g36270, overexpressed in E.coli
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Stone et al. (2006). KEEP ON GOING, a RING E3 ligase essential for Arabidopsis growth and development, is involved in abscisic acid signaling. Plant Cell. 2006 Dec;18(12):3415-28.
RAD23c (Ubiquitin receptor RAD23c) binds and presumably selects ubiquitin-conjugates for destruction. Prefers multiubiquitin chains rather than single ubiquitins, with a binding affinity for 'Lys-48'-linked ubiquitin chains. Acts as a ubiquitin receptor that associates with the 26S proteasomal docking subunit RPN10 for the indirect recognition of ubiquitinated substrates of ubiquitin/26S proteasome-mediated proteolysis (UPP). RAD23 proteins play an essential role in the cell cycle, morphology, and fertility of plants through their delivery of UPS (ubiquitin/26S proteasome system) substrates to the 26S proteasome.Alternative names: AtRAD23c, Putative DNA repair protein RAD23-3, RAD23-like protein 3, AtRAD23-3.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
Full length, His-tagged recombinant RAD23c of Arabidopsis thaliana protein sequence, UniProt:Q84L31-1, TAIR: At3g02540, overexpressed in E.coli
Antibodies recognize recombinant RAD23b and RAD23c proteins equally well but do not recognize DSK2a/b orDDI1 based on immunoblot analyses of corresponding mutants Farmer et al. (2010).
Application Details:
1 : 3000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
44,2 | ca, 61 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Farmer et al. (2010). The RAD23 family provides an essential connection between the 26S proteasome and ubiquitylated proteins in Arabidopsis. Plant Cell. 2010 Jan;22(1):124-42. doi: 10.1105/tpc.109.072660.
RAD23b (Rad23 UV excision repair protein family) belongs to radiation Sensitive23 (RAD23) family. Other isoforms are coded by: AT1G16190(RAD23A), AT1G79650(RAD23B), AT3G02540(RAD23C), AT5G38470(RAD23D). RAD23 proteins play an essential role in the cell cycle, morphology, and fertility of plants through their delivery of UPS (ubiquitin/26S proteasome system) substrates to the 26S proteasome. Alternative names: Rad23 UV excision repair protein family, RAD23B.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
Full length, HIS-tagged recombinant Rad23b of Arabidopsis thaliana protein sequence UniProt: F4IF85-1, TAIR: At1g79650, expressed in E.coli and purified under native conditions
This antibody is also recognizing other RAD23 isoforms
Application Details:
1 : 3000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
42,4 | 55 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Farmer et al. (2010). The RAD23 family provides an essential connection between the 26S proteasome and ubiquitylated proteins in Arabidopsis. Plant Cell. 2010 Jan;22(1):124-42. doi: 10.1105/tpc.109.072660.
Reagents: Mouse Albumin Microplate: A 96-well polystyrene microplate (12 strips of 8 wells) coated with a polyclonal antibody against mouse albumin. Sealing Tapes: Each kit contains 3 pre-cut, pressure-sensitive sealing tapes that can be cut to fit the format of the individual assay. Mouse Albumin Standard: Mouse albumin in a buffered protein base (150 ?g, lyophilized). Biotinylated Albumin: 1 vial, lyophilized. MIX Diluent Concentrate (10x): A 10-fold concentrated buffered protein base (30 ml). Wash Buffer Concentrate (20x): A 20-fold concentrated buffered surfactant (30 ml). Streptavidin-Peroxidase Conjugate (SP Conjugate): A 100-fold concentrate (90 ?l). Chromogen Substrate: A ready-to-use stabilized peroxidase chromogen substrate tetramethylbenzidine (8 ml). Stop Solution: A 0.5 N hydrochloric acid to stop the chromogen substrate reaction (12 ml). The minimum detectable dose of albumin is typically 300 ng/ml. Intra-assay and inter-assay coefficients of variation were 4.6% and 7.1% respectively.
Mouse Albumin Microplate: A 96-well polystyrene microplate (12 strips of 8 wells) coated with a polyclonal antibody against mouse albumin. Sealing Tapes: Each kit contains 3 pre-cut, pressure-sensitive sealing tapes that can be cut to fit the format of the individual assay. Mouse Albumin Standard: Mouse Albumin in a buffered protein base (800 ng, lyophilized). Biotinylated Mouse Albumin Antibody (70x): A 70-fold concentrated biotinylated polyclonal antibody against mouse Albumin (120 ul). MIX Diluent Concentrate (10x): A 10-fold concentrated buffered protein base (30 ml). Wash Buffer Concentrate (20x): A 20-fold concentrated buffered surfactant (30 ml). Streptavidin-Peroxidase Conjugate (SP Conjugate): A 100-fold concentrate (90 ul). Chromogen Substrate: A ready-to-use stabilized peroxidase chromogen substrate tetramethylbenzidine (8 ml). Stop Solution: A 0.5 N hydrochloric acid to stop the chromogen substrate reaction (12 ml).
PA200 (Proteasome activator PA200) is an associated component of the proteasome that specifically recognizes acetylated histones and promotes ATP- and ubiquitin-independent degradation of core histones during DNA damage response. It also recognizes and binds acetylated histones via its bromodomain-like (BRDL) region and activates the proteasome by opening the gated channel for substrate entry. Binds to the core proteasome via its C-terminus, which occupies the same binding sites as the proteasomal ATPases, opening the closed structure of the proteasome via an active gating mechanism. involved in DNA damage response: binds to acetylated histones and promotes degradation of histones. Protein levels increase upon exposure of seedlings to MG132, a specific, potent, reversible, and cell-permeable proteasome inhibitor. Alternative names: Proteasome activator subunit 4, Proteasome activating protein 200.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
PA200 antibodies were generated against a partial fragment encompassing residues 840 –1140 Arabidopsis thaliana protein sequence UniProt:F4JC97-1, TAIR: At3g13330
Recommended protein load is 20 g/well, primary antibody dilution: 1: 1000 ON/4 C and optimisation based on obtained result regarding signal/noise ratio,
Application Details:
1 : 500 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
202,9 | ca, 200 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Book et al. (2010). Affinity purification of the Arabidopsis 26 S proteasome reveals a diverse array of plant proteolytic complexes. J Biol Chem. 2010 Aug 13;285(33):25554-69. doi: 10.1074/jbc.M110.136622.
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
Recombinant, full length RPN12a of Arabidopsis thaliana protein sequence UniProt: Q9SGW3-1, TAIR: At1g64520, overexpressed in E.coli
Certain proportion of both wild-type transcript and protein is still produced in the rpn12a -1 mutant, see Figures 2B and 2C Smalle et al. (2002), PVDF membrane instead of nitrocellulose, and use the primary antibody at a 1:3000 dilution in 1% non-fat dry milk in PBS, performing just a 1 hour incubation at room temperature, so those adjustments to the protocol may also help reduce the background and increase signal intensity. Recommended Western blot conditions: protein load: 10-20 g/well, membrane: PVDF membrane, blocking with 10% nonfat milk 1h/RT, antibody incubation buffer: PBS-T. Primary antibody dilution: 1: 3000 in PBS with non-fat dry milk incubation RT/1h, optimisation based on obtained result regarding signal/noise ratio.
Application Details:
1 : 3000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
30,7 | 30 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Smalle et al. (2002). Cytokinin growth responses in Arabidopsis involve the 26S proteasome subunit RPN12. Plant Cell 14, 17-32.
Keyhole limpet hemocyanin (KLH) is a large cooper-containing protein consisting of subunits with MW of 400 kDa. It is found in the hemolymph of the sea mollusk Megathura crenulata. This extracellular respiratory protein has many immunostimulatory properties, including the ability to enhance the host’s immune response by interacting with T cells, monocytes, macrophages, and polymorphonuclear lymphocytes. Since its discovery, KLH has been used primarily as a carrier for vaccines and antigens and as adjuvant treatment in regimens such as antimicrobial therapy.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
Megathura crenulata - most commonly used carrier protein
Antibody can be used as a negative control to determine if observed signal is generated by anti-KLH or anti-peptide antibodies, Due to its large size KLH protein will be very difficult to separate on SDS-PAGE
Application Details:
1: 5 000 (ELISA), 1: 5 000 (WB), 1: 1000 (IL)
Purity:
Immunogen affinity purified serum in PBS, pH 7.4, conjugated to biotin.
Molecular Weight:
ca, 400 kDa/subunit
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Protein present in plant vascular tissue (xylem and vascular cambium) is detected by anti-KLH antibodies (H glund et al. 2002) which might lead to false results in IL when using anti-peptide antibodies generated to KLH-conjugated peptide.
Keyhole limpet hemocyanin (KLH) is a large cooper-containing protein consisting of subunits with MW of 400 kDa. It is found in the hemolymph of the sea mollusk Megathura crenulata. This extracellular respiratory protein has many immunostimulatory properties, including the ability to enhance the host’s immune response by interacting with T cells, monocytes, macrophages, and polymorphonuclear lymphocytes. Since its discovery, KLH has been used primarily as a carrier for vaccines and antigens and as adjuvant treatment in regimens such as antimicrobial therapy.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
Megathura crenulata - most commonly used carrier protein
Antibody can be used as a negative control to determine if observed signal is generated by anti-KLH or anti-peptide antibodies, Due to its large size KLH protein will be very difficult to separate on SDS-PAGE
Application Details:
1: 10 000 (ELISA), 1: 10 000 (WB), 1: 1000 (IL)
Purity:
Immunogen affinity purified serum in PBS pH 7.4, conjugated to HRP.
Molecular Weight:
ca, 400 kDa/subunit
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Protein present in plant vascular tissue (xylem and vascular cambium) is detected by anti-KLH antibodies (H glund et al. 2002) which might lead to false results in IL when using anti-peptide antibodies generated to KLH-conjugated peptide.
Keyhole limpet hemocyanin (KLH) is a large cooper-containing protein consisting of subunits with MW of 400 kDa, It is found in the hemolymph of the sea mollusk Megathura crenulata, This extracellular respiratory protein has many immunostimulatory properties, including the ability to enhance the host's immune response by interacting with T cells, monocytes, macrophages, and polymorphonuclear lymphocytes, Since its discovery, KLH has been used primarily as a carrier for vaccines and antigens and as adjuvant treatment in regimens such as antimicrobial therapy.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 650.
Molecular Weight:
ca, 400 kDa/subunit
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known.
Selected references:
To be added when available. Antibody released in May 2023.
Special application note:
Protein present in plant vascular tissue (xylem and vascular cambium) is detected by anti-KLH antibodies (H glund et al, 2002) which might lead to false results in IL when using anti-peptide antibodies generated to KLH-conjugated peptide.DyLight 650 has Amax = 652 nm, Emax = 672 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
Keyhole limpet hemocyanin (KLH) is a large cooper-containing protein consisting of subunits with MW of 400 kDa, It is found in the hemolymph of the sea mollusk Megathura crenulata, This extracellular respiratory protein has many immunostimulatory properties, including the ability to enhance the host's immune response by interacting with T cells, monocytes, macrophages, and polymorphonuclear lymphocytes, Since its discovery, KLH has been used primarily as a carrier for vaccines and antigens and as adjuvant treatment in regimens such as antimicrobial therapy.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 594.
Molecular Weight:
ca, 400 kDa/subunit
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known,
Selected references:
To be added when available. Antibody released in May 2023.
Special application note:
Protein present in plant vascular tissue (xylem and vascular cambium) is detected by anti-KLH antibodies (H glund et al, 2002) which might lead to false results in IL when using anti-peptide antibodies generated to KLH-conjugated peptide.DyLight 594 has Amax = 593 nm, Emax = 618 nm.DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
Keyhole limpet hemocyanin (KLH) is a large cooper-containing protein consisting of subunits with MW of 400 kDa, It is found in the hemolymph of the sea mollusk Megathura crenulata, This extracellular respiratory protein has many immunostimulatory properties, including the ability to enhance the host's immune response by interacting with T cells, monocytes, macrophages, and polymorphonuclear lymphocytes, Since its discovery, KLH has been used primarily as a carrier for vaccines and antigens and as adjuvant treatment in regimens such as antimicrobial therapy.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 488.
Molecular Weight:
ca, 400 kDa/subunit
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known.
Selected references:
To be added when available. Antibody released in May 2023.
Special application note:
Protein present in plant vascular tissue (xylem and vascular cambium) is detected by anti-KLH antibodies (H glund et al, 2002) which might lead to false results in IL when using anti-peptide antibodies generated to KLH-conjugated peptide.DyLight 488 Amax = 493 nm, Emax = 519 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
Keyhole limpet hemocyanin (KLH) is a large cooper-containing protein consisting of subunits with MW of 400 kDa. It is found in the hemolymph of the sea mollusk Megathura crenulata. This extracellular respiratory protein has many immunostimulatory properties, including the ability to enhance the host’s immune response by interacting with T cells, monocytes, macrophages, and polymorphonuclear lymphocytes. Since its discovery, KLH has been used primarily as a carrier for vaccines and antigens and as adjuvant treatment in regimens such as antimicrobial therapy.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
Megathura crenulata - most commonly used carrier protein
Antibody can be used as a negative control to determine if observed signal is generated by anti-KLH or anti-peptide antibodies. Due to its large size KLH protein will be very difficult to separate on SDS-PAGE.Optimal working dilution has to be determined by end user.
Application Details:
1 : 5 000 (ELISA), 1 : 1000 (IL), 1 : 5 000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4, conjugated to ALP.
Molecular Weight:
ca, 400 kDa/subunit
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Protein present in plant vascular tissue (xylem and vascular cambium) is detected by anti-KLH antibodies (H glund et al. 2002) which might lead to false results in IL when using anti-peptide antibodies generated to KLH-conjugated peptide. Further information about it can be found here.
Keyhole limpet hemocyanin (KLH) is a large cooper-containing protein consisting of subunits with MW of 400 kDa. It is found in the hemolymph of the sea mollusk Megathura crenulata. This extracellular respiratory protein has many immunostimulatory properties, including the ability to enhance the host’s immune response by interacting with T cells, monocytes, macrophages, and polymorphonuclear lymphocytes. Since its discovery, KLH has been used primarily as a carrier for vaccines and antigens and as adjuvant treatment in regimens such as antimicrobial therapy.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Megathura crenulata - most commonly used carrier protein
Antibody can be used as a negative control to determine if observed signal is generated by anti-KLH or anti-peptide antibodies, Due to its large size KLH protein will be very difficult to separate on SDS-PAGE
Application Details:
1: 10 000 (ELISA), 1: 10 000 (WB), 1: 1000 (IL)
Purity:
Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
ca, 400 kDa/subunit
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Geadkaew et al. (2014). Bi-functionality of Opisthorchis viverrini aquaporins. doi:10.1016/j.biochi.2014.11.013.H glund et al. (2002). An Antigen Expressed During Plant Vascular Development Crossreacts with Antibodies Towards KLH (Keyhole Limpet Hemocyanin). J of Histochem & Cytochem. 50:999-1003.
Special application note:
Protein present in plant vascular tissue (xylem and vascular cambium) is detected by anti-KLH antibodies (H glund et al. 2002) which might lead to false results in IL when using anti-peptide antibodies generated to KLH-conjugated peptide.
RPN11 (26S proteasome regulatory subunit RPN11) is a metalloprotease component of the 26S proteasome that specifically cleaves 'Lys-63'-linked polyubiquitin chains. The 26S proteasome is involved in the ATP-dependent degradation of ubiquitinated proteins.Aleternative names: 26S proteasome non-ATPase regulatory subunit 14 homolog, AtRPN11.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Cucumis melo, Medicago truncatula, Noccaea caerulescens Species of your interest not listed? Contact us
Immunogen:
Recomebinant RPN11 of Arabidopsis thaliana, protein sequence UniProt: Q9LT08-1, TAIR: At5g23540, overexpressed in E.coli
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Yang et al. (2004). Purification of the Arabidopsis 26 S proteasome: biochemical and molecular analyses revealed the presence of multiple isoforms. J Biol Chem. 2004 Feb 20;279(8):6401-13.
RPN10 (26S proteasome regulatory subunit RPN10) is playing a role in maintaining the structural integrity of the 19S regulatory particle (RP), subcomplex of the 26S proteasome by the direct and indirect recognition of ubiquitinated substrates of ubiquitin/26S proteasome-mediated proteolysis (UPP). Binds and presumably selects ubiquitin-conjugates for destruction. Plays a role in the growth and development via the proteasome-dependent degradation of the ABA-signaling protein ABI5/DPBF1 and in the balancing cell expansion with cell proliferation rates during shoot development.Alternative names: 26S proteasome non-ATPase regulatory subunit 4 homolog, AtRPN10, 26S proteasome regulatory subunit S5A homolog, Multiubiquitin chain-binding protein 1, AtMCB1, MBP1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Gossypium hirsutum, Noccaea caerulescens, Theobroma cacao Species of your interest not listed? Contact us
Immunogen:
HIS-tagged RPN10 of Arabidopsis thaliana UniProt: P55034-1, TAIR: At4g38630 expressed in E. coli and purified by metal-chelate affinity chromatography
For western blot detection image, please check van Nocker et al. (1996).
Application Details:
1 : 3000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
40,7 | 40 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Huang et al (2021). Parasitic modulation of host development by ubiquitin-independent protein degradation. Cell. 2021 Sep 30;184(20):5201-5214.e12. doi: 10.1016/j.cell.2021.08.029. Epub 2021 Sep 17. PMID: 34536345; PMCID: PMC8525514.van Nocker et al. (1996). Arabidopsis MBP1 gene encodes a conserved ubiquitin recognition component of the 26S proteasome. Proc Natl Acad Sci U S A. 1996 Jan 23;93(2):856-60.
RPN5a | 26S proteasome regulatory subunit, putative (RPN5) is one of two isoforms for the 26S proteasome regulatory protein (RN) subunit RPN5. For many functions it acts redundantly with the paralogous gene RPN5b but also appears to exert independent effects.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Glycine soja, Gossypium arboreum, Juglans regia, Morus notabilis, Noccaea caerulescens, Theobroma cacao Species of your interest not listed? Contact us
Immunogen:
Recombinant RPN5a of Arabidopsis thaliana UniProt:F4KFD7-1, TAIR: At5g09900, overexpressed in E.coli, purified from a gel piece
This antibody is also recognizing RPN5b.Recommended protein load is 20 g/well, primary antibody dilution: 1: 1000 ON/4 C and optimisation based on obtained result regarding signal/noise ratio.
Application Details:
1 : 5000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
52,7 | 50 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Smalle et al. (2002). Cytokinin growth responses in Arabidopsis involve the 26S proteasome subunit RPN12. Plant Cell 14, 17-32.
RPN1a (26S proteasome regulatory subunit RPN1a) Acts as a regulatory subunit of the 26 proteasome which is involved in the ATP-dependent degradation of ubiquitinated proteins (By similarity). Required during embryogenesis and involved in innate immune response, proteasome-mediated ubiquitin-dependent protein catabolic process, protein catabolic process, regulation of cell cycle, regulation of protein catabolic process, response to salicylic acid, ubiquitin-dependent protein catabolic process. Alternative names: 26S proteasome non-ATPase regulatory subunit 2 homolog A, AtRPN1a, 26S proteasome regulatory subunit S2 homolog A.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Recombinant, full length Arabidopsis thaliana RPN1a protein sequence UniProt: Q9SIV2-1, TAIR: At2g20580 overexpressed in E.coli, purified from a gel piece
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Meng, Wang, Hao, et al. (2023) RNA-binding protein MAC5A interacts with the 26S proteasome to regulate DNA damage response in Arabidopsis. Plant Physiol. 2023;191(1):446-462. doi:10.1093/plphys/kiac510Yang et al. (2004). Purification of the Arabidopsis 26 S proteasome: biochemical and molecular analyses revealed the presence of multiple isoforms. J Biol Chem. 2004 Feb 20;279(8):6401-13.
RPT4a (26S proteasome AAA-ATPase subunit RPT4a) is involved in positive regulation of RNA polymerase II transcriptional preinitiation complex assembly, ubiquitin-dependent ERAD pathway, ubiquitin-dependent protein catabolic process. Alternative names: 26S proteasome subunit 10B homolog A, Regulatory particle triple-A ATPase subunit 4a, 26S proteasome regulatory subunit 10B homolog A.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Zea mays
Expected Species:
Actinidia chinensis, Artemisia annua, Capsicum chinense, Cicer arietinum, Helianthus annuus, Medicago truncatula, Nicotiana sylvestris, Noccaea tabacum, Solanum tuberosum, Trifolium pratense, Ricinus communis, Vigna radiata Species of your interest not listed? Contact us
Immunogen:
Full length recombinant RPT4a of Arabidopsis thaliana, UniProt: Q9SEI3-1, TAIR: At5g43010, overexpressed in E.coli
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Marshall et al. (2015). Autophagic Degradation of the 26S Proteasome Is Mediated by the Dual ATG8/Ubiquitin Receptor RPN10 in Arabidopsis. Mol Cell. 2015 Jun 18;58(6):1053-66. doi: 10.1016/j.molcel.2015.04.023.
RPT2a (Regulatory particle triple-A ATPase subunit 2a) is the 26S proteasome subunit. It is required for root meristem maintenance, and regulates gametogenesis. RPT2a is also shown to regulate gene silencing via DNA methylation. Alternative names: 26S proteasome regulatory subunit 4 homolog A Alternative name(s): 26S proteasome AAA-ATPase subunit, RPT2a 26S proteasome subunit 4 homolog A, Protein HALTED ROOT, 26S proteasome regulatory subunit 4 homolog A.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica napus, Cajanus cajan, Gossypium hirsutum, Mucuna pruriens, Noccaea caerulescens, Vigna radiata var. radiata Species of your interest not listed? Contact us
Immunogen:
Recombinant, full lenght RPT2a of Arabidopsis thaliana RPT2a protein sequence UniProt: Q9SZD4-1, TAIR: At4g29040 overexpressed in E.coli, purified from a gel piece
This antibody is also recognizing RPT2b protein. Recommended western blot conditions: SDS-PAGE, transfer to nitrocellulose, blocking 10% non-fat milk. Diluent for both primary and secondary antibodies PBS containing 0.2% Tween 20 and 1% BSA.For an image of western blot detection, refer to: Smalle et al. (2002).
Application Details:
1 : 3000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
49,4 | 50 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Meng, Wang, Hao, et al. (2023) RNA-binding protein MAC5A interacts with the 26S proteasome to regulate DNA damage response in Arabidopsis. Plant Physiol. 2023;191(1):446-462. doi:10.1093/plphys/kiac511Smalle et al. (2002). Cytokinin growth responses in Arabidopsis involve the 26S proteasome subunit RPN12. Plant Cell 14, 17-32.
PBF1 (20S proteasome beta subunit F-1) is a subunit of proteasome, multicatalytic proteinase complex which is characterized by its ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH. Alternative names: Proteasome subunit beta type-1, Proteasome component 5 Proteasome subunit beta type-6, TAS-F22/FAFP98, TAS-G39.20.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
PBA1 (20S proteasome beta subunit A1) is a subunit of proteasome, multicatalytic proteinase complex which is characterized by its ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH. Alternative name: Proteasome subunit beta.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Boussardon, Bag, Juvany, et al. (2022) The RPN12a proteasome subunit is essential for the multiple hormonal homeostasis controlling the progression of leaf senescence. Commun Biol. 2022;5(1):1043. Published 2022 Sep 30. doi:10.1038/s42003-022-03998-2Smalle et al. (2002). Cytokinin growth responses in Arabidopsis involve the 26S proteasome subunit RPN12. Plant Cell 14, 17-32.
PAG1 (20S Proteasome alpha subunit G1) is a component of the 20S core complex of the 26S proteasome. The 26S proteasome is composed of a core protease (CP), known as the 20S proteasome, capped at one or both ends by the 19S regulatory particle (RP/PA700). The 20S proteasome core is composed of 28 subunits that are arranged in four stacked rings, resulting in a barrel-shaped structure. The two end rings are each formed by seven alpha subunits, and the two central rings are each formed by seven beta subunits. Alternative name: 20S proteasome alpha subunit G-1, DiDi 17A-2a, Proteasome component 8, Proteasome subunit alpha type-7.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
Recombinant, full length PAG1 of Arabidopsis thaliana, UniProt: O23715-1, TAIR: At2g27020 overexpressed in E.coli, purified from a gel piece
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Book et al. (2010). Affinity purification of the Arabidopsis 26 S proteasome reveals a diverse array of plant proteolytic complexes. J Biol Chem. 2010 Aug 13;285(33):25554-69. doi: 10.1074/jbc.M110.136622.
PAC1 (20S Proteasome alpha subunit C1) is a component of proteasome complex which has ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH. The process is ATP-dependent. Alternative names: Proteasome subunit alpha type-4-A, 20S proteasome alpha subunit C-1, Proteasome 27 kDa subunit, Proteasome component 9, Proteasome subunit alpha type-3
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C (short tem, months) or at -80°C(long term, years) ; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
Recombinant PAC1 of Arabidopsis thaliana, UniProt: O81148-1, TAIR: At3g22110 , overexpressed in E.coli, purified from a gel piece
Recommended western blot conditions: SDS-PAGE, transfer to nitrocellulose, blocking 10% non-fat milk. Diluent for both primary and secondary antibodies PBS containing 0.2% Tween 20 and 1% BSA.For an image of western blot detection, refer to: Smalle et al. (2002).
Application Details:
1 : 3000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
27,4 | 26 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Smalle et al. (2002). Cytokinin growth responses in Arabidopsis involve the 26S proteasome subunit RPN12. Plant Cell 14, 17-32.
TROL (thylakoid rhodanase-like protein) is an integral membrane component associated to the photosynthetic apparatus of higher plants. TROL is involved in the final step of photosynthetic electron transport by binding a key energy-conversion enzyme ferredoxin: NADP+ oxidoreductase (FNR). This interaction enables direct transfer of photosynthetic electrons from iron-sulphur protein ferredoxin at the stromal site of photosystem I to FNR, which then hands over electrons to NADP+. TROL is located in two distinct chloroplast compartments – in the inner envelope of chloroplasts, in its precursor form; and in the thylakoid membranes, where it is processed completely. Alternative names: Protein THYLAKOID RHODANESE-LIKE1, Sulfurtransferase 4, AtStr4
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
TROL protein can be used as a chloroplast dual-localization marker: for the thylakoids (the major portion of the protein) and the chloroplastic inner envelope. Since the envelopes make a very small portion of the total membranes, the envelope form of TROL is detectable only when isolated envelopes are applied. For AgriseraECLBright and Agrisera matching secondary antibodies goat anti-rabbit HRP conjugated, dilution 1: 25 000 1h/RT incubation (AS09 602), anti-TROL antibodies can be used in dilution of 1:3000.Recommendation: 2 g chlorophyll/well. With increased protein or chlorophyll load/well background bands may be detected. Check here.
Application Details:
1: 1000 - 1 : 3000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
55-60 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Vojta and Fulgosi (2019). Topology of TROL protein in thylakoid membranes of Arabidopsis thaliana. Physiologia Plantarum, Special Issue on: “Photosynthesis”. DOI: 10.1111/ppl.12927
His-Tag is a polyhistidine tag which consists of 6 histidine residues introduced on N- or C-terminus of the protein. The polyhistidine-tag can be used for recombinant protein detection using specific antibodies and it is not conjugated to any dye or enzyme.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
eIF1 (Eukaryotic initiation factor eIF1) is involved in protein biosynthesis.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
eIF5 (Eukaryotic initiation factor eIF5) is involved in protein biosynthesis.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
eIF4A (Eukaryotic initiation factor eIF4A) is involved in protein biosynthesis.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Li et al. (2021) Efficient and high-throughput pseudorecombinant-chimeric Cucumber mosaic virus-based VIGS in maize. Plant Physiol. 2021 Dec 4;187(4):2865-2876. doi: 10.1093/plphys/kiab443. PMID: 34606612; PMCID: PMC8644855.
The optimum working dilution should be established by titration before being used
Purity:
Purified by salt precipitation, followed by a ion-exchange chromatography with DEAE Sepharose, in PBS pH 7.2.
Reconstitution:
For reconstitution add 1 ml of sterile destilled water, Spin down to remove insoluble particles
Special application note:
Does not react with IgG, IgG/Fab fragments and IgM or any non-Ig protein in rat serum.It does not discriminate between serum IgA (monomeric and dimeric) and higher molecular forms such as secretory IgA.
The optimum working dilution should be established by titration before being used
Purity:
Purified by salt precipitation, followed by a ion-exchange chromatography with DEAE Sepharose, in PBS pH 7.2.
Reconstitution:
For reconstitution add 1 ml of sterile destilled water, Spin down to remove insoluble particles
Special application note:
Does not react with any non-Ig protein in rat serum.It does not discriminate between serum IgA (monomeric and dimeric) and higher molecular forms such as secretory IgA.
Has to be determined for each specific application
Purity:
Purified by salt precipitation, followed by a ion-exchange chromatography with DEAE Sepharose, in PBS pH 7.2.
Reconstitution:
For reconstitution add 1 ml of sterile destilled water, Spin down to remove insoluble particles
Special application note:
Does not react with IgG, IgG/Fab fragments and IgM or any non-Ig protein in rat serum.It does not discriminate between serum IgA (monomeric and dimeric) and higher molecular forms such as secretory IgA.
Antioxidant system works as a defense against oxidative stress. SOD (superoxide dismutase) catalyzes the dismutation of superoxide into oxygen and H202,. SODs are classified, according to their metal cofactor, as FeSOD, MnSOD, or Cu / ZnSOD. Chloroplasts generally contain Cu/ZnSOD and, in a number of plant species, FeSOD
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Olea europaea (pollen)
Expected Species:
Ananas ananas, Betula pendula, Camellia sinensis, Citrus sp., Codonis lanceolata, Cucurbita ficifolia, Gossypium sp., Helianthus sp., Hordeum vulgare, Lycopersicum esculentum, Plantago major, Populus trichocarpa, Solanum nigrum, Solanum tuberosum, Solidago sp., Vitis viniferaSpecies of your interest not listed? Contact us
Immunogen:
Full length, recombinant OeCSD1,1,B protein, accession no, EU250769,1
Note: Antibody recognizes two to three isoforms of Cu/Zn SOD in olive pollen depending on the olive cultivar
Application Details:
1 : 1500 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
15.3 | 16 kDa (Olea europaea L.)
Not reactive in:
Marchantia polymorpha
Selected references:
Zafra et al. (2018). Identification of novel superoxide dismutase isoenzymes in the olive (Olea europaea L.) pollen. BMC Plant Biol. 2018 Jun 8;18(1):114. doi: 10.1186/s12870-018-1328-z.
Special application note:
Reaction of the antibody to chloroplastic SOD isoform has not been determined yet
ACO4 (1-aminocyclopropane-1-carboxylate oxidase 4) is an enzyme involved in the ethylene biosynthesis. Alternative names: ACC oxidase,Ethylene-forming enzyme,EFE.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
TIM9 (Mitochondrial import inner membrane translocase subunit TIM9) is a chaperone that participates in the import and insertion of multi-pass transmembrane proteins into the mitochondrial inner membrane. Alternative name: Protein EMBRYO DEFECTIVE 2474
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to 3 years. Re-constituted antibody can be stored at 4°Cfor several days to weeks. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Brassica oleracea
Expected Species:
Arabidopsis thaliana, Cucumis melo, Gossypium hirsutum, Mesembryanthemum crystallinum, Noccaea caerulescens, Oryza sativa, Ostreococcus lucimarinus, Zea mays Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from known protein sequences of higher plant TIM9, including Arabidopsis thaliana UniProt: Q9XGX9, TAIR: At3g46560
TIM8 (Mitochondrial import inner membrane translocase subunit TIM8) is an intermembrane chaperone that participates in the import and insertion of some multi-pass transmembrane proteins into the mitochondrial inner membrane. The TIM8-TIM13 complex mediates the import of some proteins while the predominant TIM9-TIM10 70 kDa complex mediates the import of much more proteins.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to 3 years. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Brassica oleracea
Expected Species:
Arabidopsis thaliana, Brassica rapa, Capsicum baccatum, Cinnamomum micranthum f. kanehirae, Gossypium hirsutum, Handroanthus impetiginosus, Helianthus annuus, Jatropha curcas, Juglans regia, Morus notabilis, Nelumbo nucifera, Nicotiana tabacum, Prunus yedoensis, Theobroma cacao, Solanum chacoense, Vitis vinifera Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from known sequences of higher plant TIM8, including Arabidopsis thaliana UniProt: Q9XGY4, TAIR: At5g50810
AHB1 (Non-symbiotic hemoglobin 1) is involved in a cellular response to hypoxia and displays oxygen carrier activity. Alternative names: ARAth, GLB1, Hb1AHB1, ARATH GLB1, ATGLB1, CLASS I HEMOGLOBIN, GLB1, HB1, HEMOGLOBIN 1, NSHB1, PGB1, PHYTOGLOBIN 1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to 3 years. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Green fluorescent protein (Venus) from Aequorea victoria (Jellyfish), can be mutated to emit at different wavelengths such as blue for BFP (when Tyr-66 is replaced by His), cyan for CFP (when Tyr-66 is replaced by Trp), and yellow for YFP (when THR-203 is replaced by Tyr). It is an energy-transfer acceptor. Its role is to transduce the blue chemiluminescence of the protein aequorin into green fluorescent light by energy transfer.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
VENUS
Immunogen:
Full length, recombinat VENUS protein, expressed in E.coli, UniProt: P42212
Green fluorescent protein (Venus) from Aequorea victoria (Jellyfish), can be mutated to emit at different wavelengths such as blue for BFP (when Tyr-66 is replaced by His), cyan for CFP (when Tyr-66 is replaced by Trp), and yellow for YFP (when THR-203 is replaced by Tyr). It is an energy-transfer acceptor. Its role is to transduce the blue chemiluminescence of the protein aequorin into green fluorescent light by energy transfer.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
VENUS
Immunogen:
Full length, recombinat VENUS protein, expressed in E.coli, UniProt: P42212
Green fluorescent protein (Venus) from Aequorea victoria (Jellyfish), can be mutated to emit at different wavelengths such as blue for BFP (when Tyr-66 is replaced by His), cyan for CFP (when Tyr-66 is replaced by Trp), and yellow for YFP (when THR-203 is replaced by Tyr), It is an energy-transfer acceptor, Its role is to transduce the blue chemiluminescence of the protein aequorin into green fluorescent light by energy transfer.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
VENUS
Immunogen:
Full length, recombinant VENUS protein, expressed in E.coli, UniProt: P42212
Green fluorescent protein (Venus) from Aequorea victoria (Jellyfish), can be mutated to emit at different wavelengths such as blue for BFP (when Tyr-66 is replaced by His), cyan for CFP (when Tyr-66 is replaced by Trp), and yellow for YFP (when THR-203 is replaced by Tyr), It is an energy-transfer acceptor, Its role is to transduce the blue chemiluminescence of the protein aequorin into green fluorescent light by energy transfer.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
VENUS
Immunogen:
Full length, recombinat VENUS protein, expressed in E.coli, UniProt: P42212
Green fluorescent protein (Venus) from Aequorea victoria (Jellyfish), can be mutated to emit at different wavelengths such as blue for BFP (when Tyr-66 is replaced by His), cyan for CFP (when Tyr-66 is replaced by Trp), and yellow for YFP (when THR-203 is replaced by Tyr), It is an energy-transfer acceptor, Its role is to transduce the blue chemiluminescence of the protein aequorin into green fluorescent light by energy transfer.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
VENUS
Immunogen:
Full length, recombinat VENUS protein, expressed in E.coli, UniProt: P42212
Green fluorescent protein (Venus) from Aequorea victoria (Jellyfish), can be mutated to emit at different wavelengths such as blue for BFP (when Tyr-66 is replaced by His), cyan for CFP (when Tyr-66 is replaced by Trp), and yellow for YFP (when THR-203 is replaced by Tyr). It is an energy-transfer acceptor. Its role is to transduce the blue chemiluminescence of the protein aequorin into green fluorescent light by energy transfer.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
VENUS
Immunogen:
Full length, recombinat VENUS protein, expressed in E.coli, UniProt: P42212
Green fluorescent protein (Venus) from Aequorea victoria (Jellyfish), can be mutated to emit at different wavelengths such as blue for BFP (when Tyr-66 is replaced by His), cyan for CFP (when Tyr-66 is replaced by Trp), and yellow for YFP (when THR-203 is replaced by Tyr). It is an energy-transfer acceptor. Its role is to transduce the blue chemiluminescence of the protein aequorin into green fluorescent light by energy transfer.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to 3 years. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
cell lysate overexoressing Venus protein fusion
Immunogen:
Full length, recombinat VENUS protein, expressed in E.coli, UniProt: P42212
TRITC is a bright orange-fluorescent dye. The sensitivity of the TRITC hapten-anti-hapten system makes it a valuable alternative to the biotin-avidin system. This antibody is used to enhance the specific signal obtained with a monoclonal antibody or a polyclonal second antibody conjugated to TRITC.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube. Stort time storage at +4°C.
Host Animal:
Mouse
Species Reactivity:
Tetramethylrhodamine isothiocyanate isomer R
Immunogen:
Highly purified tetramethylrhodamine isothiocyanate isomer R
Applications:
ELISA (ELISA), Immunocytochemistry (ICC), Immunohistochemistry (IHC) paraffin, Dot blot (Dot), Western blot (WB)
TRITC is a bright orange-fluorescent dye. The sensitivity of the TRITC hapten-anti-hapten system makes it a valuable alternative to the biotin-avidin system. This antibody is used to enhance the specific signal obtained with a monoclonal antibody or a polyclonal second antibody conjugated to TRITC.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube. Stort time storage at +4°C.
SUN1,2 (nuclear envelope protein) is a member of the Sad1/UNC-84 (SUN)-domain proteins.SUN domain proteins are part of the cytoskeletal-nucleoskeletal bridging complexes. These proteins are localized to the nuclear envelope and are present as homomers and heteromers in vivo. Involved in maintaining the elongated nuclear shape of epidermal cells.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to 3 years. Re-constituted antibody can be stored at 4°Cfor several days to weeks. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Arabis nemor, Eutrema salsugineum, Microthlaspi erraticum, Noccaea caerulescens Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from N-terminus of SUN1 of Arabidopsis thaliana UniProt: Q9FF75 , TAIR: AT5G04990and SUN2, UniProt: Q9SG79, TAIR: AT3G10730
PHR1 (Phosphate starvation response 1) is nuclear localized and involved in transcription regulation.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to 3 years. Re-constituted antibody can be stored at 4°Cfor several days to weeks. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Hordeum vulgare (recombinant PHR1)
Expected Species:
Aegilops tauschii, Brachypodium distachyon, Dichanthelium oligosanthes, Panicum hallii Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Hordeum vulgare PHR1, UniProt: F4Y5E9
CRY2 (Cryptochrome 2) is a photoreceptor that mediates primarily blue light inhibition of hypocotyl elongation and photoperiodic control of floral initiation, and regulates other light responses: circadian rhythms, tropic growth, stomata opening, guard cell development, root development, bacterial and viral pathogen responses, abiotic stress responses, cell cycles, programmed cell death, apical dominance, fruit and ovule development, seed dormancy, and magnetoreception. (PubMed:21841916).Alternative protein names: Blue light photoreceptor1, Protein PHR homolog 11 AtPHH1, Protein SUPPRESSOR OF elf3 20
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Camelina sativa, Capsella rubellaSpecies of your interest not listed? Contact us
Immunogen:
Part of Arabidopsis thaliana CRY2 protein sequence, UniProt:Q96524, TAIR: At1g04400Antigen used to elicit CR2 antibodies is not conserved in CRY1 protein.
FITC is a fluorochrome dye that absorbs ultraviolet or blue light causing molecules to become excited and emit a visible yellow-green light. This emission ceases upon removal of the light causing the excitation. FITC antibody is used to enhance the specific signal from a monoclonal antibody or a secondary antibody conjugated to FITC. The sensitivity of the FITC hapten-anti-hapten system makes it a useful alternative to other systems.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube. Stort time storage at +4°C.
FITC is a fluorochrome dye that absorbs ultraviolet or blue light causing molecules to become excited and emit a visible yellow-green light. This emission ceases upon removal of the light causing the excitation. FITC antibody is used to enhance the specific signal from a monoclonal antibody or a secondary antibody conjugated to FITC. The sensitivity of the FITC hapten-anti-hapten system makes it a useful alternative to other systems.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube. Stort time storage at +4°C.
FITC is a fluorochrome dye that absorbs ultraviolet or blue light causing molecules to become excited and emit a visible yellow-green light. This emission ceases upon removal of the light causing the excitation. FITC antibody is used to enhance the specific signal from a monoclonal antibody or a secondary antibody conjugated to FITC. The sensitivity of the FITC hapten-anti-hapten system makes it a useful alternative to other systems.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube. Stort time storage at +4°C.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
Host Animal:
Rat
Species Reactivity:
Higher plants, ferns and mosses,Higher plants, ferns and mosses
Pedersen et a. (2012). Versatile high resolution oligosaccharide microarrays for plant glycobiology and cell wall research. J Biol Chem. 2012 Nov 6;287(47):39429-38.doi: 10.1074/jbc.M112.396598.
Special application note:
Contains 0.05% Sodium AzideReacts with grasses, sugar beet and spinach feruloyated polysaccharides. No cross-reactivity with non-feruloylated polymers outside these taxonomic groups
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
Host Animal:
Rat
Species Reactivity:
Higher plants, ferns and mosses
Immunogen:
Polysaccharide Arabinogalactan-protein (AGP) from Oryza sativa
Antibody is recognizing carbohydrate epitope containing Β-linked glucuronic acid.
Application Details:
1:10 (ELISA, IF)
Conjugation:
IgM
Isotype:
IgM
Purity:
Cell culture supernatant.
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Stacey et al. (1990). Patterns of expression of the JIM4 arabinogalactan-protein epitope in cell cultures and during somatic embryogenesis in Daucus carota L Planta. 1990 Jan;180(2):285-92.doi: 10.1007/BF00194009. Knox et al.(1991). Developmentally regulated epitopes of cell surface arabinogalactan proteins and their relation to root tissue pattern formation. Plant J. 1991 ov;1(3):317-326.doi: 10.1046/j.1365-313X.1991.t01-9-00999.x.
Special application note:
Contains 0.05% Sodium Azide.This antibody is made to rice arabinogalactan-proteins (AGPs) and it recognizes a carbohydrate epitope containing B-linked glucuronic acid. In competitive inhibition ELISAs antibody binding to gum arabic was inhibited (50%) by 70 mg/ml 1-O-methyl-B-D-GlcA. The binding of the antibody to AGPs can be fully inhibited by 10 mM 1-O-methyl-B-D-GlcA.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Extensins are a family of flexuous, rodlike, hydroxyproline-rich glycoproteins (HRGPs) of the plant cell wall.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Davies et al. (2010). Induction of extracellular matrix glycoproteins in Brassica petioles by wounding and in response to Xanthomonas campestris. Mol Plant Microbe Interact. 1997 Sep;10(7):812-20.doi: 10.1094/MPMI.1997.10.7.812. Smallwood et al. (1995). An epitope of rice threonine- and hydroxyproline-rich glycoprotein is common to cell wall and hydrophobic plasma-membrane. Planta. 995;196(3):510-22.doi: 10.1007/BF00203651. glycoproteins
Special application note:
Contains 0.05% Sodium Azide.Generated to rice extensin hydroxyproline-rich glycoproteins (HRGPs). The antibody recognises an epitope that is carried by a range of HRGPs of the extensin class.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Marcus et al. (2010). Restricted access of proteins to mannan polysaccharides in intact plant cell walls. Plant J. 2010 Oct;64(2):191-203.doi:0.1111/j.1365-313X.2010.04319.x.
Special application note:
Contains 0.05% Sodium Azide.No cross-reactivity with other polymersThis antibody recognises B-linked mannan polysaccharides of plant cell walls. LM21 binds effectively to B-(1-4)-manno-oligosaccharides from DP2 to DP5.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Glucuronoxylans are hemicellulosic plant cell wall polysaccharides which contains glucuronic acid and xylose.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Cornault et al. (2015). Monoclonal antibodies indicate low-abundance links between heteroxylan and other glycans of plant cell walls. Planta. 2015 ec;242(6):1321-34.doi: 10.1007/s00425-015-2375-4.
Special application note:
Contains 0.05% Sodium Azide.This antibody is made using a complex pectic immunogen. It can recognise glucuronosyl substituted xylans and MeGlcA is not required for recognition.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Xylan is a group of hemicelluloses in plant cells walls and can also be found in some algae.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Xylan is a group of hemicelluloses in plant cells walls and can also be found in some algae.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Xyloglucan is a hemiceullose or polysaccharide that can be found in the primary cell wall.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Pedersen et a. (2012). Versatile high resolution oligosaccharide microarrays for plant glycobiology and cell wall research. J Biol Chem. 2012 Nov 6;287(47):39429-38.doi: 10.1074/jbc.M112.396598.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Xyloglucan is a hemiceullose or polysaccharide that can be found in the primary cell wall.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Pedersen et a. (2012). Versatile high resolution oligosaccharide microarrays for plant glycobiology and cell wall research. J Biol Chem. 2012 Nov 6;287(47):39429-38.doi: 10.1074/jbc.M112.396598.
Special application note:
Contains 0.05% Sodium Azide.Reacts with galactosylated XLLG oligosaccharide motif of plants xyloglucan.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Xyloglucan is a hemiceullose or polysaccharide that can be found in the primary cell wall.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Ruprecht et al. (2017). A Synthetic Glycan Microarray Enables Epitope Mapping of Plant Cell Wall Glycan-Directed Antibodies. Plant Physiol. 2017 Nov;175(3):1094-1104. doi: 10.1104/pp.17.00737.
Special application note:
Contains 0.05% Sodium AzideReacts with the XXXG motif of land plants xyloglucan. This antibody is directed toward the nonreducing end, with the requirement for the second to last Glc to be substituted with an a-1,6-linked Xyl Ruprecht et al. (2017).
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Pectins are the major polysaccharides that build pectic matrix of plant primary cell walls.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
Willam et al. (2004). A xylogalacturonan epitope is specifically associated with plant cell detachment. Planta. 2004 Feb;218(4):673-81.doi: 0.1007/s00425-003-1147-8.
Special application note:
Contains 0.05% Sodium Azide.No known cross-reactivity with other polymers.Does not bind to all xylogalacturonans
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Pectins are the major polysaccharides that build pectic matrix of plant primary cell walls.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Verhertbruggen et al. (2009). Developmental complexity of arabinan polysaccharides and their processing in plant cell walls. Plant J. 2009 Aug;59(3):413-25.doi: 0.1111/j.1365-313X.2009.03876.x.
Special application note:
Contains 0.05% Sodium Azide.Reacts with polysaccharide, rhamnogalacturonan-I (RG-I) The binding could be sensitive to galactosidase action and the epitope could involve galactosyl residue(s) on the rhamnogalacturonan backbones.Recognizes a epitope associated with arabinans and can be generated by arabinofuranosidase action and the loss of arabinosyl residues.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Pectins are the major polysaccharides that build pectic matrix of plant primary cell walls.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term). Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tube.
Host Animal:
Rat
Species Reactivity:
Higher plants, ferns and mosses
Immunogen:
Pectic polysaccharide, alpha-1,5-arabinan, This antibody was isolated from a high throughput screen of many antibodies generated by immunization with a pectic fraction,
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Verhertbruggen et al. (2009). Developmental complexity of arabinan polysaccharides and their processing in plant cell walls. Plant J. 2009 Aug;59(3):413-25.doi: 0.1111/j.1365-313X.2009.03876.x. Moller et al. (2008). High-throughput screening of monoclonal antibodies against plant cell wall glycans by hierarchical clustering of their carbohydrate microarray. inding profiles Glycoconj J. 2008 Jan;25(1):37-48. doi: 10.1007/s10719-007-9059-7.
Special application note:
Contains 0.05% Sodium Azide.Antibody recognition of arabinans increases with arabinofuranosidase action. Binds to a specific subset of pectic arabinans, and to longer stretches of 1,5-linked arabinosyl residues that are likely to be more abundant in unbranched arabinans.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Pectins are the major polysaccharides that build pectic matrix of plant primary cell walls.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term). Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tube.
Host Animal:
Rat
Species Reactivity:
Higher plants, ferns and mosses
Immunogen:
Pectic polysaccharide (alpha-1,5-arabinan). This antibody was isolated from a high throughput screen of many antibodies generated by immunization with a pectic fraction.
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Contains 0.05% Sodium Azide.This antibody is recognizing a (1-5)-alpha-L-arabinan in a similar manner as an antibody to Pectic polysaccharide, alpha-1,5-arabinan (monoclonal, clone LM6). This antibody is an IgM isotype.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Pectins are the major polysaccharides that build pectic matrix of plant primary cell walls.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term). Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tube.
Verhertbruggen et al. (2009). Developmental complexity of arabinan polysaccharides and their processing in plant cell walls. Plant J. 2009 Aug;59(3):413-25.doi: 0.1111/j.1365-313X.2009.03876.x.
Special application note:
Contains 0.05% Sodium AzideNo cross-reactivity with gum arabic. The antibody recognises a linear pentasaccharide in (1-5)-α-L-arabinans. I many species it can also recognise pectic polysaccharides.In some species this antibody could recognize arabinogalactan-proteins (AGPs).In competitive inhibition ELISAs, antibody is binding to: (1-5)-α-L-arabinan was inhibited (50%) by 40 ng/ml (1-5)-α-L-arabinopentaose and 19 ng/ml (1-5)-α-L-arabinohexaose.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Homogalacturonan is a pectic polysaccharide of alpha-1,4 linked galacturonic acid residues. Pectin contains a complex set of polysaccharides that can be found in many primary cell walls.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term). Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Andersen et al. (2016). Characterization of the LM5 pectic galactan epitope with synthetic analogues of -1,4-d-galactotetraose. Carbohydr Res. 2016 Dec ;436:36-40.doi: 10.1016/j.carres.2016.10.012. Jones et al. (1997). Development and validation of an in vitro model system to study peripheral sensory neuron development and injury. Sci Rep. 2018 Oct 29;8(1):15961. doi: 10.1038/s41598-018-34280-3.
Special application note:
Contains 0.05% Sodium Azide.No cross-reactivity with (1-3)-beta-D-galactans or (1-6)-beta-D-galactans.It recognizes a linear tetrasaccharide in (1-4)-beta-D-galactans.In ELISA (competitive inhibition), antibody is binding to: (1-4)-beta-D-galactan was inhibited (50%) by 58 g/ml (1-4)-beta-D-galactotetraose and by 0.7 g/ml lupin (1-4)-beta-D-galactan.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Homogalacturonan is a pectic polysaccharide of alpha-1,4 linked galacturonic acid residues. Pectin contains a complex set of polysaccharides that can be found in many primary cell walls
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term). Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Zhang et al. (2022) Mutation of CESA1 phosphorylation site influences pectin synthesis and methylesterification with a role in seed development, Journal of Plant Physiology, 2022, 153631, ISSN 0176-1617, https://doi.org/10.1016/j.jplph.2022.153631.
Special application note:
Contains 0.05% Sodium AzideThe antibody recognizes a partially methyl-estrified epitope of HG which results from non-blockwise de-estrification processes. The antibody does not bind to un-estrified homogalacuronan.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Homogalacturonan is a pectic polysaccharide of alpha-1,4 linked galacturonic acid residues. Pectin contains a complex set of polysaccharides that can be found in many primary cell walls.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term). Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Clausen et al. (2003). Synthetic methyl hexagalacturonate hapten inhibitors of anti-homogalacturonan monoclonal antibodies LM7, JIM5 and JIM7. Carbohydr Res. 003 Aug 12;338(17):1797-800.doi: 10.1016/s0008-6215(03)00272-6. Knox et al. (1990). Pectin esterification is spatially regulated both within cell walls and between developing tissues of root apices. Planta. 1990 Jul;181(4):512-21.doi: 0.1007/BF00193004.
Special application note:
Contains 0.05% Sodium AzideHas no known cross-reactivity with other polymers.Binds to methyl esterified homogalacturonan.Does not bind to un-esterified homogalacturonan.This antibody is a good marker for pectic homogalacturonan.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Homogalacturonan is a pectic polysaccharide of alpha-1,4 linked galacturonic acid residues. Pectin contains a complex set of polysaccharides that can be found in many primary cell walls.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term). Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Yu et al. (2023) Reduction of pectin may decrease the embryogenicity of grapevine (Vitis vinifera) pro-embryonic masses after 10 years of in vitro culture, Scientia Horticulturae,Volume 309,2023,111690,ISSN 0304-4238,https://doi.org/10.1016/j.scienta.2022.111690.
Special application note:
Contains 0.05% Sodium AzideHas no known cross-reactivity with other polymers.Binds to paritally methyl esterified homogalacturonan and can also bind to un-esterified homogalacturonan.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Homogalacturonan is a pectic polysaccharide of alpha-1,4 linked galacturonic acid residues. Pectin contains a complex set of polysaccharides that can be found in many primary cell walls.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Cell Culture Supernatant
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term). Make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tubes.
No confirmed exceptions from predicted reactivity known at the moment.
Selected references:
Pan, Li, Liu, Qi et al. (2023) Multi-microscopy techniques combined with FT-IR spectroscopy reveals the histological and biochemical causes leading to fruit texture difference in oriental melon (Cucumis melo var. Makuwa Makino), Food Chemistry,Volume 402, 2023,134229, ISSN 0308-8146, https://doi.org/10.1016/j.foodchem.2022.134229.(https://www.sciencedirect.com/science/article/pii/S0308814622021914)Verhertbruggen et al. (2009). An extended set of monoclonal antibodies to pectic homogalacturonan. Carbohydr Res. 2009 Sep 28;344(14):1858-62.doi: 10.1016/j.carres.2008.11.010.
Special application note:
Contains 0.05% Sodium AzideHas no known cross-reactivity with other polymers.Binds to methyl esterified homogalacturonan.Does not bind to un-esterified homogalacturonanl.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Homogalacturonan is a pectic polysaccharide of alpha-1,4 linked galacturonic acid residues. Pectin contains a complex set of polysaccharides that can be found in many primary cell walls.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term). Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Verhertbruggen et al. (2009). An extended set of monoclonal antibodies to pectic homogalacturonan. Carbohydr Res. 2009 Sep 28;344(14):1858-62.doi: 10.1016/j.carres.2008.11.010.
Special application note:
Contains 0.05% Sodium Azide.No known cross-reactivity with other polymers.Binds to partially methyl esterified homogalacturonan but can also bind to un-esterified homogalacturonan
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Homogalacturonan is a pectic polysaccharide of alpha-1,4 linked galacturonic acid residues. Pectin contains a complex set of polysaccharides that can be found in many primary cell walls.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term). Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Pan, Li, Liu, Qi et al. (2023) Multi-microscopy techniques combined with FT-IR spectroscopy reveals the histological and biochemical causes leading to fruit texture difference in oriental melon (Cucumis melo var. Makuwa Makino), Food Chemistry,Volume 402, 2023,134229, ISSN 0308-8146, https://doi.org/10.1016/j.foodchem.2022.134229.(https://www.sciencedirect.com/science/article/pii/S0308814622021914)Marcus et al. (2010). Restricted access of proteins to mannan polysaccharides in intact plant cell walls. Plant J. 2010 Oct;64(2):191-203.doi: 0.1111/j.1365-313X.2010.04319.x.Verhertbruggen et al. (2009). An extended set of monoclonal antibodies to pectic homogalacturonan. Carbohydr Res. 2009 Sep 28;344(14):1858-62.doi: 10.1016/j.carres.2008.11.010.
Special application note:
Contains 0.05% Sodium Azide.Has no known cross-reactivity with other polymers.Binds to unesterified homogalacturonan.The antibody recognizes a range of homogalacturonan samples but binds strongly to un-esterified homogalacturonan.
GST-tag (glutathione S-transferase) is a tag added to a protein of interest as a fusion protein to unable purification and detection. The tag is 220 amino acid long, ca. 26 kDa which makes it quite large compare to Myc or FLAG tags.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Avoid repeated freeze-thaw cycles.
GST-tag (glutathione S-transferase) is a tag added to a protein of interest as a fusion protein to unable purification and detection. The tag is 220 amino acid long, ca. 26 kDa which makes it quite large compare to Myc or FLAG tags.
GST-tag (glutathione S-transferase) is a tag added to a protein of interest as a fusion protein to unable purification and detection. The tag is 220 amino acid long, ca. 26 kDa which makes it quite large compare to Myc or FLAG tags.
GST-tag (glutathione S-transferase) is a tag added to a protein of interest as a fusion protein to unable purification and detection. The tag is 220 amino acid long, ca. 26 kDa which makes it quite large compare to Myc or FLAG tags.
FLAG -tag is a tag that can be added to a protein sequence. It can be used for affinity chromatography, to separate recombinant protein from wt proteins. It can also be used to isolate protein complexes with multiple subunits.
FLAG -tag is a tag that can be added to a protein sequence. It can be used for affinity chromatography, to separate recombinant protein from wt proteins. It can also be used to isolate protein complexes with multiple subunits.
FLAG -tag is a tag that can be added to a protein sequence. It can be used for affinity chromatography, to separate recombinant protein from wt proteins. It can also be used to isolate protein complexes with multiple subunits.
FLAG is a tag that can be added to a protein sequence. It can be used for affinity chromatography, to separate recombinant protein from wt proteins. It can also be used to isolate protein complexes with multiple subunits.
mCherry is derived from DsRed, a red fluorescent protein from so-called disc corals of the genus Discosoma. DsRed is a 223 amino acid ~28kDa protein similar in size and properties to GFP, hoever it produces a red rather than a green fluorochrome. mCherry in its monomeric form is useful for applications such as F rster Resonance Energy Transfer (FRET, also known as Fluorescence Resonance Energy Transfer). The protein is an engineered derivative of one of a family of proteins originally isolated from Cnidarians (jelly fish, sea anemones and corals).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
mCherry
Expected Species:
mScarlett
Immunogen:
Recombinant full length mCherry expressed and purified from E. coli.
In western blot ~28 kDa band is detected corresponding to intact full-length mCherry on HEK293 cells transfected with mCherry vector.Sequence identity between mCherry and original GFP protein is 27%. Antibody does not cross with GFP or eGFP and likely not any of the relatives in western blot.
Application Details:
1 : 250-1 : 500 (ICC), 1 : 500-1 : 1000 (WB)
Purity:
Immunogen affinity purified in PBS pH 7.4, with 3% trehalose.
mCherry is derived from DsRed, a red fluorescent protein from so-called disc corals of the genus Discosoma. DsRed is a 223 amino acid ~28kDa protein similar in size and properties to GFP, however it produces a red rather than a green fluorochrome. mCherry in its monomeric form is useful for applications such as F rster Resonance Energy Transfer (FRET, also known as Fluorescence Resonance Energy Transfer). The protein is an engineered derivative of one of a family of proteins originally isolated from Cnidarians (jelly fish, sea anemones and corals).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
mCherry
Expected Species:
mScarlett
Immunogen:
Recombinant full length mCherry expressed and purified from E. coli.
Applications:
Immunocytochemistry (ICC), Immunofluorescence (IF), Western blot (WB)
YFP (Yellow Fluorescent Protein) is a genetic mutant of green fluorescent protein (GFP). YFP has an excitation peak at 514 nm and emission peak at 527 nm.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Store in small aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Native and denatured forms of GFP and Enhanced Green Fluorescent Protein (EGFP), Yellow Fluorescent Protein (YFP), Enhanced Yellow Fluorescent Protein (EYFP) and Cyan Fluorescent Protein (CFP)
Immunogen:
KLH-conjugated synthetic peptide derived from N-terminal of YFP protein from the jellyfish Aequorea victoria, UniProt:A0A059PIR9
Applications:
ELISA (ELISA), Dot Blot, Immunoprecipitation (IP), Immunolocalization (IL), Western Blot (WB)
HA-tag is derived from a human influenza hemagglutinin HA-molecule corresponding to amino acids 96-106 and is used as a general epitope tag in expression vectors.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Store in small aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
HA-tagged proteins in transfected mammalian cells or expressed under native promoter
Immunogen:
KLH-conjugated synthetic peptide: YPYDVPDYA
Applications:
Immunoprecipitation (IP), Immunolocalization (IL), Western Blot (WB)
Phosphothreonine is a phosphoamino acid and phosphorylated ester of threonine.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C for one year in storage buffer: PBS, 50 % glycerol and 0,01 % sodium azide, Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Antibody detects proteins phosphorylated on threonine residues. Does not cross-react with phosphotyrosine.5 % BSA is recommened to use for blocking as milk contains casein which is a phospho protein.
Immunogen:
KLH-conjugated phosphothreonine
Applications:
ELISA (ELISA), Immunoprecipitation (IP), Immunofluorescence (IF), Immunocytochemistry (ICC), Western blot (WB)
2 g/ml of this antibody is sufficient for detection of phosphorylation signal in western blot using mouse spleen extract treated with Vanadium.Use freshly extracted samples. Precipitate target protein to purify it and avoid cross-reactions.
Application Details:
ELISA (1:2000), ICC/IF (1:60), IP (1:100), WB (1:500)
Purity:
Immunogen affinity purified in PBS, 50% glycerol, 0.01% sodium azide.
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Affinity purified in PBS, pH 7.4 with 0.09 % sodium azide and 50 % glycerol at concentration 0.25 mg/ml. This antibody is recognizing proteins and peptides phosphorylated on threonine residues. There are no cross reactions with phosphotyrosine.
Multi-subunit complex of cytb6/f is a crucial component for the photosynthetic electron transport chain of higher plants, green algae and cyanobacteria. This complex is catalyzing oxidation of quinols and the reduction the reduction of plastocyanin. This reaction allows to establish the proton force required for the ATP synthesis. Four major subunits build the complex: the petA gene product corresponding to a c-type cytochrome (cytf), the petB gene product corresponding to a b-type/c?-type cytochrome with three haems (cyt b6), the petD gene product (subunit IV, or suIV), and the petC gene product, corresponding to the Rieske/Iron/sulfur protein.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to 3 years. Re-constituted antibody can be stored at 4°Cfor several days to weeks. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Acacia prainii, Angelphytum bahiense, Aristolochia promissa, Chlamydomonas reinhardii, Daucus glochidiatus, Dimerostemma brasilianum, Elaphandra paucipunctata, Fraxinus chiisanensis, Gossypium populifolium, Hydrangea heteromalla, Nicotiana sylvestris, Oryza sativa, Salix tetrasperma, Solanum lycopersicum, Thottea siliquosa, Triticum turgidum, Ulva flexuosa, Wedelia biflora, Vanilla aphyllaSpecies of your interest is not listed? Species of your interest not listed? Contact us. Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide chosen from Arabidopsis thaliana PetB protein sequence, UniProt: P56773, TAIR: ATCG00720
Urban, Rogowski & Romanowska (2022), Crucial role of the PTOX and CET pathways in optimizing ATP synthesis in mesophyll chloroplasts of C3 and C4 plants, Environmental and Experimental Botany, Volume 202, October 2022, 105024, https://doi.org/10.1016/j.envexpbot.2022.105027Wada et al. (2021) Identification of a Novel Mutation Exacerbated the PSI Photoinhibition in pgr5/pgrl1 Mutants; Caution for Overestimation of the Phenotypes in Arabidopsis pgr5-1 Mutant. Cells. 2021 Oct 26;10(11):2884. doi: 10.3390/cells10112884. PMID: 34831107; PMCID: PMC8616342.Chen et al. (2021)Degradation of the photosystem II core complex is independent of chlorophyll degradation mediated by Stay-Green Mg2+ dechelatase in Arabidopsis,Plant Science,Volume 307,2021,110902,ISSN 0168-9452,https://doi.org/10.1016/j.plantsci.2021.110902. Lu et al. (2021). Role of an ancient light-harvesting protein of PSI in light absorption and photoprotection. Nat Commun. 2021 Jan 29;12(1):679. doi: 10.1038/s41467-021-20967-1. PMID: 33514722; PMCID: PMC7846763.Wang et al. (2020). Post-translational coordination of chlorophyll biosynthesis and breakdown by BCMs maintains chlorophyll homeostasis during leaf development. Nat Commun. 2020; 11: 1254.
ELF3 (Early Flowering 3) is a transcription factor, which acts within a 'zeitnehmer' feedback loop and is involved in its own circadian regulation and is a part of a corepressor complex consisting of ELF4, ELF3, and LUX involved in the transcriptional regulation of APRR9. The activity of the protein may be decreased in long day conditions due to its interaction with phytochrome B (phyB). ELF3 is also involved in responses to nematode parasitism.Alternative names: Nematode-responsive protein
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles.Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
ELF3 protein is extremely sensitive to light therefore extraction has to be done in green light and protein analysis has to be done using fresh extracts only. Even short light exposure cause degradation of ELF3. Extracted protein cannot be frozen but analysed directly following extraction.Antibody is confirmed to work in ChIP for Oryza sativa Nippon bare.Antibody is recognizing all three isoforms in tomato: Solyc08g065870.4.1: Theoretical pI/Mw: 8.71 / 70659.09 DaSolyc11g070100.2.1: Theoretical pI/Mw: 8.94 / 66714.77 DaSolyc12g095900.2.1: Theoretical pI/Mw: 8.80 / 79108.57 Da
Application Details:
3 l of antibody (ChIP), 3 l of antibody used for coating 2x20 l Dynabeads A+G (IP), 1 : 1000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
77 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Seo et al. (2023) ZTL regulates thermomorphogenesis through TOC1 and PRR5 [published online ahead of print, 2023 Jan 19]. Plant Cell Environ. 2023;10.1111/pce.14542. doi:10.1111/pce.14542Andrade, Lu, Cordeiro, et al. (2022) The evening complex integrates photoperiod signals to control flowering in rice. Proc Natl Acad Sci U S A. 2022;119(26):e2122582119. doi:10.1073/pnas.2122582119Andrade et al. (2022) The evening complex integrates photoperiod signals to control flowering in rice. Proc Natl Acad Sci U S A. 2022 Jun 28;119(26):e2122582119. doi: 10.1073/pnas.2122582119. Epub 2022 Jun 21. PMID: 35733265; PMCID: PMC9245669.
ANN-1 | Annexin-1 displays peroxidase activity and may counteract oxidative stress. Alternative names: ANNAT1, ANX23-ATH, ATOXY5, OXY5, Annexin D1, AnnAt1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana Annexin-1, UniProt Q9SYT0, TAIR AT1G35720
Human TYROBP(TYRO protein tyrosine kinase-binding protein) ELISA Kit
Product Type:
Assay & Detection
Storage Temp:
4°C
Applications:
ELISA
Biosite Brand:
BioSite ELISA
Species Reactivity:
human
UniProt No:
O43914
Cookies:
X
We use cookies to help personalise and improve your web experience.
By using our website you consent to our use of cookies, some of which may have already been set on your device.
View our Cookie Policy to learn more.
