Malate synthase is involved in the synthesis of (S)-malate from isocitrate, where it catalyses the reaction: acetyl-CoA + glyoxylate + H(2)O = (S)-malate + CoA + H(+). This is part of the glyoxylate cycle, which is itself part of carbohydrate metabolism.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Nicotiana tabacum
Expected Species:
Arabidopsis thaliana, Cajanus cajan, Cinnamomum micranthum f. kanehirae, Cucumis sativus, Cucurbita maxima, Fagus sylvatica, Glycine max, Jatropha curcas, Morus notabilis, Mucuna pruriens, Parasponia andersonii, Populus alba x tremula, Theobroma cacao, Trema orientale Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Cucurbita maxima UniProt: P24571
Experimental contitions: 5 g of total protein extracted freshly from 3-4 weeks old plant leaves with a blender at 4 C in 300 mM Sorbitol, 50 mM HEPES, 5mM MgCl2. Separated on 10 % SDS-PAGE and blotted 1h to PVDF, semi-dry. Blot was blocked with 6 % milk for 1h 4 C with agitation. Blot was incubated in the primary antibody at a dilution of 1: 1 000 ON at 4 C with agitation. According to South et. al (2019).
Application Details:
1 : 1000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
65 kDa
Not reactive in:
Sorghum bicolor
Selected references:
South et. al (2019). Synthetic glycolate metabolism pathways stimulate crop growth and productivity in the field. Science 2019 Jan 4;363(6422), DOI: 10.1126/science.aat9077
NdbA (Thylakoid Localized Type 2 NAD(P)H Dehydrogenase) is localized to the thylakoid membrane and expressed at a very low level in the widl type under photoautotrophic growth. NdbA is induced substantially under light-activated heterotophic growth conditions.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Synechocystis sp. PCC 68
Expected Species:
Bacillus subtilis Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from NdbA protein sequence of Synechocystis sp. PCC 6803, UniProt:P73739 Chosen peptide is not conserved in NdbB and NdbC.
Protein extraction: harvested cells were suspended in a buffer containing 50 mM Hepes-NaOH, pH 7,5, 30 mM CaCl2, 800 mM sorbitol, 1 mM ε-amino-n-caproic acid, and the cells were broken by vortexing 6 1 min at 4 C in the presence of glass beads, Protein samples were solubilized in Laemmli buffer containing 6 M urea and separated on a gel in presence of 6M urea
Application Details:
1 : 2000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
49 | 46 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Huokko et al. (2019). Thylakoid Localized Type 2 NAD(P)H Dehydrogenase NdbA Optimizes Light-Activated Heterotrophic Growth of Synechocystis sp. PCC 6803. Plant Cell Physiol. 2019 Mar 7. pii: pcz044. doi: 10.1093/pcp/pcz044.
RPS6A (40S ribosomal protein S6-1) is the major substrate of protein kinases in eukaryote ribosomes. Essential during gametogenesis.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Actinidia rufa, Ananas comosus, Beta vulgaris, Cajanus cajan, Capsicum chinense, Citrus clementina, Gossypium australe, Olea europaea subsp. europaea, Oryza sativa, Panicum miliaceum, Populus alba, Sesamum indicum, Senna tora, Solanum lycopersicum, Vigna unguiculataSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana RPS6A, UniProt: O48549, TAIR: At4g31700 phosphorylated at Ser240
LHCR4 (Protein fucoxanthin chlorophyll a/c protein) is a PSI supercomplex peripheral antenna protein, identified by proteome analysis as type‐R light‐harvesting complexes (LHCr4).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Phaeodactylum tricornutum
Expected Species:
Gambierdiscus australes, Madurella mycetomatisSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Phaeodactylum tricornutum LHCR4, UniProt: B7FQE1
RPSA or 30S ribosomal protein S1 (bacterial) is required for translation of most natural mRNAs.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
bacteria
Immunogen:
KLH-conjugated peptide derived from RPSA of E.coli, UniProt: P0AG67
Alzheimer's disease (AD) is the most prevalent neurodegenerative disease in the growing population of elderly people. A hallmark of AD is the accumulation of plaques in the brain of AD patients. The plaques predominantly consist of aggregates of amyloid-beta (Abeta), a peptide of 39-42 amino acids generated in vivo by specific, proteolytic cleavage of the amyloid precursor protein.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Human
Expected Species:
Bovine, Chicken, Dog, Porcine, Rabbit
Immunogen:
Synthetic peptide chosen from human Abeta (18-30) peptide VFFAEDVGSNKGA
Alzheimer's disease (AD) is the most prevalent neurodegenerative disease in the growing population of elderly people. A hallmark of AD is the accumulation of plaques in the brain of AD patients. The plaques predominantly consist of aggregates of amyloid-beta (Abeta), a peptide of 39-42 amino acids generated in vivo by specific, proteolytic cleavage of the amyloid precursor protein.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Human
Expected Species:
Bovine, Chicken, Dog, Porcine, Rabbit
Immunogen:
Synthetic peptide chosen from human Abeta (1-11) peptide DAEFRHDSGYE
Alzheimer's disease (AD) is the most prevalent neurodegenerative disease in the growing population of elderly people. A hallmark of AD is the accumulation of plaques in the brain of AD patients. The plaques predominantly consist of aggregates of amyloid-beta (Abeta), a peptide of 39-42 amino acids generated in vivo by specific, proteolytic cleavage of the amyloid precursor protein.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Human
Expected Species:
Bovine, Chicken, Dog, Porcine, Rabbit
Immunogen:
Synthetic peptide chosen from human Abeta (1-11) peptide DAEFRHDSGYE
PGRL1 is a transmembrane protein present in thylakoids of higher plants and algae. Arabidopsis plants lacking PGRL1 show perturbation of cyclic electron transport (CEF) around photosystem I (PSI), similar to PGR5-deficient plants. PGRL1 has been shown to interact physically with PGR5 and associate with PSI (DalCorso et al., 2008). In Chlamydomonas reinhardtii, PGRL1 is part of a protein supercomplex, composed of PSI with its own light-harvesting complex (LHCI), the photosystem II light-harvesting complex (LHCII), the cytochrome b6/f complex (Cyt b6f), ferredoxin (Fd)-NADPH oxidoreductase (FNR), responsible of the energy balance of the two photosystems and of the switch between thylakoid linear and cyclic electron transport (Iwai et al., 2010). Synonymes: Ferredoxin-plastoquinone reductase 1
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Dichanthelium oligosanthes, Glycine soja, Gossypium arboreum, Klebsormidium nitens, Nelumbo nucifera, Noccaea caerulescens, Physcomitrium patens, Prunus dulcis, Prunus yedoensis, Rhizophora mucronatamm, Solanum chacoense, Trifolium medium, Zea mays, Vitis viniferaSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana PGRL1A UniProt: Q8H112, TAIR: At4g22890Peptide used to elicit this antibody is conserved in both isoforms PGRL1A and 1B of Zea mays
McKinnon et al. (2020). Membrane Chaperoning of a Thylakoid Protease Whose Structural Stability Is Modified by the Protonmotive Force. Plant Cell DOI: 10.1105/tpc.19.00797
EPYC1 (Essential Pyrenoid Component 1), also known as Lci5, is localizing in the pyrenoid matrix, is of similar abundance as Rubisco and its function is scaffolding for the assembly of Rubisco in the pyrenoid.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardti
Expected Species:
Chlamydomonas reinhardtii
Immunogen:
KLH-conjugated peptide derived from Chlamydomonas reinhardtii EPYC1, C-terminal part UniProt: A0A2K3DA85
CPK1 (CALCIUM-DEPENDENT PROTEIN KINASE1) is a calcium-dependent protein kinase that can phosphorylate phenylalanine ammonia lyase (PAL), a key enzyme in pathogen defense. Alternative names: AtCDPK 1, CDPK 1, Calcium-dependent protein kinase isoform AK1,
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Noccaea caerulescen, Triticum sp. Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana CPK1 protein sequence, UniProt: Q06850-1, TAIR AT5G04870
ERD7 (Early Response to Dehydration ) and its homologs are important for plant stress responses and development and associated with modification of membrane lipid composition.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
To induce detectable levels of ERD7, plants need to be exposed to low temperature of 4 C for 24 h.The protein is detected in the microsomal fraction. (Barajas-Lopez et al, 2021)
Application Details:
1 : 2000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
49 | 58 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Barajas-Lopez et al. (2021) EARLY RESPONSE TO DEHYDRATION 7 Remodels Cell Membrane Lipid Composition during Cold Stress in Arabidopsis. Plant Cell Physiol. 2021 Mar 25;62(1):80-91. doi: 10.1093/pcp/pcaa139. PMID: 33165601.
MC4 (Metacaspase-4) is a cysteine protease that cleaves specifically after arginine or lysine residues. Does not cleave caspase-specific substrates. Plays a positive regulatory role in biotic and abiotic stress-induced programmed cell death. Alternative names: AtMCP2d,Metacaspase 2d
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube. Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Raphanus sativus, Noccaea caerulescensSpecies of your interest not listed? Contact us
Full length MC4 (zMC4) disappears upon wounding, Accumulation of specific lower weight bands of active MC4 subunits, p20) is not detected with this antibody
Application Details:
1 : 1000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
45,5 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
To be added when available, antibody released in November 2020.
FBPase1 (Fructose-1,6-bisphosphatase 1, chloroplastic (chloroplastic marker in photosynthetic tissues) involved in carbohydrate biosynthesis. Alternative names: D-fructose-1,6-bisphosphate 1-phosphohydrolase, HCEF1 (High Cyclic Electron Flow 1).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Abrus precatorius, Actinidia chinensis, Arabis nemorensis, Beta vulgaris, Brassica napus, Capsella rubella, Cephalotus follicularis, Eucalyptus grandis, Gossypium tomentosum, Hibiscus syriacus, Manihot esculenta, Morella rubra, Mucuna pruriens, Nelumbo nucifera, Parasponia andersonii, Populus sp., Prunus dulcis, Prunus persica, Salvia splendens, Syzygium oleaosum, Vitis vinifera Species of your interest not listed? Contact us
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Penzler et al. (2022) Commonalities and specialties in photosynthetic functions of PROTON GRADIENT REGULATION5 variants in Arabidopsis. Plant Physiol. 2022;190(3):1866-1882. doi:10.1093/plphys/kiac362Wang et al. (2022), Arabidopsis Ubiquitin-Conjugating Enzymes UBC4, UBC5, and UBC6 Have Major Functions in Sugar Metabolism and Leaf Senescence, Int. J. Mol. Sci. 2022, 23(19), 11143; https://doi.org/10.3390/ijms231911143Lim et al (2022). Arabidopsis guard cell chloroplasts import cytosolic ATP for starch turnover and stomatal opening. Nat Commun. 2022 Feb 3;13(1):652. doi: 10.1038/s41467-022-28263-2. PMID: 35115512; PMCID: PMC8814037.
BetaCA1 (Beta carbonic anhydrase 1) (chloroplastic) - is a zinc metalloenzyme that interconvert CO2 and HCO3 (-). Alternative names: ARABIDOPSIS THALIANA SALICYLIC ACID-BINDING PROTEIN 3, ATBCA1, ATSABP3, BETA CARBONIC ANHYDRASE 1, CA1, CARBONIC ANHYDRASE 1, SABP3, SALICYLIC ACID-BINDING PROTEIN 3.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Solanum lycopersicum Q5NE20 Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide, derived in the part C-terminus of BetaCA1 of Arabidopsis thaliana, UniProt: P27140, TAIR: At3g01500
Extraction method – Grind 50 mg of leaf tissue in a sterile microcentrifuge tube using a sterile plastic pestle. Add 132μL of Protein Extraction Buffer (1x TE, 1.2 %SDS, 2.7% sucrose, 7.5 μg mL-1 bromophenol blue) to the ground leaf tissue. Vortex the sample and keep on ice for 15 mins. Centrifuge at 14,000 rpm for five minutes using a benchtop centrifuge. Collect the supernatant and in a new sterile 0.5 ml microcentrifuge tube and discard the pellet.This antibody does not recognize betaCA2.
Application Details:
1 : 20 000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
37,5 | 25,3 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
DiMario et al. (2016). The Cytoplasmic Carbonic Anhydrases βCA2 and βCA4 Are Required for Optimal Plant Growth at Low CO2. Plant Physiol. 2016 May;171(1):280-93. doi: 10.1104/pp.15.01990.
CAH6 (Carbonic anhydrase 6) is a zinc-containing metalloenzymes that catalyze the reversible hydration of CO2. There are three evolutionary not related families of carbonic anhydrases: alpha, beta and gamma. CAH6 belonds to the beta family and initially was localized to chloroplasts Mitra et al. (2004).However, lately localization to flagella has been confirmed Mackinder et al. 2017.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii
Expected Species:
Gonium pectorale, Volvox carteriSpecies of your interest not listed? Contact us
Immunogen:
Recombinant, full length CAH6 of Chlamydomonas reinhardtii, excised from the gel, UniProt: Q6S7R9
Lately localization to flagella has been confirmed for CAH6 Mackinder et al. 2017.Extraction method – harvest the cells and add SDS sample buffer.
Mackinder et al. 2017. A Spatial Interactome Reveals the Protein Organization of the Algal CO2-Concentrating Mechanism. Cell. 2017 Sep 21;171(1):133-147.e14. doi: 10.1016/j.cell.2017.08.044.Mitra et al. (2004). Identification of a new chloroplast carbonic anhydrase in Chlamydomonas reinhardtii. Plant Physiol. 2004 May;135(1):173-82.
FNRL | Ferredoxin-NADP+ oxidoreductase-like (FNRs; EC:1.18.1.2) is a member of the plant-type FNR family. It contains a two-domain scaffold that forms the basis of an extended superfamily of flavin adenine dinucleotide (FAD) dependent oxidoreductases. FNRL is soluble protein in chloroplast stroma.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica cretica, Capsella rubella, Eutrema salsugineum, Noccaea caerulescens Species of your interest not listed? Contact us
Guanine nucleotide-binding proteins (G proteins) are involved as modulators or transducers in various transmembrane signalling systems.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Oryza sativa
Expected Species:
Arabidopsis thaliana
Immunogen:
recombinat protein of Oryza sativa expressed in E.coli
PsbE (Cytochrome b559 subunit alpha) is tightly associated with the reaction center of photosystem II (PSII). Alternative name: PSII reaction center subunit V
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Synechocystis PCC 6803
Expected Species:
Bathycoccus prasinos, Capsosiphon fulvescens, Chlamydomonas sp., Gonium pectorale,Mesostigma viride, Microglena monadina, Nannochloropsis granulata,Neglectella solitaria, Ostreococcus tauri, Pandorina morum, Planctonema lauterbornii, Thermosynechococcus vulcanus, Tupiella akineta, Ulva lactuca, Volvulina compacta, Volvox africanus, Yamagishiella unicoccaSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from algal PsbE sequences, including Chlamydomonas reinhardtii PsbE UniProt: P48268
Wheat gliadin is a class of proteins being a main component of gluten fraction and present in wheat and other cereals.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Major allergen Alt a 1 (allergen Alt a 1), ALTA1 is a unique beta-barrel protein dimer found in fungi, Alternaria, most common mold, associated with allergic diseses like asthma.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Major pollen allergen Dac g 4 (allergen Dac g 4) (Fragments) is a grass pollen allergen.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Pollen allergen Dac g 3 with other names: Allergen Dac g III, allergen Dac g 3.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Major allergen Api g 1, isoallergen 2 (Allergen Api g 1.0201) (allergen Api g 1)
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Apium graveolens
Immunogen:
Recombinant Apium graveolens Major allergen Api g 1, isoallergen 2 protein, amino acids: 1-159, UniProt:P92918
Osmotin protein (from thaumatin protein family), coded by a gene AP24. Known to inhibit the germination and growth of the fungus Phytophthora infestans. Protein is induced by: salt stress, ABA viral infection and wounding. Localised to vacuole.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Nicotiana tabacum
Expected Species:
Capsicum annuum, Solanum lycopersicumSpecies of your interest not listed? Contact us
Immunogen:
Recombinant Osmotin derived from Nicotiana tabacum protein sequence, amino acids: 22-246. UniProt: P14170
>95%, Protein G purified to a total immunoglobulin G fraction.
Molecular Weight:
26 | 27 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Preservative: 0.03% Proclin 300. Preparation contains: 50% Glycerol, 10 mM PBS, pH 7.4Reactivity of this antibody on endogenous sample remains to be determined.
L-ascorbate oxidase has oxidoreductase activity and belongs to multicopper oxidase family and is an apoplastic enzyme involved in metabolism of plant ascorbate (AA). Ascorbate (AA) plays a key role in defense against oxidative stress and is particularly abundant in photosynthetic tissues. Over 90% of the ascorbate is localized in the cytoplasm, but a substantial proportion is exported to the apoplast.Alternative names: (ASO) (Ascorbase) (EC 1.10.3.3), AAO
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Cucurbita maxima
Expected Species:
Cucumis melo, Cucumis sativus, Nelumbo nucifera, Theobroma cacao Species of your interest not listed? Contact us
Reactivity of this antibody on endogenous material remains to be determined
Application Details:
1 : 1000 - 1: 5000 (WB)
Purity:
>95%, Protein G purified to a total immunoglobulin G fraction.
Molecular Weight:
65 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Preservative: 0.03% Proclin 300. Preparation contains: 50% Glycerol, 10 mM PBS, pH 7.4Reactivity of this antibody on endogenous material remains to be determined.
Polygalacturonase (PG) is an enzyme (EC 3.2.1.15) involved in cell wall biogenesis and degradation and fruit ripening. Protein is cusing an allergic reaction in human. Alternative names: Allergen Cry j II, Major pollen allergen Cry j 2, Pectinase, allergen Cry j 2.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles.
Cyclin-B1-1 is a cyclin-dependent protein kinase involved in cell division. Functions as an effector of growth contol at G2/M. Alternative names: Cyc1-At, G2/mitotic-specific cyclin-B1-1, CycB1;1, CYCB1-1, CYC1
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica campestris, Capsella rubella, Eutrema salsugineum, Noccaea caerulescensSpecies of your interest not listed? Contact us
Immunogen:
Recombinant Cyclin-B1-1 protein derived from Arabidopsis thaliana sequence, amino acids: 1-428. UniProt: P30183 TAIR: AT4G37490
>95%, Protein G purified to a total immunoglobulin G fraction.
Molecular Weight:
48,4 | 49 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Preservative: 0.03% Proclin 300. Preparation contains: 50% Glycerol, 10 mM PBS, pH 7.4Reactivity of this antibody on endogenous extract remains to be confirmed.
Omega-gliadin is wheat allergen. It is a water-insoluble component of gluten. Omega-gliadin is one of the three main types of gliadin to which body in intolerant in celiac disease.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Triticum monococcum
Expected Species:
Aegilops tauschiiSpecies of your interest not listed? Contact us
Parvalbumin beta causes allergic reaction in humans. Alternative names: Allergen Gad c I, Allergen M
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Gadus morhua subsp. callarias (Baltic cod) (Gadus callarias)
Conglutin (allergen Ara h 6) causes allergic reaction in humans and binds to IgE.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Arachin Ahy-3 is a hexamer, composed of an acidic and a basic chain, derived from a single precursor and linked by a disulfied bond. Belongs to the 11S seed storage protein (globulins) family. Arachin Ahy-3 chain alpha; Arachin Ahy-3 chain beta.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Polygalacturonase (PG) is an enzyme (EC 3.2.1.15) involved in cell wall biogenesis/degradation and food ripening. Belongs to glycoside hydrolase family 28. Alternative names: Pectinase, allergen Cha o 2.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Putative protease Do-like 12 is a mitochondrial enzyme with serine-type endopeptidase avtivity (EC 3.4.21.-) involved in proteolysis. Localized to mitochondrial matrix. Alternative names: Degradation of Periplasmic Proteins 12.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
Recombinant Putative protease Do-like 12 derived from the sequence of Arabidopsis thaliana, amino acids 25-499, UniProt: Q9LK70 TAIR: AT3G16550
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Preservative: 0.03% Proclin 300. Preparation contains: 50% Glycerol, 10 mM PBS, pH 7.4Reactivit of this antibody on endogenous material remains to be determined.
Major pollen allergen Lol p 5a causes an allergic reaction in human - grass pollen ellergy. Alternative names: Allergen Lol p Ib, Allergen Lol p Va, allergen Lol p 5a.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles.Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Lolium perenne
Immunogen:
Recombinant Lolium perenne Major pollen allergen Lol p 5a protein amino acid: 26-307, UniProt: Q40240
Gamma-glutamyl hydrolase is an enzyme (EC 3.4.19.9) displaying gamma-glutamyl-peptidase activity. Alternative names: conjugase) (GH) (Gamma-Glu-X carboxypeptidase)
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Glycine max
Expected Species:
Glycine soja (Gamma-glutamyl hydrolase isoform A and B) Species of your interest not listed? Contact us
OLE9 | Major pollen allergen Ole e 9 is an enzyme (EC 3.2.1.39), which is catalyzing Hydrolysis of (1->3)-beta-D-glucosidic linkages in (1->3)-beta-D-glucans.Alternative names: Glucan endo-1,3-beta-D-glucosidase (Major pollen allergen Ole e 9) (allergen Ole e 9), OLE9
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
ACC synthase 8 belongs to a group fo enzymes which catalyze the conversion of S-adenosyl-L-methionine (SAM) into 1-aminocyclopropane-1-carboxylate (ACC), a direct precursor of ethylene. ACS8 is auxin inducible. Alternative names: 1-aminocyclopropane-1-carboxylate synthase 8, ACC synthase 8, S-adenosyl-L-methionine methylthioadenosine-lyase 8.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C, avoid repeated freeze-thaw cycles. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
P. tricornutum contains only four Lhcx proteins, which are are structurally similar, but are differentially expressed under varying environmental conditions.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Phaeodactylum tricornutum
Expected Species:
Cyclotella cryptica, Cytocella meneghiniana, Durinskia baltica, Fragilariopsis cyclindrus, Thalassioria pseudonana, Pseudo-nitzschia multistriata, Vitrella brassicaformis CCMP3155 Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from C-terminal sequence of Lhcx protein from Phaeodactylum tricornutum. 14 (Lhcx1, Lhcx3), 13 (Lhcx2), and 12 (Lhcx4) out of 15 amino acids long peptide used to elicit this antibody is contained specifically in the C-terminus of the respective Lhcx proteins in P. tricornutum
Lhcx1: 21,95 | 16 kDa Lhcx2: 24,73 | 22 kDa Lhcx3: 22,24 | 17-18 kDa Lhc4: 22,86 | 17-18 kDa However, based on other marker and gel systems, Lhcx1 and Lhcx3/4 may also appear at 18 and 19-20 kDa,
Selected references:
Buck et al. (2021) Identification of sequence motifs in Lhcx proteins that confer qE-based photoprotection in the diatom Phaeodactylum tricornutum. Plant J. 2021 Dec;108(6):1721-1734. doi: 10.1111/tpj.15539. Epub 2021 Nov 3. PMID: 34651379.Buck et al. (2019). Lhcx proteins provide photoprotection via thermal dissipation of absorbed light in the diatom Phaeodactylum tricornutum. Nat Commun. 2019 Sep 13;10(1):4167. doi: 10.1038/s41467-019-12043-6.
PsaG (PSI-G subunit of photosystem I) is a 11-kDa membrane protein that plays an important role in electron transport between plastocyanin and PSI and is involved in the stability of the PSI complex. PSI-G subunit is bound to PSI-B and is in contact with Lhca1. The protein inserts into thylakoids by a direct or "spontaneous" pathway that does not involve the activities of any known chloroplast protein-targeting machinery. PSI-G appears to be directly or indirectly involved in the interaction between Photosystem I and plastocyanin.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Medicago truncatula, Spinacia oleracea, Vitis viniferaSpecies of your interest not listed? Contact us
V-ATPase subunit VHA-a3 The protein is essential component of the vacuolar proton pump (V-ATPase), a multimeric enzyme that catalyzes the translocation of protons across the membranes and required for assembly and activity of the V-ATPase. Involved in vacuolar nutrient storage (e.g. accumulation and storage of nitrate) and in tolerance to some toxic ions (e.g. zinc ions sequestration in vacuoles). Alternative names: V-type proton ATPase 95 kDa subunit a isoform 3, V-ATPase 95 kDa isoform a3, Vacuolar H(+)-ATPase subunit a isoform 3, Vacuolar proton pump subunit a3, Vacuolar proton translocating ATPase 95 kDa subunit a isoform 3.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica campestris, Brassica oleracea, Brassica rapa, Capsella rubella, Eutrema salsugineu, Noccaea caerulescens Species of your interest not listed? Contact us
GLDP (Glycine decarboxylase P protein) catalyzes the degradation of glycine. The P protein binds the alpha-amino group of glycine through its pyridoxal phosphate cofactor. Is involved in response to cadmium ion. Alternative names: AtGLDP1, AtGLDP2, Glycine dehydrogenase (aminomethyl-transferring) 1, Glycine dehydrogenase (aminomethyl-transferring) 2, Glycine cleavage system P protein 1, Glycine cleavage system P protein 2, Glycine decarboxylase 1, Glycine decarboxylase 2, Glycine decarboxylase P-protein 1, Glycine decarboxylase P-protein 2.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
So far only leaf tissue has been used for immunolocalization and western blot experiments
Application Details:
1:50 (IL), 1 : 5000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
113 kDa
Not reactive in:
Tecticornia spp., Salsola soda
Selected references:
Khoshravesh et al. (2020). The Evolutionary Origin of C4 Photosynthesis in the Grass Subtribe Neurachninae.Plant Physiol. 2020 Jan;182(1):566-583. doi: 10.1104/pp.19.00925.
eIF2-alpha (Eukaryotic translation initiation factor 2 subunit alpha) functions in the early steps of protein synthesis by forming a ternary complex with GTP and initiator tRNA. eIF2 is a heterodimer composed of an alpha, beta and gamma chain.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica napus, Brassica oleracea, Camelina sativa, Capsella rubella, Medicago truncatula, Noccaea caerulescens, Papaver somniferum, Raphanus sativus, Tarenaya hasslerianaSpecies of your interest not listed? Contact us
SARS-CoV-2, use its Spike Glycoprotein to attach the viron to its receptor, human angiotensin-converting enzyme 2 (hACE2) and therby mediate membrane fusion and virus entry into the cell.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
SARS-CoV-2 Spike Glycoprotein
Immunogen:
KLH-conjugated peptide derived from UniProt:P0DTC2.
RPB2 (DNA-directed RNA polymerase II subunit 2) is a unique second-largest subunit of DNA-dependent RNA polymerase II. Alternative names: DNA-directed RNA polymerase II 135 kDa polypeptide DNA-directed RNA polymerase II subunit RPB2 (EC:2.7.7.6), RNA polymerase II subunit B2, Protein EMBRYO DEFECTIVE 1989
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Multi-subunit complex of cytb6/f is a crucial component for the photosynthetic electron transport chain of higher plants, green algae and cyanobacteria. This complex is catalyzing oxidation of quinols and the reduction the reduction of plastocyanin. This reaction allows to establish the proton force required for the ATP synthesis. Four major subunits build the complex: the petA gene product corresponding to a c-type cytochrome (cytf), the petB gene product corresponding to a b-type/c’-type cytochrome with three haems (cyt b6), the petD gene product (subunit IV, or suIV), and the petC gene product, corresponding to the Rieske/Iron/sulfur protein.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Lempiainen et al. (2022) Plants acclimate to Photosystem I photoinhibition by readjusting the photosynthetic machinery. Plant Cell Environ. 2022 Oct;45(10):2954-2971. doi: 10.1111/pce.14400. Epub 2022 Aug 16. PMID: 35916195.
Phosphorylation of specific tyrosine residues has been shown to be a primary mechanism of signal transduction during normal mitogenesis, cell cycle progression and oncogenic transformation. Antibodies that specifically recognize phosphorylated tyrosine residues have proved to be invaluable to the study of tyrosine -phosphorylated proteins and the biochemical pathways in which they function.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Phosphotyrosine - not species dependent
Immunogen:
balbC mice immunized with phosphotyrosine coupled to carrier protein
Applications:
ELISA (ELISA), Immunohistochemistry (IHC), Immunoprecipitation (IP), Western blot (WB)
Chicken anti-DYKDDDDK is a primary antibody which binds to DYKDDDDK (Sigma FLAG ).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
DYKDDDDK epitope tag (Sigma FLAG )
Immunogen:
KLH-conjugated synthetic peptide: DYKDDDDK (Sigma FLAG ).
Applications:
ELISA (ELISA), Immunofluorsescence (IF), Western blot (WB)
Antibody was analyzed using amino-terminal Met-Flag-BAP, amino- terminal FLAG-BAP and carboxy-terminal FLAG-BAP fusion proteins and Invitrogen Positope R900-40
Beta-Actin is a conserved protein involved in cell motility, structure and integrity, tissue development and the development of organism. Actin is expressed at high levels in almost all tissues and cell lines. This makes it ideal to use as a loading control in Western blot.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store at -20 °C for 3 years or more, Reconstitute with distilled water to desired concentration before use, Aliquot to avoid repeated freeze-thaw cycles, Store aliquots at 4°Cfor several days to weeks
Host Animal:
Mouse
Species Reactivity:
Chicken, human, mouse, rabbit, rat
Immunogen:
Synthetic peptide derived from the N-terminal of the human beta-actin
Applications:
Dot blot (Dot), ELISA (ELISA), Immunohistochemistry (IHC), Western blot (WB)
Beta-tubulin is a conserved protein involved in cell motility, structure and integrity, tissue development and the development of organism. Tubulin is expressed at high levels in almost all tissues and cell lines. This makes it ideal to use as a loading control in Western blot.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store at -20 °C for 3 years or more, Reconstitute with distilled water to desired concentration before use, Aliquot to avoid repeated freeze-thaw cycles, Store aliquots at 4°Cfor several days to weeks
Host Animal:
Mouse
Species Reactivity:
Chicken, human, monkey, mouse, rat, rabbit
Immunogen:
Synthetic peptide derived from the N-terminal of the human beta-tubulin
Applications:
Dot blot (Dot), ELISA (ELISA), Immunohistochemistry (IHC), Western blot (WB)
SARS-CoV-2/ 2019-nCoV S protein of Novel Coronavirus (human) its role is to attache the virion to the cell membrane by interacting with host receptor (ACE2) and initiating the infection. Alternative names: S, S1, S1-RBD, Spike glycoprotein.
Product Type:
Antibody
Antibody Type:
Monoclonal recombinant
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Human Novel SARS-CoV-2/ 2019-nCoV S protein
Immunogen:
Recombinant Human Novel Coronavirus Spike glycoprotein (S) (16-685aa), UniProt: P0DTC2 Antigen sequence has highest homology to Spike protein S1.
Recombinant anti-SARS-CoV-2 spike Mouse ScFv is expressed in 293 cells (HEK293) with a human IgG1 Fc tag on C-terminal. Therefore, anti-human IgG1 Fcγ (gamma chain), secondary antibody has to be used: AS20 4390
Nucleaoprotein (N) of Novel Coronavirus SARS-CoV-2/ 2019-nCoV (human) plays a fundamental role during virion assembly through packaging of the positive strand viral genome RNA into a helical ribonucleocapsid (RNP).Alternative names: NC, Protein N, Nucleocapsid protein
Product Type:
Antibody
Antibody Type:
Monoclonal recombinant (clone 1A6)
Format:
Liquid
Storage Temp:
Store at -20 °C or -80 C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Human Nucleoprotein (N) of Novel Coronavirus SARS-CoV-2/ 2019-nCoV
Immunogen:
Recombinant Human Novel Coronavirus Nucleoprotein (N) (1-419aa), UniProt: P0DTC9
Recombinant anti-SARS-CoV-2 Nucleoprotein Mouse ScFv were expressed in 293 cells (HEK293) with a human IgG1 Fc tag on C-terminal. Therefore, anti-human IgG1 Fc, secondary antibody has to be used: AS10 791 | Anti-Human IgG Fc, HRP conjugated, goat antibodiesAS10 797 | Anti-Human IgG Fc, HRP conjugated, min. cross-reactivity bovine/mouse/rabbit serum, goat antibodiesAS10 787 | Anti-Human IgG Fc, ALP conjugated, goat antibodies AS10 793 | Anti-Human IgG Fc, ALP conjugated, min. cross-reactivity to bovine/mouse/rabbit serum, goat antibodies
Nucleaoprotein (N) of Novel Coronavirus SARS-CoV-2/ 2019-nCoV (human) plays a fundamental role during virion assembly through packaging of the positive strand viral genome RNA into a helical ribonucleocapsid (RNP).Alternative names: NC, Protein N, Nucleocapsid protein
Product Type:
Antibody
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C/-80°C. Reconstitute in deionized sterile water to a concentration from 0.1-1.0 mg/ml and add 5-50% of glycerol (final concentration). 50 % glycerol is a default final recommended concentration. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube. Working aliquotes can be stored at 4℃ for up to one week.Shelf life of liquid form is 6 monthss at -20 °C/-80°C. The shelf life of lyophilized form is 12 months at -20 °C/-80°C.
N-terminal His tagged Nucleoprotein (N) (6xHis) was overexpressed in E.coli in the region 1-419 amino acids UniProt P0DTC9: MSDNGPQNQRNAPRITFGGPSDSTGSNQNGERSGARSKQRRPQGLPNNTASWFTALTQHGKEDLKFPRGQGVPINTNSSPDDQIGYYRRATRRIRGGDGKMKDLSPRWYFYYLGTGPEAGLPYGANKDGIIWVATEGALNTPKDHIGTRNPANNAAIVLQLPQGTTLPKGFYAEGSRGGSQASSRSSSRSRNSSRNSTPGSSRGTSPARMAGNGGDAALALLLLDRLNQLESKMSGKGQQQQGQTVTKKSAAEASKKPRQKRTATKAYNVTQAFGRRGPEQTQGNFGDQELIRQGTDYKHWPQIAQFAPSASAFFGMSRIGMEVTPSGTWLTYTAAIKLDDKDPNFKDQVILLNKHIDAYKTFPPTEPKKDKKKKADETQALPQRQKKQQTVTLLPAADLDDFSKQLQQSMSSADSTQA Purity: >90 % as confirmed by SDS-PAGEBuffer: 0.2 μm filtered 20 mM Tris-HCl, 0.5 M NaCl, 6% Trehalose, pH 8.0
Nucleaoprotein (N) of Novel Coronavirus SARS-CoV-2/ 2019-nCoV (human) plays a fundamental role during virion assembly through packaging of the positive strand viral genome RNA into a helical ribonucleocapsid (RNP).Alternative names: NC, Protein N, Nucleocapsid protein
Product Type:
Antibody
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C/-80°C. Reconstitute in deionized sterile water to a concentration from 0.1-1.0 mg/ml and add 5-50% of glycerol (final concentration). 50 % glycerol is a default final recommended concentration. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube. Working aliquotes can be stored at 4℃ for up to one week.Shelf life of liquid form is 6 monthss at -20 °C/-80°C. The shelf life of lyophilized form is 12 months at -20 °C/-80°C.
N-terminal His tagged Nucleoprotein (N) (6xHis) was overexpressed in E.coli in the region 1-419 amino acids UniProt P0DTC9: MSDNGPQNQRNAPRITFGGPSDSTGSNQNGERSGARSKQRRPQGLPNNTASWFTALTQHGKEDLKFPRGQGVPINTNSSPDDQIGYYRRATRRIRGGDGKMKDLSPRWYFYYLGTGPEAGLPYGANKDGIIWVATEGALNTPKDHIGTRNPANNAAIVLQLPQGTTLPKGFYAEGSRGGSQASSRSSSRSRNSSRNSTPGSSRGTSPARMAGNGGDAALALLLLDRLNQLESKMSGKGQQQQGQTVTKKSAAEASKKPRQKRTATKAYNVTQAFGRRGPEQTQGNFGDQELIRQGTDYKHWPQIAQFAPSASAFFGMSRIGMEVTPSGTWLTYTAAIKLDDKDPNFKDQVILLNKHIDAYKTFPPTEPKKDKKKKADETQALPQRQKKQQTVTLLPAADLDDFSKQLQQSMSSADSTQA Purity: >90 % as confirmed by SDS-PAGEBuffer: 0.2 μm filtered 20 mM Tris-HCl, 0.5 M NaCl, 6% Trehalose, pH 8.0
Goat anti-human IgG Fcγ is a secondary antibody conjugated to HRP which binds to human IgG Fcγ (gamma chain) in immunological assays.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80°C. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
PGDH3 | Phosphoglycerate dehydrogenase 3 (chloroplastic) is an enzyme ((EC:1.1.1.95) involved in the plastidial phosphorylated pathway of serine biosynthesis (PPSB), step 1 of the subpathway that synthesizes L-serine from 3-phospho-D-glycerate. Expressed in aerial parts. Not detected in roots and meristematic tissue. Expressed in cotyledons, adult leaves, stigma and anther filaments.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Beside PGDH3 the antibody is recognizing in Arabidopsis thaliana PGDH1, UniProt: O49485-1 and PGDH2, UniProt: O04130-2
Application Details:
1 : 3000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
62,1 | 55-60 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
H hner et al. (2021) Stromal NADH supplied by PHOSPHOGLYCERATE DEHYDROGENASE3 is crucial for photosynthetic performance. Plant Physiology. 2021. kiaa117, https://doi.org/10.1093/plphys/kiaa117
COP1 (E3 ubiquitin-protein ligase COP1) is onvolved in proteasome-mediated ubiquitin-dependent protein catabolic process and protein ubiquitination. The protein contains a ring finger zinc-binding motif, a coiled-coil domain, and several WD-40 repeats, similar to G-beta proteins. Acts as a repressor of photomorphogenesis and as an activator of etiolation in darkness. Represses photomorphogenesis in darkness by mediating ubiquitination and subsequent proteasomal degradation of light-induced transcription factors such as HY5, HYH and LAF1. Localized in the nucleus in darkness but is gradually relocated to the cytoplasm upon illumination. Alternative names: Constitutive photomorphogenesis protein 1, RING-type E3 ubiquitin transferase COP1
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica napus, Brassica rapa, Camelina sativa, Capsella rubella, Eutrema salsugineum, Hirschfeldia incana, Raphanus sativusSpecies of your interest not listed? Contact us
Immunogen:
His-tagged recombinant part of COP1 protein from Arabidopsis thaliana, overexpressed in E.coli, UniProt: P43254, TAIR: AT2G32950
VSP29 (Vacuolar protein sorting-associated protein 29) plays a role in vesicular protein sorting. Component of the membrane-associated retromer complex which is essential in endosome-to-Golgi retrograde transport. Required for the auxin-carrier protein PIN2 sorting to the lytic vacuolar pathway and the PIN1 recycling to the plasma membrane. Also involved in the efficient sorting of seed storage proteins globulin 12S and albumin 2S. The VPS29-VPS26-VPS35 subcomplex may be involved in recycling of specific cargos from endosome to the plasma membrane. Cellular localisation: endosome and Golgi apparatus.Alternative names: MAIGO1, Vesicle protein sorting 29
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
21 | 25 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Yamazaki et al. (2008). Arabidopsis VPS35, a retromer component, is required for vacuolar protein sorting and involved in plant growth and leaf senescence. Plant Cell Physiol. 2008 Feb;49(2):142-56. doi: 10.1093/pcp/pcn006. (Immunoprecipitation, Western blot, Arabidopsis thaliana)Shimada et al. (2006). et al. (2006). AtVPS29, a putative component of a retromer complex, is required for the efficient sorting of seed storage proteins. Plant Cell Physiol. 2006 Sep;47(9):1187-94. doi: 10.1093/pcp/pcj103. (Western blot, Arabidopsis thaliana)
VPS35 (Vacuolar Protein Sorting-associated protein 35) plays a role in vesicular protein sorting. Component of the membrane-associated retromer complex which is essential in endosome-to-Golgi retrograde transport. Also involved in the efficient sorting of seed storage proteins globulin 12S and albumin 2S. The VPS29-VPS26-VPS35 subcomplex may be involved in recycling of specific cargos from endosome to the plasma membrane. Arabidopsis thaliana has three VPS35 homologs designated VPS35a, VPS35b and VPS35c, and among them,VPS35b plays most important role in these processes. Localised to pre-vacuolar compartments (PVC).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
89 | 98 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Yamazaki et al. (2008). Arabidopsis VPS35, a retromer component, is required for vacuolar protein sorting and involved in plant growth and leaf senescence. Plant Cell Physiol. 2008 Feb;49(2):142-56. doi: 10.1093/pcp/pcn006. (Immunofluorescence, Immunoprecipitation, Western blot)
Major 12S seed storage protein CRC (globulin) is synthesized on the endoplasmic reticulum as precursor and then transported to storage vacuoles, where it is processed at a conserved Asn-Gly peptide bond by an asparaginyl endopeptidase to produce two mature polypeptides referred to as alpha and beta subunits that are joined together by a disulfide bond. Phosphorylated in seeds on some Tyr residues in response to abscisic acid (ABA). 12S CRC protein is cleaved to alpha and beta chains. Cellular localisation: vacuole.Alternative protein names: Cruciferin 3, Cruciferin C Legumin-type globulin Cruciferin1, Legumin-type globulin storage protein CRU1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Native, 12S globulin alpaha subunit purified from Arabidopsis thaliana and excised from SDS-PAGE gel. UniProt: Q96318, TAIR: At4g28520
Applications:
ELISA (ELISA), Immunolocalization (IL) using electron microscopy, Immunohistochemistry (IHC), Western blot (WB)
Assay dependent (ELISA), 1: 50 (IL by electron microscopy), 1: 100 (IHC), 1: 3000 - 1: 10 000 (WB)
Purity:
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
58 | 30 kDa (alpha subunit)
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Shirakawa et al. (2014). CONTINUOUS VASCULAR RING (COV1) is a trans-Golgi network-localized membrane protein required for Golgi morphology and vacuolar protein sorting. Plant Cell Physiol. 2014 Apr;55(4):764-72.doi: 10.1093/pcp/pct195. (Immunohistochemistry, Western blot)Li et al. MAG2 and three MAG2-INTERACTING PROTEINs form an ER-localized complex to facilitate storage protein transport in Arabidopsis thaliana. Plant J. 2013 Dec;76(5):781-91.doi: 10.1111/tpj.12347. (Immunolocalisation by electron microscopy, Western blot)
2S seed storage protein 3, one of major seed storage proteins is synthesized on the endoplasmic reticulum as precursor and then transported to storage vacuoles, where it is processed by an asparaginyl endopeptidase to produce two mature polypeptides referred to as large and small subunits which are linked by disulfide bonds. Subcellular localisation: vacuole.Alternative names: 2S albumin storage protein, NWMU2-2S albumin 3
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Capsella rubella Species of your interest not listed? Contact us
Immunogen:
Conjugated peptide, derived of Arabidopsis thaliana 2S3 large subunit, UniProt: P15459, TAIR: At4g27160
Applications:
ELISA (ELISA), Immunolocalization (IL) using electron microscopy, Western blot (WB)
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
18, 7 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Takagi et al. (2013). MAIGO5 functions in protein export from Golgi-associated endoplasmic reticulum exit sites in Arabidopsis. Plant Cell . 2013 Nov;25(11):4658-75. doi: 10.1105/tpc.113.118158. (Immunolocalisation by electron microscopy, Western blot, Arabidopsis thaliana)
2S seed storage protein 3, one of major seed storage proteins is synthesized on the endoplasmic reticulum as precursor and then transported to storage vacuoles, where it is processed by an asparaginyl endopeptidase to produce two mature polypeptides referred to as large and small subunits which are linked by disulfide bonds. Subcellular localisation: vacuole.Alternative names: 2S albumin storage protein, NWMU2-2S albumin 3
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Conjugated peptide, derived from N-propeptide of Arabidopsis thaliana 2S3P, UniProt: P15459, TAIR: At4g27160
Applications:
ELISA (ELISA), Immunolocalization (IL) using electron microscopy, Western blot (WB)
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
18,7 | 17-20 kDa (2S albumin precursors)
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Shirakawa et al. (2014). CONTINUOUS VASCULAR RING (COV1) is a trans-Golgi network-localized membrane protein required for Golgi morphology and vacuolar protein sorting. Plant Cell Physiol. 2014 Apr;55(4):764-72. doi: 10.1093/pcp/pct195. (Western blot, Arabidopsis thaliana) Li et al. (2006). MAIGO2 is involved in exit of seed storage proteins from the endoplasmic reticulum in Arabidopsis thaliana. Plant Cell. 2006 Dec;18(12):3535-47. doi: 10.1105/tpc.106.046151.( Immunolocalisation by electron microscopy, Western blot, Arabidopsis thaliana)
Aleu protein may play a role in proteolysis leading to mobilization of nitrogen during senescence and starvation. Catalytic activity : Hydrolysis of proteins, acting as an aminopeptidase (notably, cleaving Arg-|-Xaa bonds) as well as an endopeptidase. Cellular localisation: vacuole. Alternative names: Senescence-associated gene product 2
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica oleracea, Camelina sativa, Capsella rubella, Eutrema salsugineum, Raphanus sativus Species of your interest not listed? Contact us
Immunogen:
Recombinant, His6-tagged, ALEU protein from Arabidopsis thaliana, UniProt: Q8H166, TAIR: At5g60360
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
38,9 | 24 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Takagi et al. et al. (2013). MAIGO5 functions in protein export from Golgi-associated endoplasmic reticulum exit sites in Arabidopsis. Plant Cell. 2013 Nov;25(11):4658-75. doi: 10.1105/tpc.113.118158. (Western blot, Arabidopsis thaliana)Ueda et al. (2006). AtVAM3 is required for normal specification of idioblasts, myrosin cells. Plant Cell Physiol. 2006 Jan;47(1):164-75. doi: 10.1093/pcp/pci232. (Western blot, Arabidopsis thaliana)
Vacuolar-sorting receptor (VSR) involved in clathrin-coated vesicles sorting from Golgi apparatus to vacuoles. Required for the sorting of 12S globulin, 2S albumin and maybe other seed storage proteins to protein storage vacuoles (PSVs) in seeds. May also be implicated in targeting N-terminal propeptide containing proteins to lytic vacuoles. Subcellular localisation: Golgi apparatus membrane.Alternative names: BP80-like protein b, Epidermal growth factor receptor-like protein 1, AtELP, AtELP1, Spot 3 protein
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Nicotiana tabacum
Expected Species:
Brassica rapa, Capsella rubella, Camelina sativa, Eutrema salsugineum, Raphanus sativus, Tarenaya hassleriana Species of your interest not listed? Contact us
Immunogen:
Recombinant, His6-tagged, VSR1 from Arabidopsis thaliana, UniProt: P93026, TAIR: At3g52850
Higher apparent molecular weight of VSR1 is due to three determined glycosylations and several more predicted
Application Details:
1: 500 (IF), 1: 1000-1: 5000 (WB)
Purity:
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
68 | 80 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Fuji et al. (2016). The Adaptor Complex AP-4 Regulates Vacuolar Protein Sorting at the trans-Golgi Network by Interacting with VACUOLAR SORTING RECEPTOR1. Plant Physiol. 2016 Jan;170(1):211-9. doi: 10.1104/pp.15.00869. (Western blot, Arabidopsis thaliana) Kunieda et al. (2013). Spatiotemporal secretion of PEROXIDASE36 is required for seed coat mucilage extrusion in Arabidopsis. Plant Cell. 2013 Apr;25(4):1355-67. doi: 10.1105/tpc.113.110072. (Western blot, Arabidopsis thaliana)Yamada et al. (2005). Endosomal proteases facilitate the fusion of endosomes with vacuoles at the final step of the endocytotic pathway. Plant J. 2005 Mar;41(6):888-98. doi: 10.1111/j.1365-313X.2005.02349.x. (Immunofluorescence, Nicotiana tabacum)
Delta VPE (Vacuplar-Processing Enzyme delta-isozyme) is Asparagine specific endopeptidase that may be involved in processing of proteins targeted to vacuoles (By similarity). The enzyme is probably involved in post-translational proteolysis of seed storage proteins in the protein storage vacuole of developing seeds (PubMed:12417707, PubMed:14688293). Exhibits a caspase-1-like activity in extracellular granules. At the early stage of seed development, required for the formation of the seed coat, by regulating cell death of specific cell layers in inner integument (Nakaune et al. 2005).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Camelina sativa, Capsella rubella, Eutrema salsugineum, Raphanus sativus Species of your interest not listed? Contact us
Immunogen:
Recombinant, His6-tagged, delta-VPE from Arabidopsis thaliana, UniProt: Q9LJX8, TAIR: At3g20210
Applications:
Immunofluorescence (IF), Immunolocalisation (IL), Western blot (WB)
Subcellular localisation is seed specific and restricted to developing seeds at 7 days after anthesis, Delta-VPE is detected at lower levels in flowers siliques, specifically in seed coats
Application Details:
1: 500 (IF), 1: 5000 (IL), 1: 5000 (WB)
Purity:
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
52 kDa (inactive precursor) | 37-38 kDa (mature, active form)
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Kunieda et al. (2013). Spatiotemporal secretion of PEROXIDASE36 is required for seed coat mucilage extrusion in Arabidopsis. Plant Cell . 2013 Apr;25(4):1355-67.doi: 10.1105/tpc.113.110072. (Western blot, Arabidopsis thaliana)Kunieda et al. (2008). NAC family proteins NARS1/NAC2 and NARS2/NAM in the outer integument regulate embryogenesis in Arabidopsis. Plant Cell. 2008 Oct;20(10):2631-42.doi: 10.1105/tpc.108.060160. (Western blot, Arabidopsis thaliana)Nakaune et al. (2005). A vacuolar processing enzyme, deltaVPE, is involved in seed coat formation at the early stage of seed development. Plant Cell. 2005 Mar;17(3):876-87. doi: 10.1105/tpc.104.026872. (Immunofluorescence, Immunolocalisation by electron microscopy, Western blot, Arabidopsis thaliana)
PYK10 is the main component of ER bodies. It has hydrolase activity, hydrolyzing O-glycosyl compounds It may produce defense compounds when plants are damaged by insects or wounding.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Conjugated peptide, derived from Arabidopsis thaliana internal part of PYK10, UniProt: A0A178VCN3, TAIR: At3g08880.
Applications:
Immunofluorescence (IF), Immunohistochemistry (IHC), Immunoprecipitation (IP), Western blot (WB)
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
59,7 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Yamada et al. (2013). Identification of Two Novel Endoplasmic Reticulum Body-Specific Integral Membrane Proteins. Plant Physiol. 2013 Jan;161(1):108-20. doi: 10.1104/pp.112.207654. (Western blot, Arabidopsis thaliana) Nagano et al. (2005). Activation of an ER-body-localized -Glucosidase via a Cytosolic Binding Partner in Damaged Tissues of Arabidopsis thaliana. Plant Cell Physiol. 2005 Jul;46(7):1140-8. doi: 10.1093/pcp/pci126. (Immunoprecipiation, Western blot, Arabidopsis thaliana)Matshushima et al. (2003). A novel ER-derived compartment, the ER body, selectively accumulates a beta-glucosidase with an ER-retention signal in Arabidopsis. Plant J . 2003 Feb;33(3):493-502. doi: 10.1046/j.1365-313x.2003.01636.x. Immunofluorescence, Immunohistochemistry, Western blot, Arabidopsis thaliana)
PYK10 is the main component of ER bodies. It has hydrolase activity, hydrolyzing O-glycosyl compounds It may produce defense compounds when plants are damaged by insects or wounding. Cellular localisation: ER bodies.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Conjugated peptide, derived from Arabidopsis thaliana C-terminal of PYK10, UniProt: A0A178VCN3, TAIR: At3g08880.
N-terminal signal peptide including 24 amino acis and ER retention signal is removed from the mature protein
Application Details:
1:500-1:1000 (IHC), 1: 5000- 1: 20 000 (WB)
Purity:
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
59,7 | 56 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Matsushima et al. (2003). A novel ER-derived compartment, the ER body, selectively accumulates a beta-glucosidase with an ER-retention signal in Arabidopsis. Plant J. 2003 Feb;33(3):493-502. doi: 10.1046/j.1365-313x.2003.01636.x.
Oleosins may have a structural role to stabilize the lipid body during desiccation of the seed by preventing coalescence of the oil. Probably interacts with both lipid and phospholipid moieties of lipid bodies. May also provide recognition signals for specific lipase anchorage in lipolysis during seedling growth. Oleosins also increase the viability of over-wintering oilseeds by preventing abnormal fusion of oil bodies during imbibition in the spring. Cellular localisation: surface of oil bodies.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Camelina sativa, Capsella rubella, utrema salsugineum. Raphanus sativus Species of your interest not listed? Contact us
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
21 | 19 kDa
Not reactive in:
Glycine max
Selected references:
Shimada et al. (2008). A novel role for oleosins in freezing tolerance of oilseeds in Arabidopsis thaliana. Plant J. 2008 Sep;55(5):798-809. doi: 10.1111/j.1365-313X.2008.03553.x.
Oleosins may have a structural role to stabilize the lipid body during desiccation of the seed by preventing coalescence of the oil. Probably interacts with both lipid and phospholipid moieties of lipid bodies. May also provide recognition signals for specific lipase anchorage in lipolysis during seedling growth. Oleosins also increase the viability of over-wintering oilseeds by preventing abnormal fusion of oil bodies during imbibition in the spring. Cellular localisation: surface of oil bodies.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica oleracea, Raphanus sativusSpecies of your interest not listed? Contact us
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
18,5 | 17 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Shimada et al. (2010). A rapid and non-destructive screenable marker, FAST, for identifying transformed seeds of Arabidopsis thaliana. (Immunolocalisation)Shimada et al. (2008). A novel role for oleosins in freezing tolerance of oilseeds in Arabidopsis thaliana. Plant J. 2008 Sep;55(5):798-809. doi: 10.1111/j.1365-313X.2008.03553.x. (Western blot)
PBP1 (PYK10-binding protein 1) is inhibitor-type lectin that may regulate the correct polymerization of BGLU23/PYK10 upon tissue damage. Activates BGLU21, BGLU22 and BGLU23. PBP1 is localised to cytoplasm.Alternative names: Jacalin-related lectin 30, Jasmonic acid-induced protein.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Conjugated peptide, derived from C-terminus of Arabidopsis thaliana PBP1, UniProt: O04314, TAIR: At3g16420
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
32 | 35 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Nagano et al. (2005). Activation of an ER-body-localized beta-glucosidase via a cytosolic binding partner in damaged tissues of Arabidopsis thaliana. Plant Cell Physiol. 2005 Jul;46(7):1140-8. doi: 10.1093/pcp/pci126. (Immunofluorescence, Western Blot, Arabidopsis thaliana)
PBP1 (PYK10-binding protein 1) is inhibitor-type lectin that may regulate the correct polymerization of BGLU23/PYK10 upon tissue damage. Activates BGLU21, BGLU22 and BGLU23. PBP1 is localised to cytoplasm.Alternative names: Jacalin-related lectin 30, Jasmonic acid-induced protein.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica rapa, Raphanus sativusSpecies of your interest not listed? Contact us
Immunogen:
Conjugated peptide, derived from N-terminus of Arabidopsis thaliana PBP1, UniProt: O04314, TAIR: At3g16420
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
32 | 35 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Nagano et al. (2005). Activation of an ER-body-localized beta-glucosidase via a cytosolic binding partner in damaged tissues of Arabidopsis thaliana. Plant Cell Physiol. 2005 Jul;46(7):1140-8. doi: 10.1093/pcp/pci126. (Immunofluorescence, Western blot, Arabidopsis thaliana)Matsushima et al. (2004). NAI1 gene encodes a basic-helix-loop-helix-type putative transcription factor that regulates the formation of an endoplasmic reticulum-derived structure, the ER body. Plant Cell. 2004 Jun;16(6):1536-49. doi: 10.1105/tpc.021154. (Western blot, Arabidopsis thaliana)
TGG2 | Myrosinase 2 ( BGL37) may degrade glucosinolates (glucose residue linked by a thioglucoside bound to an amino acid derivative) to glucose, sulfate and any of the products: thiocyanates, isothiocyanates, nitriles, epithionitriles or oxazolidine-2-thiones. These toxic degradation products can deter insect herbivores. Seems to function in abscisic acid (ABA) and methyl jasmonate (MeJA) signaling in guard cells. Functionally redundant with TGG1. Cellular localisation: vacuole. Alternative names: Beta-glucosidase 37, AtBGLU37, Sinigrinase 2, Thioglucosidase 2.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
BSA-conjugated peptide, derived from N-terminus of Arabidopsis thaliana TGG2, UniProt: Q9C5C2 , TAIR: At5g25980
Applications:
ELISA (ELISA), Immunolocalisation (IL), Western blot (WB)
Signal peptide of 28 amino acids is removed from N-termins. Three glycosylation sites were identified in the mature form of the protein.Antibody specificity has been confirmed using wild-type and tgg2-1 mutant Ueda et al. (2006).
Application Details:
assay dependent (ELISA), (IL), 1: 1000 (WB)
Purity:
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
63 | 70 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Liebminger et al. (2012). Myrosinases TGG1 and TGG2 from Arabidopsis thaliana contain exclusively oligomannosidic N-glycans. Phytochemistry. 2012 Dec;84(21):24-30.doi: 10.1016/j.phytochem.2012.08.023. (Western blot)Shirakava et al. (2010). Arabidopsis Qa-SNARE SYP2 proteins localized to different subcellular regions function redundantly in vacuolar protein sorting and plant development. Plant J. 2010 Dec;64(6):924-35.doi: 10.1111/j.1365-313X.2010.04394.x. (Western blot)Ueda et al. (2006). AtVAM3 is required for normal specification of idioblasts, myrosin cells. Plant Cell Physiol. 2006 Jan;47(1):164-75. doi: 10.1093/pcp/pci232. (Immunolocalisation, Western blot)
In Brassicaceae, the enzyme myrosinase (beta-thioglucoside glucohydrolase, TGG) degrades glucosinolates to produce toxins like thiocyanates, isothiocyanates, nitriles, epithionitriles or oxazolidine- 2-thiones that deter herbivory. There are two TGG enzymes, TGG1 and TGG2, which have a redundant function. Cellular localization: vacuole.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
BSA-conjugated peptide, derived from N-terminus of Arabidopsis thaliana TGG1, UniProt: P37702, TAIR: At5g26000
Applications:
ELISA (ELISA), Immunogold (IG), Immunohistochemistry (IHC), Western blot (WB)
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
61 | 77 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Farid et al. (2011). Arabidopsis thaliana alpha1,2-glucosyltransferase (ALG10) is required for efficient N-glycosylation and leaf growth. Plant J. 2011 Oct;68(2):314-25.doi: 10.1111/j.1365-313X.2011.04688.x. (Western blot)Shirakawa et al. (2010). Arabidopsis Qa-SNARE SYP2 proteins localized to different subcellular regions function redundantly in vacuolar protein sorting and plant development. Plant J. 2010 Dec;64(6):924-35.doi: 10.1111/j.1365-313X.2010.04394.x. (Western blot)Ueda et al. (2006). AtVAM3 is required for normal specification of idioblasts, myrosin cells. Plant Cell Physiol. 2006 Jan;47(1):164-75. doi: 10.1093/pcp/pci232. (Immunlocalization, Western blot).
RHD3 (Protein Root Hair Defective 3) protein is probable GTP-binding protein involved in cell wall expansion. Required for appropriate root and root hair cells enlargement. May inhibit vacuole enlargement during root hair cell expansion. Plays a role in cell wall biosynthesis and actin organization. Seems to act independently from auxin and ethylene pathways. May regulate membrane traffic from the Golgi apparatus towards the endoplasmic reticulum (ER). Localized in Golgi and ER membrane.Alternative names: Fragile Fiber 4, Portein SEY1 homolog 1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Apostasia shenzhenica, Artemisia annua, Brassica rapa, Capsicum annuum, Dichanthelium oligosanthes, Hibiscus syriacus, Mucuna pruriens, Panicum hallii, Phoenix dactylifera, Tanacetum cinerariifolium, Triticum urartu, Zea mays, Vitis vinifera Species of your interest not listed? Contact us
Immunogen:
BSA-conjugated peptide, derived from N-terminus of Arabidopsis thaliana RHD3, UniProt: P93042, TAIR: At3g13870
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
89 | 90 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Ueda et al. (2016). Phosphorylation of the C Terminus of RHD3 Has a Critical Role in Homotypic ER Membrane Fusion in Arabidopsis. Plant Physiol. 2016 Feb;170(2):867-80. doi: 10.1104/pp.15.01172.
Caleosin3 encodes a calcium binding protein whose mRNA is induced upon treatment with NaCl, ABA and in response to desiccation. mRNA expression under drought conditions is apparent particularly in leaves and flowers. Isoform of caleosin with a role as a peroxygenase involved in oxylipin metabolism during biotic and abiotic stress. Involved in the production of 2-hydroxyoctadecatrienoic acid. The peroxygenase has a narrow substrate specificity thus acting as a fatty acid hydroperoxide reductase in vivo. Protective role to fungus pathogen has been indicaed. Expression is very low in young leaves and high in senescent leaves.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica napus, Camelina sativa, Capsella rubella, Raphanus sativus Species of your interest not listed? Contact us
Immunogen:
BSA-conjugated peptide, derived from N-terminus of Arabidopsis thaliana Caleosin 3, UniProt: O22788, TAIR: At2g33380
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
26,6 | 30 kDa
Not reactive in:
Poppulus sp.
Selected references:
Shimada et al. (2014). Leaf oil body functions as a subcellular factory for the production of a phytoalexin in Arabidopsis. Plant Physiol. 2014 Jan;164(1):105-18. doi: 10.1104/pp.113.230185.Shimada et al. (2010). A rapid and non-destructive screenable marker, FAST, for identifying transformed seeds of Arabidopsis thaliana. Plant J. 2010 Feb 1;61(3):519-28. doi: 10.1111/j.1365-313X.2009.04060.x
BG1 (Beta-glucosidase 1) hydrolyzes abscisic acid glucose ester (ABA-GE) which represents the predominant form of conjugated ABA (biologically inactive). No activity with beta-D-glucopyranosyl zeatin. The hydrolysis of ABA-GE in the endoplasmic reticulum (ER) forms free ABA and contributes to increase its cellular levels under dehydration conditions. ABA-GE hydrolyzing activity is enhanced by dehydration stress-induced polymerization into higher molecular weight forms. The ABA produced by BGLU18 contributes to the initiation of intracellular signaling as well as the increase in the extracellular ABA level. Localised to ER lumen.Alternative names: AtBG1, Beta-glucosidase 18, Beta-glucosidase homolog 1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Purified recombinant BG1 of Arabidopsis thaliana, residues 27-528 with a His6-thioredoxin tagged, UniProt: Q9SE50, TAIR: At1g52400
Applications:
Immunolocalization (IL) using electron microscopy, Western blot (WB)
NAI2 TSA1-like protein, C-terminal is responsible for the ER body formation. Regulates the number and shape of the ER bodies and the accumulation of PYK10 in ER bodies, but is not involved in the expression of PYK10. Interacts directly or indirectly with MEB1 and MEB2. Expressed in roots. Detected in shoot apex. Localised to ER lumen.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Purified recombinant C-terminal part of NAI2 of Arabidopsis thaliana, residues 636-772 with a His tag, UniProt: Q9LSB4, TAIR: At3g15950
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
85 | 120 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Yamada et al. (2008). NAI2 is an endoplasmic reticulum body component that enables ER body formation in Arabidopsis thaliana. Plant Cell . 2008 Sep;20(9):2529-40. doi: 10.1105/tpc.108.059345.
Special application note:
Signal peptide of 24 amino acids is removed from the mature protein
NAI2 TSA1-like protein is responsible for the ER body formation. Regulates the number and shape of the ER bodies and the accumulation of PYK10 in ER bodies, but is not involved in the expression of PYK10. Interacts directly or indirectly with MEB1 and MEB2. Expressed in roots. Detected in shoot apex. Induced by NAI1. The protein is localising to ER lumen.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Purified recombinant NAI2 of Arabidopsis thaliana, residues 272-502 with a His tag, UniProt: Q9LSB4, TAIR: At3g15950
Signal peptide of 24 amino acids is removed from the mature protein
Application Details:
1: 1000 - 1: 3000 (IF), 1: 2000 - 1: 4000 (WB)
Purity:
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
85 | 120 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Ueda et al. (2018).Endoplasmic Reticulum (ER) Membrane Proteins (LUNAPARKs) are Required for Proper Configuration of the Cortical ER Network in Plant Cells. Plant Cell Physiol. 2018 Oct 1;59(10):1931-1941. doi: 10.1093/pcp/pcy137. Yamada et al. (2013). Identification of two novel endoplasmic reticulum body-specific integral membrane proteins. Plant Physiol. 2013 Jan;161(1):108-20. doi: 10.1104/pp.112.207654. Yamada et al. (2008). NAI2 is an endoplasmic reticulum body component that enables ER body formation in Arabidopsis thaliana. Plant Cell . 2008 Sep;20(9):2529-40. doi: 10.1105/tpc.108.059345.
MEB2 (Membrane protein of ER body 2) may sequester excess cytosolic iron and manganese into endoplasmic reticulum to reduce metal ion toxicity. Not essential for the accumulation of ER body components, including PYK10.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Purified recombinant MEB2 of Arabidopsis thaliana, residues 1-325 with a His tag, UniProt: F4KFS7 , TAIR: At5g24290
MEB1 (Membrane protein of ER body 1) displays iron ion transmembrane transporter activity and may sequester excess cytosolic iron and manganese into endoplasmic reticulum to reduce metal ion toxicity. Not essential for the accumulation of ER body components.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Purified recombinant MEB1 of Arabidopsis thaliana, residues 271-502 with a His tag, UniProt: Q8W4P8, TAIR: AT4G27860
Applications:
ELISA (ELISA), Immunoprecipitation (IP), Western blot (WB)
Sulfite reductase (SiR) is an essential protein with sulfite reductase activity required in assimilatory sulfate reduction pathway during both primary and secondary metabolism and thus involved in development and growth. It is known as a DNA-binding protein that binds to both double-stranded and single-stranded DNA without significant sequence specificity to reversibly repress the transcriptional activity of chloroplast nucleoids by promoting DNA compaction and possibly regulate DNA replication. The sequence identity between maize and Arabidopsis SiR is 77%.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 4 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Pisum sativum, Zea mays
Expected Species:
Dichanthelium oligosanthes, Panicum hallii, Setaria viridis, Sorghum bicolorSpecies of your interest not listed? Contact us
Immunogen:
Purified full length, tag cleaved, recombinant Zea mays SiR, UniProt: O23813
This antibody is also recognizing recombinant SiR protein from Zea mays.
Application Details:
assay dependent (ELISA), 1: 1000 - 1: 5000 (WB)
Purity:
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
70 kDa (Zea mays), 72 kDa (Arabidopsis thaliana)
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Sato et al. (2001). The 70-kDa major DNA-compacting protein of the chloroplast nucleoid is sulfite reductase. FEBS Lett. 2001 Jan 5;487(3):347-50.doi: 10.1016/s0014-5793(00)02342-5. (Western blot, pea)Sakibara et al. (2000). Analysis of reductant supply systems for ferredoxin-dependent sulfite reductase in photosynthetic and nonphotosynthetic organs of maize. Plant Physiol. 2000 Mar;122(3):887-94.doi: 10.1104/pp.122.3.887. (Western blot, maize)
ASN (Glutamine-dependent asparagine synthetase) is essential for nitrogen assimilation, distribution and remobilization within the plant via the phloem. ASN2 is expressed in leaf and ASN1 is expressed in floral organs. The amino acid sequences of Arabidopsis thaliana ASN1 and ASN2 are 76% identical. The amino acid sequences of Arabidopsis thaliana and Zea mays ASN2 are 73.6% identical.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Zea mays
Expected Species:
Brassica rapa, Camelina sativa, Capsella rubella, Eutrema salsugineum, Punica granatumSpecies of your interest not listed? Contact us
Immunogen:
Purified full length, tag cleaved, recombinant Arabidopsis thaliana ASN2, UniProt: Q9LV77 , TAIR: AT5G65010
Applications:
ELISA (ELISA), Immunohistochemistry (IHC), Western blot (WB)
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
65 | 65 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Gaufichon et al. (2017). ASN1-encoded asparagine synthetase in floral organs contributes to nitrogen filling in Arabidopsis seeds. Plant J. 2017 Aug;91(3):371-393. doi: 10.1111/tpj.13567.Gaufichon et al. (2013). Arabidopsis thaliana ASN2 encoding asparagine synthetase is involved in the control of nitrogen assimilation and export during vegetative growth. Plant Cell Environ. 2013 Feb;36(2):328-42. doi: 10.1111/j.1365-3040.2012.02576.x.
Special application note:
This antibody reacts with both isoforms: ASN1 and ASN2
Glutamine synthetase plays a role in the flow of nitrogen into nitrogenous organic compounds. There are five root types of GS isoproteis (GS1-1~ GS1-5) and one chloroplastic GS isoprotein (GS2/GLN2) are known. The sequence identity between GS1-1 and GS2 is 65%.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Spinacia oleracea, Zea mays
Expected Species:
Brachypodium distachyon, Cucurbita moschata, Glycine max, Medicago truncatula, Oryza sativa, Panicum hallii, Pontederia crassipes, Populus tremula x Populus alba, Prunus persica, Raphanus sativus, Saccharum officinarum, Setaria italica, Sorghum bicolor, Triticum aestivumSpecies of your interest not listed? Contact us
Immunogen:
Purified full length, tag cleaved, recombinant Zea mays GS-1 (Glutamine synthetase, root isozyme 1) UniProt: P38559
No confirmed exceptions from predicted reactivity are currently known
Application Details:
assay dependent (ELISA), 1: 1000 - 1: 5000 (WB)
Purity:
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
39 kDa | 43 kDa (chloroplast isoform)
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Kimata-Ariga and Hase (2014). Multiple complexes of nitrogen assimilatory enzymes in spinach chloroplasts: possible mechanisms for the regulation of enzyme function. PLoS One . 2014 Oct 1;9(10):e108965. doi: 10.1371/journal.pone.0108965. Sakaibara et al. (1996). Molecular identification and characterization of cytosolic isoforms of glutamine synthetase in maize roots. J Biol Chem. 1996 Nov 22;271(47):29561-8. doi: 10.1074/jbc.271.47.29561.
Special application note:
This antibody reactis with all glutamine synthetase isotypes from leaf and root
NADH-dependent glutamate synthase (GltBD) is involved in glutamate biosynthesis and consists of large subunit (GltB, 168 kDa) and small subunit (GltD, 54 kDa). It is required for non-photorespiratory ammonium assimilation.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 4 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Synechocystis sp. strain PCC6803
Expected Species:
cyanobacteria Species of your interest not listed? Contact us
Immunogen:
Purified full length, tag cleaved, recombinant cyanobacterium, Leptolyngbya boryana (Plectonema boryanum) , glutamate synthase, UniProt: Q51583 (gltB, large subunit L.boryanum), Q51584 (gltD, small subunit L.boryanum)
Glutamine oxoglutarate aminotransferase (GOGAT) is an enzyme involved in synthesis of glutamate from glutamine and alpha-ketoglutarate. GOGAT has two forms in plants: ferredoxin-dependent GOGAT (Fd-GOGAT) and NADH-dependent GOGAT (NADH-GOGAT). 95% of GOGAT found in plants is the Fd-GOGAT type. Fd-GOGAT is encoded by two genes, glu1 and glu2 in Arabidopsis. Fd-GOGAT (both forms) is highly conserved among plants, red algae, and cyanobacteria. Ferredoxin-dependent glutamate synthase, chloroplastic (Fd-GOGAT) is involved in glutamate biosynthesis in leaf. This protein required for the reassimilation of ammonium ions generated during photorespiration. Gene name is GlsF.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Ariga and Hase (2014). Multiple complexes of nitrogen assimilatory enzymes in spinach chloroplasts: possible mechanisms for the regulation of enzyme function. PLoS One. Oct 1;9(10):e108965. doi: 10.1371/journal.pone.0108965.Sakaibara et al. (1991). Molecular cloning and characterization of complementary DNA encoding for ferredoxin-dependent glutamate synthase in maize leaf. J Biol Chem. Feb 5;266(4):2028-35.
Ferredoxins are iron-sulfur proteins that transfer electrons in a wide variety of metabolic reactions.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 4 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Plasmodium falciparum
Immunogen:
Ferredoxin purified from Malaria parasite, Plasmodium falciparum, UniProt:Q8IED5
Applications:
ELISA (ELISA), Immunofluorescence (IF), Western blot (WB)
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
18 kDa
Selected references:
Kimata and Ariga et al. (2007). Cloning and Characterization of Ferredoxin and ferredoxin-NADP+ Reductase From Human Malaria Parasite. J Biochem. 141(3):421-8. doi: 10.1093/jb/mvm046. Kabayashi et al. (2007). Mitochondria and Apicoplast of Plasmodium Falciparum: Behaviour on Subcellular Fractionation and the Implication. Mitochondrion 7(1-2):125-32. doi: 10.1016/j.mito.2006.11.021.
Ferredoxins are iron-sulfur proteins that transfer electrons in a wide variety of metabolic reactions. Higher plants also possess genes for significantly different, as yet uncharacterized Fd proteins, with extended C termini (FdCs). Whether these FdC proteins function as photosynthetic electron transfer proteins is not known. It has been suggested that FdC1 has a specific function in conditions of acceptor limitation at PSI, and channels electrons away from NADP(+) photoreduction.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Zea mays
Expected Species:
Brassica rapa, Cannabis sativa, Theobroma cacao Species of your interest not listed? Contact us
Immunogen:
Purified full length, tag cleaved, recombinant Arabidopsis thaliana Ferredoxin C-1, UniProt: O23344 , TAIR: At4g14890
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
16,7 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Voss et al. (2011). FdC1, a Novel Ferredoxin Protein Capable of Alternative Electron Partitioning, Increases in Conditions of Acceptor Limitation at Photosystem I. J Biol Chem. 2011 Jan 7;286(1):50-9. doi: 10.1074/jbc.M110.161562.
Ferredoxins are iron-sulfur proteins that transfer electrons in a wide variety of metabolic reactions. Occupies a key position both for transferring the photoreducing power to Fd-NADP+ oxidoreductase (FNR), hence the formation of NADPH, and for mediating the cyclic electron flow around photosystem I (PSI).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Zea mays
Expected Species:
plant ferredoxin isoformsSpecies of your interest not listed? Contact us
Immunogen:
Native, chromafography purified ferredoxin mixture: Fd1, Fd2, Fd3 and Fd4 from Zea mays, UniProt: P27787 (Fd1), P27787(Fd2), P27788 (Fd3), accesion number not known for Fd4
Following processing MW of plant ferredoxins is around 12 kDa, However, due to a strong acidic nature, they migrate at 16 to 17 kDa
Application Details:
1: 1000 - 1: 10 000 (WB)
Purity:
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
12 | 16-17 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Hase et al. (1991). Molecular Cloning and Differential Expression of the Maize Ferredoxin Gene Family. Plant Physiol. 96(1):77-83. doi: 10.1104/pp.96.1.77.
Ferredoxins are iron-sulfur proteins that transfer electrons in a wide variety of metabolic reactions. Fd3 is non-photosynthetic Fd expressed more in root than in leaf. Fd3 is localised in chloroplast and plastids.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Zea mays
Expected Species:
Brachypodium distachyon, Dichanthelium oligosanthes, Hordeum vulgare, Oryza sativa, Panicum hallii, Saccharum sp. , Setaria italicaSpecies of your interest not listed? Contact us
Immunogen:
Purified full length, tag cleaved, recombinant maize Fd3, UniProt: P27788
Antibody reacts weakly with other ferredoxins: Arabidopsis thaliana and Zea mays Fd2 and Zea mays Fd6.
Application Details:
1: 2000 - 1: 10 000 (WB)
Purity:
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
16 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Hanke and Hase (2008). Variable Photosynthetic Roles of Two Leaf-Type Ferredoxins in Arabidopsis, as Revealed by RNA Interference. Photochem Photobiol. 84(6):1302-9. doi: 10.1111/j.1751-1097.2008.00411.x. Hanke et al. (2003). A Post Genomic Characterization of Arabidopsis Ferredoxins. Plant Physiol. 134(1):255-64. doi: 10.1104/pp.103.032755. Matsumura et al. (1997). A Nitrate-Inducible Ferredoxin in Maize Roots. Genomic Organization and Differential Expression of Two Nonphotosynthetic Ferredoxin Isoproteins. Plant Physiol. 114(2):653-60. doi: 10.1104/pp.114.2.653.
Ferredoxins are iron-sulfur proteins that transfer electrons in a wide variety of metabolic reactions. Occupies a key position both for transferring the photoreducing power to Fd-NADP+ oxidoreductase (FNR), hence the formation of NADPH, and for mediating the cyclic electron flow around photosystem I (PSI). Fd2 is most abundant Fd isoprotein expressed in plant leaves.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
15 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Ramirez et al. (2013). Glutathione and ascorbic acid protect Arabidopsis plants against detrimental effects of iron deficiency.Hanke et al. (2004). A post genomic characterizationof Arabidopsis ferredoxins. Plant Physiol. 2004 Jan;134(1):255-64. Epub 2003 Dec 18 (Western blot, Arabidopsis thaliana)
Ferredoxins are iron-sulfur proteins that transfer electrons in a wide variety of metabolic reactions. It occupies a key position both for transferring the photoreducing power to Fd-NADP+ oxidoreductase (FNR), hence the formation of NADPH, and for mediating the cyclic electron flow around photosystem I (PSI).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Zea mays
Expected Species:
Brassica napus, Brassica oleracea, Eutrema salsugineum, Raphanus sativusSpecies of your interest not listed? Contact us
Immunogen:
Purified full length, tag cleaved, recombinant maize Fd1, UniProt: P27787
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
12 | 15 kDa
Not reactive in:
Nicotiana benthamiana
Selected references:
Hanke and Hase (2008). Variable Photosynthetic Roles of Two Leaf-Type Ferredoxins in Arabidopsis, as Revealed by RNA Interference. Photochem Photobiol. 84(6):1302-9. doi: 10.1111/j.1751-1097.2008.00411.x.Kimata and Hase (1989). Localization of Ferredoxin Isoproteins in Mesophyll and Bundle Sheath Cells in Maize Leaf. Plant Physiol. 89(4):1193-7. doi: 10.1104/pp.89.4.1193.
FNR | Ferredoxin NADP Reductase plays a key role in regulating the relative amounts of cyclic and non-cyclic electron flow to meet the demands of the plant for ATP and reducing power. The human malaria parasite (Plasmodium falciparum) possesses a plastid-derived organelle called the apicoplast, which is believed to employ metabolisms crucial for the parasite's survival.Alternative name: Fd:NADPH oxidoreducatase (FNR)
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 4 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Plasmodium falciparum
Immunogen:
Purified full length, tag cleaved, recombinant Plasmodium falciparum FNR, UniProt: C6KT68
For western blot apicoplast fraction from Plasmodium falciparum is recommended, not a total cell extract.
Application Details:
1: 500 - 1: 2000 (WB)
Purity:
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
43,8 | 38 kDa (transit peptide removed)
Selected references:
Kimata-Ariga et al. (2007). Cloning and Characterization of Ferredoxin and ferredoxin-NADP+ Reductase From Human Malaria Parasite. J Biochem. 2007 Mar;141(3):421-8. doi: 10.1093/jb/mvm046.Kimata-Ariga et al. (2007). Cloning and Characterization of Ferredoxin and ferredoxin-NADP+ Reductase From Human Malaria Parasite. J Biochem. 141(3):421-8. doi: 10.1093/jb/mvm046.
Ferredoxin-NADP reductase (FNR) isoproteins of plant roots play a key role in redox homeostasis of NADPH / NADP + and donation of reducing equivalence to ferredoxin. R-FNR2 is major form of R-FNR and involved in reduction and detoxication of nitrite in root.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Antibody will recognize two root FNR proteins (R-FNR1 and R-FNR2) of Arabidopsis thaliana and Zea mays as well as leaf FNRs.This antibody can be used as a marker of plastids localised in roots.
Application Details:
1: 1000 - 1: 30 000 (WB)
Purity:
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
36,3 kDa | 35,57 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Hachiya et al. (2016). Arabidopsis Root-Type Ferredoxin:NADP(H) Oxidoreductase 2 Is Involved in Detoxification of Nitrite in Roots . Plant Cell Physiol. 57(11):2440-2450. doi: 10.1093/pcp/pcw158.Hachiya et al. (2016). Arabidopsis Root-Type Ferredoxin:NADP(H) Oxidoreductase 2 Is Involved in Detoxification of Nitrite in Roots. Plant Cell Physiol. 57(11):2440-2450. doi: 10.1093/pcp/pcw158.Onda et al. (2000). Differential Interaction of Maize Root ferredoxin:NADP(+) Oxidoreductase With Photosynthetic and Non-Photosynthetic Ferredoxin Isoproteins. Plant Physiol. 123(3):1037-45. doi: 10.1104/pp.123.3.1037. Onda et al. (2000). Differential Interaction of Maize Root ferredoxin:NADP(+) Oxidoreductase With Photosynthetic and Non-Photosynthetic Ferredoxin Isoproteins. Plant Physiol. 123(3):1037-45. doi: 10.1104/pp.123.3.1037.
FNR3 | Ferredoxin NADP Reductase, isoprotein 3 (leaf) (L-FNR1) plays a key role in regulating the relative amounts of cyclic and non-cyclic electron flow to meet the demands of the plant for ATP and reducing power. Localized in chloroplast.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Zea mays
Expected Species:
Dichanthelium oligosanthes, Panicum hallii, Sorghum bicolor Species of your interest not listed? Contact us
Immunogen:
Purified full length, tag cleaved, recombinant maize leaf FNR3, UniProt: B4FUM2
This antibody is also detecting other maize L-FNRs: FNR2 and FNR1 in Zea mays and Arabidopsis thaliana leaf extracts, in the order of reactivity in each species.
Application Details:
1: 1000 (WB)
Purity:
Total IgG. Protein A purified in PBS, 50% glycerol. Filter sterilized.
Molecular Weight:
40,6 | 34,7 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Okutani et al. (2005). Three Maize Leaf ferredoxin:NADPH Oxidoreductases Vary in Subchloroplast Location, Expression, and Interaction With Ferredoxin. Plant Physiol . 2005 Nov;139(3):1451-9. doi: 10.1104/pp.105.070813.Okutani et al. (2005). Three Maize Leaf ferredoxin:NADPH Oxidoreductases Vary in Subchloroplast Location, Expression, and Interaction With Ferredoxin. Plant Physiol. 2005 Nov;139(3):1451-9. doi: 10.1104/pp.105.070813.
FNR2 | Ferredoxin NADP Reductase, isoprotein 2 (leaf) plays a key role in regulating the relative amounts of cyclic and non-cyclic electron flow to meet the demands of the plant for ATP and reducing power.Alternative names: FNR
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Zea mays
Expected Species:
Dichanthelium oligosanthes, Glycine max, Sorghum bicolorSpecies of your interest not listed? Contact us
Immunogen:
Purified full length, tag cleaved, recombinant maize leaf FNR2, UniProt: Q9SLP5, sharing homology with Arabidopsis thaliana FNR2, UniProt: Q8W493
Ferredoxin-NADP reductase, leaf isozyme 1 (L-FNR1) plays a key role in regulating the relative amounts of cyclic and non-cyclic electron flow to meet the demands of the plant for ATP and reducing power. Localised in the chloroplast.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Zea mays
Expected Species:
Hordeum vulgare, Oryza brachyantha, Saccharum sp., Setaria italica, Sorghum bicolorSpecies of your interest not listed? Contact us
Immunogen:
Purified recombinant maize leaf FNR1 protein UniProt: Q9SLP6, sharing homology with maize FNR2, FNR3 and Arabidopsis thaliana FNR1 Q9FKW6
Tagging a protein with TurboID allows studying protein interactions in different types of cells and organs and developmental stages. This is a suitable tool for proximity labelling experiments as described in Mair et al. (2019). Proximity labelling of protein complexes and cell-type-specific organellar proteomes in Arabidopsis enabled by TurboID. Elife . 2019 Sep 19;8:e47864. doi: 10.7554/eLife.47864.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
BirA (mutated/TurboID)
Expected Species:
mini TurboID
Immunogen:
Recombinant mutated BirA protein from E.coli produced using the following plasmid: TurboID-His6_pET21a, (Plasmid #107177). Expression was done in a vector that allowed for the generation of an untagged protein (without HIS6tag).
Tagging a protein with TurboID allows studying protein interactions in different types of cells and organs and developmental stages. This is a suitable tool for proximity labelling experiments as described in Mair et al. (2019). Proximity labelling of protein complexes and cell-type-specific organellar proteomes in Arabidopsis enabled by TurboID. Elife . 2019 Sep 19;8:e47864. doi: 10.7554/eLife.47864. This tag has MW of 35 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
BirA (mutated/TurboID)
Immunogen:
Recombinant mutated BirA protein from E.coli produced using the following plasmid: TurboID-His6_pET21a, (Plasmid #107177). Expression was done in a vector that allowed for the generation of an untagged protein (without HIS6tag).
Tagging a protein with TurboID allows studying protein interactions in different types of cells and organs and developmental stages. This is a suitable tool for proximity labelling experiments as described in Mair et al. (2019). Proximity labelling of protein complexes and cell-type-specific organellar proteomes in Arabidopsis enabled by TurboID. Elife . 2019 Sep 19;8:e47864. doi: 10.7554/eLife.47864. This tag has MW of 35 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
BirA (mutated/TurboID)
Immunogen:
Recombinant mutated BirA protein from E.coli produced using the following plasmid: TurboID-His6_pET21a, (Plasmid #107177). Expression was done in a vector that allowed for the generation of an untagged protein (without HIS6tag).
Tagging a protein with TurboID allows studying protein interactions in different types of cells and organs and developmental stages, This is a suitable tool for proximity labelling experiments as described in Mair et al, (2019), Proximity labelling of protein complexes and cell-type-specific organellar proteomes in Arabidopsis enabled by TurboID, Elife , 2019 Sep 19;8:e47864, doi: 10,7554/eLife,47864, This tag has MW of 35 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
BirA (mutated/TurboID)
Immunogen:
Recombinant mutated BirA protein from E.coli produced using the following plasmid: TurboID-His6_pET21a, (Plasmid #107177). Expression was done in a vector that allowed for the generation of an untagged protein (without HIS6tag).
Tagging a protein with TurboID allows studying protein interactions in different types of cells and organs and developmental stages, This is a suitable tool for proximity labelling experiments as described in Mair et al, (2019), Proximity labelling of protein complexes and cell-type-specific organellar proteomes in Arabidopsis enabled by TurboID, Elife , 2019 Sep 19;8:e47864, doi: 10,7554/eLife,47864, This tag has MW of 35 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
BirA (mutated/TurboID)
Immunogen:
Recombinant mutated BirA protein from E.coli produced using the following plasmid: TurboID-His6_pET21a, (Plasmid #107177). Expression was done in a vector that allowed for the generation of an untagged protein (without HIS6tag).
Tagging a protein with TurboID allows studying protein interactions in different types of cells and organs and developmental stages, This is a suitable tool for proximity labelling experiments as described in Mair et al, (2019), Proximity labelling of protein complexes and cell-type-specific organellar proteomes in Arabidopsis enabled by TurboID, Elife , 2019 Sep 19;8:e47864, doi: 10,7554/eLife,47864, This tag has MW of 35 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
BirA (mutated/TurboID)
Immunogen:
Recombinant mutated BirA protein from E.coli produced using the following plasmid: TurboID-His6_pET21a, (Plasmid #107177). Expression was done in a vector that allowed for the generation of an untagged protein (without HIS6tag).
Tagging a protein with TurboID allows studying protein interactions in different types of cells and organs and developmental stages. This is a suitable tool for proximity labelling experiments as described in Mair et al. (2019). Proximity labelling of protein complexes and cell-type-specific organellar proteomes in Arabidopsis enabled by TurboID. Elife . 2019 Sep 19;8:e47864. doi: 10.7554/eLife.47864. This tag has MW of 35 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
BirA (mutated/TurboID)
Immunogen:
Recombinant mutated BirA protein from E.coli produced using the following plasmid: TurboID-His6_pET21a, (Plasmid #107177). Expression was done in a vector that allowed for the generation of an untagged protein (without HIS6tag).
His-Tag is a polyhistidine tag which consists of 3 or 6 histidine residues introduced on N- or C-terminus of the protein. The polyhistidine-tag can be used for recombinant protein detection using specific antibodies and it is not conjugated to any dye or enzyme.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
His-Tag is a polyhistidine tag which consists of 3 or 6 histidine residues introduced on N- or C-terminus of the protein. The polyhistidine-tag can be used for recombinant protein detection using specific antibodies and it is not conjugated to any dye or enzyme.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
His-Tag is a polyhistidine tag which consists of 3 or 6 histidine residues introduced on N- or C-terminus of the protein. The polyhistidine-tag can be used for recombinant protein detection using specific antibodies and it is not conjugated to any dye or enzyme.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
His-Tag is a polyhistidine tag which consists of 3 or 6 histidine residues introduced on N- or C-terminus of the protein, The polyhistidine-tag can be used for recombinant protein detection using specific antibodies and it is not conjugated to any dye or enzyme.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
His-Tag is a polyhistidine tag which consists of 3 or 6 histidine residues introduced on N- or C-terminus of the protein, The polyhistidine-tag can be used for recombinant protein detection using specific antibodies and it is not conjugated to any dye or enzyme.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
His-Tag is a polyhistidine tag which consists of 3 or 6 histidine residues introduced on N- or C-terminus of the protein, The polyhistidine-tag can be used for recombinant protein detection using specific antibodies and it is not conjugated to any dye or enzyme.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
His-Tag is a polyhistidine tag which consists of 3 or 6 histidine residues introduced on N- or C-terminus of the protein. The polyhistidine-tag can be used for recombinant protein detection using specific antibodies and it is not conjugated to any dye or enzyme.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Rabbit anti-DYKDDDDK is a primary antibody which binds to DYKDDDDK (Sigma FLAG ).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
DYKDDDDK epitope tag (Sigma FLAG ), fused to proteins in plant cells
Immunogen:
KLH-conjugated synthetic peptide: DYKDDDDK (Sigma FLAG )
GFP (Green fluorescent protein) was originally identified in photo organs on jellyfish Aequorea victoria. It is a naturally fluorescent protein which emits green light at a maximum wavelength of 509 nm when excited by blue or UV light. It is extensively used in laboratory as a reporter molecule to label and study cellular and subcellular proteins in living cells using a wide range of applications. Antibodies to GFP protein are used in immunoblotting and ELISA. GFP protein has molecular weight of 27 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
GFP (Green fluorescent protein) was originally identified in photo organs on jellyfish Aequorea victoria. It is a naturally fluorescent protein which emits green light at a maximum wavelength of 509 nm when excited by blue or UV light. It is extensively used in laboratory as a reporter molecule to label and study cellular and subcellular proteins in living cells using a wide range of applications. Antibodies to GFP protein are used in immunoblotting and ELISA. GFP protein has molecular weight of 27 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
GFP (Green fluorescent protein) was originally identified in photo organs on jellyfish Aequorea victoria. It is a naturally fluorescent protein which emits green light at a maximum wavelength of 509 nm when excited by blue or UV light. It is extensively used in laboratory as a reporter molecule to label and study cellular and subcellular proteins in living cells using a wide range of applications. Antibodies to GFP protein are used in immunoblotting and ELISA. GFP protein has molecular weight of 27 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
GFP (Green fluorescent protein) was originally identified in photo organs on jellyfish Aequorea victoria, It is a naturally fluorescent protein which emits green light at a maximum wavelength of 509 nm when excited by blue or UV light, It is extensively used in laboratory as a reporter molecule to label and study cellular and subcellular proteins in living cells using a wide range of applications, Antibodies to GFP protein are used in immunoblotting and ELISA, GFP protein has molecular weight of 27 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
GFP (Green fluorescent protein) was originally identified in photo organs on jellyfish Aequorea victoria, It is a naturally fluorescent protein which emits green light at a maximum wavelength of 509 nm when excited by blue or UV light, It is extensively used in laboratory as a reporter molecule to label and study cellular and subcellular proteins in living cells using a wide range of applications, Antibodies to GFP protein are used in immunoblotting and ELISA, GFP protein has molecular weight of 27 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
GFP (Green fluorescent protein) was originally identified in photo organs on jellyfish Aequorea victoria, It is a naturally fluorescent protein which emits green light at a maximum wavelength of 509 nm when excited by blue or UV light, It is extensively used in laboratory as a reporter molecule to label and study cellular and subcellular proteins in living cells using a wide range of applications, Antibodies to GFP protein are used in immunoblotting and ELISA, GFP protein has molecular weight of 27 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
GFP (Green fluorescent protein) was originally identified in photo organs on jellyfish Aequorea victoria. It is a naturally fluorescent protein which emits green light at a maximum wavelength of 509 nm when excited by blue or UV light. It is extensively used in laboratory as a reporter molecule to label and study cellular and subcellular proteins in living cells using a wide range of applications. Antibodies to GFP protein are used in immunoblotting and ELISA. GFP protein has molecular weight of 27 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, prepare small aliquots and store at -20 °C. For storage at 2-8 C, add a preservative to prevent growth of bacteria.This product is used as a blocking reagent or control for
After opening the vial, the lyophilized content is reconstituted by adding 1 ml of sterile distilled water, mixed gently by inversion until complete dissolution is obtained, Allow to stand at ambient temperature for 5-10 minutes to reach equilibrium, Reconstituted serum may be stored frozen
Special application note:
This normal serum can be used as an internal relative standard for quantitative protein assays such as double radial immunodiffusion (Mancini, Fahey), ELISA, Western blot and electroimmunodiffusion (Laurell). The product can be also applied as a blocking or negative control in non-precipitating antibody binding assays as immunofluorescence.Normal pig serum was obtained from healthy animals of European origin.
BC2 tag is a short and inert peptide-tag for protein studies.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Protein of interest overexpressed wth BC2-tag
Immunogen:
KLH-conjugated BC2 tag PDRKAAVSHWQQ derived from beta catenin.
BC2 tag is a short and inert peptide-tag for protein studies.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
Protein of interest overexpressed wth BC2-tag
Immunogen:
KLH-conjugated BC2 tag PDRKAAVSHWQQ derived from beta catenin.
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 488.
Selected references:
To be added when available. Antibody released in May 2023.
Special application note:
This antibody is suitable for detection of recombinant proteins with BC2 tag.DyLight 488 Amax = 493 nm, Emax = 519 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
BC2 tag is a short and inert peptide-tag for protein studies.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
Protein of interest overexpressed wth BC2-tag
Immunogen:
KLH-conjugated BC2 tag PDRKAAVSHWQQ derived from beta catenin.
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 594.
Selected references:
To be added when available. Antibody released in May 2023.
Special application note:
This antibody is suitable for detection of recombinant proteins with BC2 tag.DyLight 594 has Amax = 593 nm, Emax = 618 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
BC2 tag is a short and inert peptide-tag for protein studies.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
Protein of interest overexpressed wth BC2-tag
Immunogen:
KLH-conjugated BC2 tag PDRKAAVSHWQQ derived from beta catenin.
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 650.
Selected references:
To be added when available. Antibody released in May 2023.
Special application note:
This antibody is suitable for detection of recombinant proteins with BC2 tag.DyLight 650 has Amax = 652 nm, Emax = 672 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
eIF2-alpha (Eukaryotic translation initiation factor 2 subunit alpha) functions in the early steps of protein synthesis by forming a ternary complex with GTP and initiator tRNA. eIF2 is a heterodimer composed of an alpha, beta and gamma chain.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Soybean (Glycine max) is a plant from legume family with a broad use in food industry.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid working with a stock. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Mouse immunoglobulin molecules of IgG1 isotype this ready to use Negative Control reagent contains purified non-conjugated mouse immunoglobulin molecules of IgG1 isotype, which have been selected on the basis of their binding characteristics: no specific binding to human cell surface or intracellular antigens
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Stored at 2-8 C, do not freeze.
Host Animal:
Mouse
Species Reactivity:
Calf intestine alkaline phosphatase (no cross reaction with human proteins)
Applications:
Direct Immunofluorescence (IF), Flow Cytometry (Flow cyt), Immunofluoresence (IF)
The clone VI-AP reacts with calf intestine alkaline phosphatase and does not show cross-reactivity with human proteins. The sensitivity of VI-AP mAb is determined by staining well-defined blood samples from representative donors with serial-fold mAb dilutions to obtain a titration curve that allows relating the mAb concentration to the percentage of stained cells and geometric MFI (mean fluorescence intensity). For this purpose, a mAb-concentration range is selected to include both the saturation point and the detection threshold In practice, 50 l of leukocytes containing 10^7 cells/ml are stained with 20 l mAb of various dilutions to obtain a titration curve and to identify the saturation point and detection threshold. The final concentration of the product is then adjusted to be at least 3-fold above the detection threshold.
Mouse IgG1 is a negative control for Immunofluorescence staining with FITC, Biotin, PE and APC mouse monoclonal antibodies of the IgG1 subclass. Monitoring the level of non-specific binding of mouse monoclonal antibodies to human cell surgace antigens can be done using this product.
IgG1 immunoglobulin Protein A/G purified in PBS. Contains 0.08% sodium azide.
Special application note:
PBMC: Add 10 l of MAB/10^6 PBMC in100 µl PBS. Mix gently and incubate for 15 minutes at 2 to 8 C. Wash twice with PBS and analyze. Whole blood: Add10 μl of MAB/100 μl of Whole Blood. Mix gently and 1/3incubate for 15 minutes at room temperature 20oC. Lyse the whole blood. Wash once with PBS and analyze. See instrument manufacturer’s instructions for Lysed Whole Blood and Immunofluorescence analysis with a flow cytometer or microscope. Allophycocyanin: (APC) conjugates are analyzed in multi-color flow cytometry with instruments equipped with a second laser and proper filters. Laser excitation is at 633 nm with a Helium Neon (HeNe) laser or a 600-640 nm (633nm) range for a Dye laser. Peak fluorescence emission is at 660 nm. RPE-Cy-5 +: Excites at 488nm and emits at 670nm. Store protected from light. Optimal concentration should be evaluated by serial dilutions.
HA-tag is derived from a human influenza hemagglutinin HA-molecule corresponding to amino acids 96-106 and is used as a general epitope tag in expression vectors. An anti-HA antibody can then be used to detect the protein on western blot or to immunoprecipitate the recombinant protein in binding studies with transfected cells.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
HA-tagged proteins
Immunogen:
9 amono acid long synthetic petide to influenza virus hemagglutinin,
APP is an integral membrane protein found in many tissues and concentrated in the synapses of neurons. It is known as the precursor molecule generating amyloid beta (Aβ), and the amyloid fibrillar form is the primary component of amyloid plaques found in the brains of patients with Alzheimer's disease.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Human, mouse, rat
Immunogen:
Synthetic peptide (aa 653-662 of human APP) or 1-10 of the 4kDa Amyloid- peptide, The 4 kDa amyloid peptide is a 40 amino acid sequence that is cleaved of from the human amyloid A4 protein precursor (APP) and therefore the amino acids 1-10 of the peptide correspond to amino acids 653-662 of APP,
APP is an integral membrane protein found in any tissues and concentrated in the synapses of neurons. It is known as the precursor molecule generating amyloid beta (Aβ), and the amyloid fibrillar form is the primary component of amyloid plaques found in the brains of patients with Alzheimer's disease.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Human, mouse, rat
Expected Species:
Chicken, monkey and other species, please inquire.
Immunogen:
Synthetic peptide amino acids: 737-751 of human APP UniProt: P05067 or 85-99 of the C99 generated by secretases.
His-Tag is a polyhistidine tag which consists of 6 histidine residues introduced on N- or C-terminus of the protein. The polyhistidine-tag can be used for recombinant protein detection using specific antibodies and it is not conjugated to any dye or enzyme.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Papain (EC=3.4.22.2) is a cysteine protease which belongs to peptidase C1 family. Can cause an allergic reaction in humans. Alternative names: Papaya proteinase I, allergen= Car p 1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Carica papaya
Expected Species:
Carica papaya
Immunogen:
native papain isolated and purified from Carica papaya
Applications:
ELISA (ELISA), Immunofluorescence (IF), Immunohistochemistry (IHC), Western blot (WB)
Biotin/IgG protein molar ration is approximately 6,2, No foreign proteins are added
Application Details:
1 : 1000-1 : 100 000 (ELISA), (IF), (IHC), (WB)
Purity:
Purified IgG in PBS. Contains 0.08% sodium azide.
Reconstitution:
For reconstitution add 0,5 ml of sterile destilled water
Molecular Weight:
38,9 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Antibody is labelled with biotin using N-hydroxysuccinimidobiotin, Antibody potency and purity has been evaluated by immunoelectrophoresis, single radial immunodiffusion (Ouchterlony), ELISA,immunoblotting and enzyme inhibition
Papain (EC=3.4.22.2) is a cysteine protease which belongs to peptidase C1 family. Can cause an allergic reaction in humans. Alternative names: Papaya proteinase I, allergen= Car p 1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Carica papaya
Expected Species:
Carica papaya
Immunogen:
native papain isolated and purified from Carica papaya
Applications:
ELISA (ELISA), Immunofluorescence (IF), Immunohistochemistry (IHC), Western blot (WB)
Biotin/IgG protein molar ration is approximately 6,2, No foreign proteins are added
Application Details:
1 : 1000-1 : 100 000 (ELISA), (IF), (IHC), (WB)
Purity:
Purified IgG in PBS. Contains 0.08% sodium azide.
Reconstitution:
For reconstitution add 0,5 ml of sterile destilled water
Molecular Weight:
38,9 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Antibody is labelled with biotin using N-hydroxysuccinimidobiotin, Antibody potency and purity has been evaluated by immunoelectrophoresis, single radial immunodiffusion (Ouchterlony), ELISA,immunoblotting and enzyme inhibition
HA-tag is derived from a human influenza hemagglutinin HA-molecule corresponding to amino acids 96-106 and is used as a general epitope tag in expression vectors. An anti-HA antibody can then be used to detect the protein on western blot or to immunoprecipitate the recombinant protein in binding studies with transfected cells.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
HA-tagged proteins
Immunogen:
KLH-conjugated synthetic petide YPYDVPDYA of influenza virus hemagglutinin.
Applications:
ELISA (ELISA), Flow cytometry (Flowcyt), Western blot (WB)
HA-tag is derived from a human influenza hemagglutinin HA-molecule corresponding to amino acids 96-106 and is used as a general epitope tag in expression vectors. An anti-HA antibody can then be used to detect the protein on western blot or to immunoprecipitate the recombinant protein in binding studies with transfected cells.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
HA-tagged proteins
Immunogen:
KLH-conjugated synthetic petide YPYDVPDYA of influenza virus hemagglutinin.
Molar F/P ratio is 3,6 and indicates an average number of FITC molecules/IgY molecule as determined by the extinction values at 495 nm and 280 nm (OD495 and OD280), respectively
Botulinum toxin is a toxin produced by the anaerobic, gram-positive, bacterium of the genus Clostridium (C. botulinum, C. butyricum, C. baratii and C. argentinense). These strains are widely distributed and can be found in soil and dust. Eight types of botulinum toxin are distinguished, named type A–H. Type A and B are capable of causing disease in humans (botulism) and have longest activity in vivo, and are also used commercially (BOTOX) and medically. Types C–G are less common; types E and F can cause disease in humans, while the other types cause disease in other animals. BotA is cleaved into two chains: heavy and light.Alternative name: Bontoxilysin-A
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
Botulinum toxin A heavy chain
Immunogen:
Purified Botulinum Neurotoxin Type A (Heavy Chain Binding Domain)
For direct ELISA coating with 2 g of Botulinium Toxin A is recommended combined with primary antibody dilution of 1: 10 000.For Western blot 0.5 g of non reduced holotoxin or heavy chains is recommended together with 1: 2000 dilution of a primary antibody.
Botulinum toxin is a toxin produced by the anaerobic, gram-positive, bacterium of the genus Clostridium (C. botulinum, C. butyricum, C. baratii and C. argentinense). These strains are widely distributed and can be found in soil and dust. Eight types of botulinum toxin are distinguished, named type A–H. Type A and B are capable of causing disease in humans (botulism) and have longest activity in vivo, and are also used commercially (BOTOX) and medically. Types C–G are less common; types E and F can cause disease in humans, while the other types cause disease in other animals. BotB is cleaved into two chains: heavy and light.Alternative name: Bontoxilysin-B
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
Botulinum Neurotoxin B fromClostridium botulinum
Immunogen:
Highly purified Botulinum Neurotoxin Type B (Clostridium botulinum)
Botulinum toxin is a toxin produced by the anaerobic, gram-positive, bacterium of the genus Clostridium (C. botulinum, C. butyricum, C. baratii and C. argentinense). These strains are widely distributed and can be found in soil and dust. Eight types of botulinum toxin are distinguished, named type A–H. Type A and B are capable of causing disease in humans (botulism) and have longest activity in vivo, and are also used commercially (BOTOX) and medically. Types C–G are less common; types E and F can cause disease in humans, while the other types cause disease in other animals. BotB is cleaved into two chains: heavy and light.Alternative name: Bontoxilysin-B
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
Botulinum Neurotoxin B from Clostridium botulinum
Immunogen:
Highly purified Botulinum Neurotoxin Type B (Clostridium botulinum)
Protein A is a surface protein of S. aureus which binds IgG molecules by their Fc region. In serum, the bacteria will bind IgG molecules in the wrong orientation on their surface, which hinders opsonization and phagocytosis. Mutants of S. aureus lacking protein A are more efficiently phagocytosed in vitro and mutants in infection models have diminished virulence. Due to its affinity for the Fc region of many mammalian immunoglobulins, protein A is considered a universal reagent in biochemistry and immunology.
The specific activity of the anti-protein A-agarose was determined, For this lot, 1,1 mg protein A bound per ml agarose
Purity:
Immunogen affinity purified in PBS pH 7.2. Contains 0.075% sodium azide, coupled to immunoprecipiation gel.
Special application note:
Antibodies were isolated from immune eggs, affinity purified on a protein A column and conjugated to N- hydroxysuccinimide (NHS)-activated agarose beads, Beads were washed extensively with after the blocking of the residual NHS sites
Protein A is a surface protein of S. aureus which binds IgG molecules by their Fc region. In serum, the bacteria will bind IgG molecules in the wrong orientation on their surface, which hinders opsonization and phagocytosis. Mutants of S. aureus lacking protein A are more efficiently phagocytosed in vitro and mutants in infection models have diminished virulence. Due to its affinity for the Fc region of many mammalian immunoglobulins, protein A is considered a universal reagent in biochemistry and immunology.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Protein G is a bacterial protein derived from the cell wall of certain strains of b-hemolytic Streptococcci. It binds with high affinity to the Fc portion of various classes and subclasses of immunoglobulins from a variety of species. Protein G binds to all IgG subclasses from human, mouse and rat species. It also binds to total IgG from guinea pig, rabbit, goat, cow, sheep, and horse. Protein G binds preferentially to the Fc portion of IgG, but unlike Protein A, can also bind to the Fab region, making it useful for purification of F(ab') fragments of IgG. Due to its affinity for the Fc region of many mammalian immunoglobulins, protein G is considered a universal reagent in biochemistry and immunology.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
Streptococcus sp.
Immunogen:
Recombinant protein G, lacking the albumin binding region,
Protein L is a 36 kDa immunoglobulin-binding protein isolated from the bacteria Peptostreptococcus magnus. Unlike Protein A and Protein G, which bind to the Fc region of immunoglobulins (antibodies), Protein L binds antibodies through light chain interactions. Protein L binds a wider range of antibody classes than Protein A or G. Protein L binds to representatives of all antibody classes, including IgG, IgM, IgA, IgE and IgD.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Protein L is an immunoglobulin-binding protein isolated from the bacteria Peptostreptococcus magnus. Unlike Protein A and Protein G, which bind to the Fc region of immunoglobulins (antibodies), Protein L binds antibodies through light chain interactions. Protein L binds a wider range of antibody classes than Protein A or G. Protein L binds to representatives of all antibody classes, including IgG, IgM, IgA, IgE and IgD.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Protein L is a 36 kDa immunoglobulin-binding protein isolated from the bacteria Peptostreptococcus magnus. Unlike Protein A and Protein G, which bind to the Fc region of immunoglobulins (antibodies), Protein L binds antibodies through light chain interactions. Protein L binds a wider range of antibody classes than Protein A or G. Protein L binds to representatives of all antibody classes, including IgG, IgM, IgA, IgE and IgD.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
This product is intended for use in precipitating and non-precipitating antibody-binding assays; to prepare an insoluble immuno-affinity adsorbent and for labelling with a marker of chosed by the customer.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at 4°C(short time) or -20 °C (log term); once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Aspergillus niger
Immunogen:
Purified Glucose oxidase of Aspergillus niger, UniProt: P13006
Applications:
ELISA (ELISA), Immunofluorescence (IF), Western blot (WB)
LUC (Luciferase) from Photinus pyralis (Common eastern firefly) (Lampyris pyralis), light producing beetle is an enzyme in the light production. Luciferase enzymes are used in bioluminescene assay systems and display an inherent light emission, which makes them suitable for multiplex analyses, including in vivo imaging, cell viability.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at 4°C(short term) or -20 °C (long term); once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Luciferase from Photinus pyralis
Immunogen:
Purified Luciferase from Photinus pyralis UniProt: P08659
Applications:
ELISA (ELISA), Indirect Immunofluorescence (IF), Western blot (WB)
Tubulin gamma chain is essential for the control of microtubular network. It is found at microtubule organizing centers (MTOC) such as the spindle poles
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 4 C; Do not freeze. Do not exceed exipry date is provided on the tube. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
KLH-conjugated gamma-tubulin peptide EYHAATRPDYISWGTQ, amino acids 434-449. UniProt: P23258The epitope was located in the aminoacid sequence PDYISW (aa441-446 in human), which is identical for gamma-tubulin 1 and gamma-tubulin 2.
This antibody recognizes C-terminus (amino acids 434-449 in human) of gamma-tubulin, a 48 kDa structural constituent of cytoskeleton and microtubule organizing center (MTOC). The epitope which this antibody is recognizing is conserved in Arabidopsis thaliana Tubulin gamma-1 chain, UniProt: P38557, Gene ID: At3g61650 and Tubulin gamma-2 chain, UniProt: P38558, Gene ID: At5g05620Recommended secondary antibody: goat anti-mouse IgG1 AS16 3715
Tubulin alpha (TUA) together with beta tubulin is making up microtubules.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 4 C; Do not freeze. Do not exceed exipry date is provided on the tube. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
This antibody is recognizing defined epitope (amino acid 65-97) on N-terminal structural domain of alpha tubulin.Recommended secondary antibody, goat anti-mouse IgG1, HRP conjugated AS16 3715
Application Details:
1 : 500 (ICC), 1-4 g/ml /FlowCyt), 1-4 g/ml (WB)
Conjugation:
IgG1
Isotype:
IgG1
Purity:
Immunoglobulin Protein A purified in PBS. Contain 15 mM sodium azide.
Molecular Weight:
51 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Liu et al. (2022) Identification of positive and negative regulators of antiviral RNA interference in Arabidopsis thaliana. Nat Commun. 2022 May 30;13(1):2994. doi: 10.1038/s41467-022-30771-0. PMID: 35637208; PMCID: PMC9151786.
Special application note:
Metal induced stress affected the expression of tubulin, and that therefore, this protein cannot be used as a loading control under that type of conditions, data in application example,
Tubulin beta (TUB) together with alpha tubulin is making up microtubules.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 4 C; Do not freeze. Do not exceed exipry date is provided on the tube. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
human, mouse, pig
Expected Species:
Plants Species of your interest not listed? Contact us
Immunogen:
Beta-tubulin purified from porcine brain, UniProt: Q9H4B7
Applications:
Immunocytochemistry (ICC), Immunohistochemistry on frozen sections (IHC), Western blot (WB)
This antibody is recognizing N-terminal structural domain of beta tubulin.Recommended secondary antibody for Western blot is: goat anti mouse IgM AS16 3497Metal induced stress affected the expression of tubulin alpha and gamma, and that therefore, these proteins cannot be used as a loading control under that type of conditions. More information can be found here.
Application Details:
2-8 g/ml (ICC), 1 g/ml (WB)
Conjugation:
IgM
Isotype:
IgM
Purity:
Purified by precipitation and affinitychromatography in TBS. Contains 15 mM sodium azide.
Molecular Weight:
50,3 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Fluorescent proteins, like EBFP, can be used as protein "tags" to study the subcellular localization of proteins and/or their translocation upon stimulation and/or as markers for transfections in transient and stable expression systems.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at 2-8 C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
BFP, GFP, YFP
Immunogen:
Recombinant EBFP (NCBI accession number AX_766758 REGION: 1-717, expression vector pGEX-1N), expressed in E.coli.
Immunoglobulin Protein A purified in a 10 mM ammonium bicarbonate buffer, with 2 mg of BSA.
Reconstitution:
Recommended antibody concentration: 0.5 mg/ml (when dissolved at 0.5 mg/ml, the BSA concentration will be 1%). Recommended solvent; 100 mM PBS or Tris-HCl, pH 7.0 •Additional sodium azide ( up to 0.05%) is recommended for long term storage. •For a 0.5 mg/ml antibody concentration in 1% BSA, dissolve in 200 μl buffer.
Fluorescent proteins, like BFP, can be used as protein "tags" to study the subcellular localization of proteins and/or their translocation upon stimulation and/or as markers for transfections in transient and stable expression systems.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at 2-8 C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
BFP
Immunogen:
Recombinant EBFP (NCBI accession number AX_766758 REGION: 1-717, expression vector pGEX-1N), expressed in E.coli.
Immunoglobulin Protein A purified in a 10 mM ammonium bicarbonate buffer, with 2 mg of BSA.
Reconstitution:
Recommended antibody concentration: 0.5 mg/ml (when dissolved at 0.5 mg/ml, the BSA concentration will be 1%). Recommended solvent; 100 mM PBS or Tris-HCl, pH 7.0 •Additional sodium azide ( up to 0.05%) is recommended for long term storage. •For a 0.5 mg/ml antibody concentration in 1% BSA, dissolve in 200 μl buffer.
Phosphorylation is a post-translational modification of proteins in which a phosphate group is covalently bound to a serine, threonine or a thyrosine residue by a protein kinase. Phosphorylation of a protein can result in activation or inhibition of a proteins function and is thereby a regulatory mechanisms of protein activation.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at 2-8 C; add sodium azide to 0,05% for porlonged storage, Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Immunoglobulin Protein A purified in a 10 mM ammonium bicarbonate buffer, with 2 mg of BSA.
Reconstitution:
Recommended antibody concentration: 0.5 mg/ml (when dissolved at 0.5 mg/ml, the BSA concentration will be 1%). Recommended to dissolve in; 100 mM PBS or Tris-HCl, pH 7.0 Additional sodium azide ( up to 0.05%) is recommended for long term storage. For a 0.5 mg/ml antibody concentration in 1% BSA, dissolve in 200 μl buffer.
The reactivity of the antiserum is directed to the subclass IgG2a. It reacts with IgG2a of the allelic types Igh-1a and Igh-1b, which include BALB/C, C57Bl, CBA/J, SJL/J and SM/J. hen used for the identification of IgG2a in other mouse strains the reaction may be weaker. The immunoconjugate contains antibodies to iso and allospecific determinants. It does not react with other subclasses of IgG, IgG/Fab fragments, IgM and IgA or any non-Ig protein in mouse serum, as tested by immunoelectrophoresis and double radial immunodiffusion.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
The lyophilized conjugate is shipped at ambient temperature and may be stored at 4 C; prolonged storage at or below -20 °C. It is reconstituted by adding 1 ml sterile distilled water, spun down to remove insoluble particles, divided into small aliquots, frozen and stored at or below -20 °C. Prior to use, an aliquot is thawed slowly at ambient temperature, spun down again and used to prepare working dilutions by adding sterile phosphate buffered saline (PBS, pH 7,2). Repeated thawing and freezing should be avoided. Working dilutions should be stored at 4 C, not refrozen, and preferably used the same day. If a slight precipitation occurs upon storage, this should be removed by centrifugation. It will not affect the performance of the immunoconjugate. Lyophilized at +4 C--at least 10 years. Reconstituted at or below -20 C--3-5 years. Reconstituted at +4 C--7 days.
Host Animal:
Goat
Species Reactivity:
Mouse IgG2a
Immunogen:
Pools of purified homogenous IgG2a isolated from pooled mouse sera belonging to the allelic types Igh- 1a and Igh-1b, Freund's complete adjuvant is used in the first step of the immunization procedure,
Applications:
Dot blot (Dot), ELISA (ELISA), Immunohistochemistry (paraffin) (IHC), Western blot (WB)
This immunoconjugate is not species-specific since inter-species cross-reactivity is a normal feature of antisera to immunoglobulins, However this conjugate has been passed over appropriate immuno-adsorbents to remove antibodies cross-reacting with Human immunoglobulins, This renders it specific for use in test systems containing material of Human origin (e,g, Human tissue/Mouse monoclonal antibody to a Human tissue constituent/anti Mouse Ig isotype-specific immunoconjugate
For reconstitution add 1 ml of sterile water, Let it stand for 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
This immunoconjugate is not species-specific since inter-species cross-reactivity is a normal feature of antisera to immunoglobulins, However this conjugate has been passed over appropriate immunoadsorbents to remove antibodies cross-reacting with Human immunoglobulins, This renders it specific for use in test systems containing material of Human origin (e,g, Human tissue/Mouse monoclonal antibody to a Human tissue constituent/anti Mouse Ig isotype-specific immunoconjugate
Xyloglucan is a hemiceullose or polysaccharide that is found in the primary cell wall of all vascular plants. Xyloglucan binds to the surface of cellulose microfibrils and may link them together.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
Mannan is one of the major constituent groups of hemicellulose in the wall of higher plants. It comprises linear or branched polymers derived from sugars such as D-mannose, D-galactose, and D-glucose.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
Host Animal:
Mouse
Species Reactivity:
gum and acetylated mannan from Lycopersicum esculentum
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Pattathil et al. (2015). Insights into plant cell wall structure, architecture, and integrity using glycome profiling of native and AFEXTM-pre-treated biomass. J Exp Bot. Jul;66(14):4279-94.doi: 10.1093/jxb/erv107.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Pattathil et al. (2015). Insights into plant cell wall structure, architecture, and integrity using glycome profiling of native and AFEXTM-pre-treated biomass. J Exp Bot. Jul;66(14):4279-94.doi: 10.1093/jxb/erv107.
Phytochrome is a photomorphogenically active pigment that modulates plant growth and development with respect to incident light intensity and wavelength distribution. It exists in two forms: an inactive, red-absorbing form (Pr),4 and an active far-red-absorbing form (Pfr). When either absorbs light, it is photoconverted to the other. Phytochrome is a dimeric, water-soluble, relatively labile chromoprotein with similar, if not identical, monomers of about 124 kDa each. It is also a relatively low abundance protein, even under the best of conditions. Genetic manipulation of phytochrome expression in plants leads to plants requiring less light and able to divert more energy to the production of fruits and seeds. For its physicochemical characterization, it has therefore been difficult to utilize techniques that require large quantitites of highly purified protein. Consequently, indirect methods for elucidating its structure/function relationships are especially important. These could also be applicable to fabaceae and closely related families.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -80 C; Avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Avena sativa, Pisum sativum
Expected Species:
graminae, fabaceaeSpecies of your interest not listed? Contact us
Immunogen:
Phytochrome
Applications:
ELISA (ELISA), Competitive ELISA, Immunoflourescence (IF), Immunoprecipiation (IP), Western blot (WB)
Epitope for this antibody is located at 36 kDa from N-terminus and very near the site of chromophore attachment
Application Details:
assay dependent
Purity:
Cell culture supernatant
Molecular Weight:
124 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Pratt et al. (1988). Mapping of antigenic domains on phytochrome from etiolated Avena sativa L. by immunoblot analysis of proteolytically derived peptides. Arch Biochem Biophys. 267(2):723-35. doi: 10.1016/0003-9861(88)90081-1.Cordonnier et al. (1983). Production and purification of monoclonal antibodies to Pisum and Avena phytochrome. Planta. 158(4):369-76. doi: 10.1007/BF00397340.
Actin-related proteins (ARPs) are found in the nuclei of all eukaryotic cells, but their functions are generally understood only in the context of their presence in various yeast and animal chromatin-modifying complexes. Arabidopsis thaliana ARP6 is a clear homolog of other eukaryotic ARP6s, including Saccharomyces cerevisiae ARP6, which was identified as a component of the SWR1 chromatin remodeling complex. Arabidopsis ARP6 is localized to the nucleus during interphase but dispersed away from the chromosomes during cell division. ARP6 expression was observed in all vegetative tissues as well as in a subset of reproductive tissues. Null mutations in ARP6 caused numerous defects, including altered development of the leaf, inflorescence, and flower as well as reduced female fertility and early flowering in both long- and short-day photoperiods.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -80 C; Avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Arabidopsis thaliana
Immunogen:
ARP6 of Arabidopsis thaliana, UniProt: Q8LGE3, TAIR: At3g33520
Applications:
ELISA (ELISA), Immunoflourescence (IF), Western blot (WB)
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Deal et al. (2005). The nuclear actin-related protein ARP6 is a pleiotropic developmental regulator required for the maintenance of FLOWERING LOCUS C expression and repression of flowering in Arabidopsis. Plant Cell Oct;17(10):2633-46. doi:10.1105/tpc.105.035196.
Actin-related proteins (ARPs) are found in the nuclei of all eukaryotic cells, but their functions are generally understood only in the context of their presence in various yeast and animal chromatin-modifying complexes. Arabidopsis ARP8 shows 30 and 29% amino acid identity to yeast actin and Arabidopsis ACT2 in the regions of alignment, respectively. Because it is not closely related to yeast or human ARP8 and shows similar weak homology to yeast ARP8 and ARP9, the Arabidopsis ARP8 is considered a plant-specific orphan ARP.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -80 C; Avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica rapa, Camelina sativa, Capsella rubella, Eutrema salsugineum, Raphanus sativusSpecies of your interest not listed? Contact us
Antibody is recognizing following epitope, amino acids 2-26: aa 2-ILKKVWG SVWNRSNSGKDLVNHQRA-26 This antibody is recognizing the full-length 52 kDa recombinant ARP8 protein expressed in Escherichia coli as well as endogenous ARP8 of identical molecular weight in Arabidopsis thaliana extracts from different tissues: all vegetative and reproductive organs examined including seedlings, roots and siliques, with higher concentrations of the protein detected in developing flower buds and flowers within the inflorescence.
Application Details:
assay dependent
Conjugation:
IgG1
Isotype:
IgG1
Purity:
Cell culture supernatant
Molecular Weight:
52 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Kandasamy et al. (2008). ACTIN-RELATED PROTEIN8 encodes an F-box protein localized to the nucleolus in Arabidopsis. Plant Cell Physiol. 49(5):858-63. doi: 10.1093/pcp/pcn053.
Actin-related proteins (ARPs) are found in the nuclei of all eukaryotic cells, but their functions are generally understood only in the context of their presence in various yeast and animal chromatin-modifying complexes. Arabidopsis ARP8 shows 30 and 29% amino acid identity to yeast actin and Arabidopsis ACT2 in the regions of alignment, respectively. Because it is not closely related to yeast or human ARP8 and shows similar weak homology to yeast ARP8 and ARP9, the Arabidopsis ARP8 is considered a plant-specific orphan ARP.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -80 C; Avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Antibody is recognizing following epitope, amino acids 447-471: SNLSIFPGPWCITRKQFRRKSRLMWThis antibody is recognizing the full-length 52 kDa recombinant ARP8 protein expressed in Escherichia coli as well as endogenous ARP8 of identical molecular weight in Arabidopsis thaliana extracts from different tissues: all vegetative and reproductive organs examined including seedlings, roots and siliques, with higher concentrations of the protein detected in developing flower buds and flowers within the inflorescence.
Application Details:
assay dependent
Conjugation:
IgG1
Isotype:
IgG1
Purity:
Cell culture supernatant
Molecular Weight:
52 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Kandasamy et al. (2008). ACTIN-RELATED PROTEIN8 encodes an F-box protein localized to the nucleolus in Arabidopsis. Plant Cell Physiol. 49(5):858-63. doi: 10.1093/pcp/pcn053.
GFP (Green fluorescent protein) was originally identified in photo organs on jellyfish Aequorea victoria. It is a naturally fluorescent protein which emits green light at a maximum wavelength of 509 nm when excited by blue or UV light. It is extensively used in laboratory as a reporter molecule to label and study cellular and subcellular proteins in living cells using a wide range of applications. Antibodies to GFP protein are used in immunoblotting and ELISA. GFP protein has molecular weight of 27 kDa.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid, 1mg/ml.
Storage Temp:
Store at -20 °C, Avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rat
Species Reactivity:
Native GFP, Recombinant GFP (E,coli), all variants of GFP, including EGFP
Immunogen:
Recombinant GFP protein from Aequorea victoria, UniProt: P42212
Applications:
Chromatin immunoprecipitation (ChIP), ELISA (ELISA), Immunofluorescence (IF), Immunoprecipitation (IP), Western blot (WB)
Immunoglobulin Protein A purified in PBS, 50 % glycerol, filter sterilized.
Selected references:
Maehara et al. (2015). issue-specific expression of histone H3 variants diversified after species separation. Epigenetics Chromatin. 2015 Sep 17;8:35. doi: 10.1186/s13072-015-0027-3. (ChIP)Okazaki et al. (2012). Nuclear localization signal in a cancer-related transcriptional regulator protein NAC1. Carcinogenesis. 2012 Oct;33(10):1854-62.doi: 10.1093/carcin/bgs193. (Immunoprecipiation)
GFP (Green fluorescent protein) was originally identified in photo organs on jellyfish Aequorea victoria. It is a naturally fluorescent protein which emits green light at a maximum wavelength of 509 nm when excited by blue or UV light. It is extensively used in laboratory as a reporter molecule to label and study cellular and subcellular proteins in living cells using a wide range of applications. Antibodies to GFP protein are used in immunoblotting and ELISA. GFP protein has molecular weight of 27 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
EGFP, S65T-GFP, RS-GFP, YFP
Immunogen:
Recombinant, His-tagged EGFP protein from Aequorea victoria, UniProt: P42212
Applications:
Immunofluorescence (IF), Immunoprecipitation (IP), Western blot (WB)
Tatsumi et al. (2017). G196 epitope tag system: a novel monoclonal antibody, G196,recognizes the small, soluble peptide DLVPR with high affinity. Sci Rep. 2017 Mar 7;7:43480.doi: 10.1038/srep43480. (Immunofluorescence, Western blot)
GST-tag (glutathione S-transferase) is a tag added to N-terminus of a protein of interest as a fusion protein to unable purification and detection. The tag is 220 amino acid long, ca. 26 kDa which makes it quite large compare to Myc or FLAG tags.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
GST-tag
Immunogen:
Recombinant, full size GST, amino acids 1-212, NCBI: AAA57089
Applications:
ELISA (ELISA), Immunoprecipitation (IP), Western blot (WB)
GST (Glutathione S-Transferase) is a 26kDa protein encoded by the parasitic helminth Schistosoma japonicum and widely used in the pGEX family of GST plasmid expression vectors as a fusion protein with foreign proteins.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at -20 °C, Avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
GST-tagged recombinant proteins
Immunogen:
Recombinant GST of Schistosoma japonicum UniProt: P08515
Applications:
Immunofluorescence (IF), Immunoprecipitation (IP), Western blot (WB)
Beta-galactosidase is an exoglycosidase which hydrolyzes the β-glycosidic bond formed between agalactose and its organic moiety. It may also cleave fucosides and arabinosides but with much lower efficiency. It is an essential enzyme in the human body. Deficiencies in the protein can result ingalactosialidosis or Morquio B syndrome. In E. coli , the gene of β-galactosidase, the lacZ gene, is present as part of the inducible system lac operon which is activated in the presence of lactose when glucose level is low. It is commonly used in molecular biology as a reporter marker to monitor gene expression. It also exhibits a phenomenon called α-complementation which forms the basis for the blue/white screening of recombinant clones. This enzyme can be split in two peptides, LacZα and LacZΩ, neither of which is active by itself but when both are present together, spontaneously reassemble into a functional enzyme. This property is exploited in many cloning vectors where the presence of the lacZα gene in a plasmid can complement in trans another mutant gene encoding the LacZΩ in specific laboratory strains of E. coli . However, when DNA fragments are inserted in the vector, the production of LacZα is disrupted, the cells therefore show no β-galactosidase activity. The presence or absence of an active β-galactosidase may be detected by X-gal, which produces a characteristic blue dye when cleaved by β-galactosidase, thereby providing an easy means of distinguishing the presence or absence of cloned product in a plasmid. E. coli β-Galactosidase consists of 1,024 amino acids with molecular mass of 116 kDa and functional form is a homotetramer.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 2 mg/ml.
Storage Temp:
Store at -20 °C, Avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube. , Do not store this antibody below -20 °C
Host Animal:
Rabbit
Species Reactivity:
Beta galactosidase (E.coli) and beta galactosidase tagged proteins
Immunogen:
Full length Beta galactosidase from E.coli UniProt: B7UJI9
Applications:
ELISA (ELISA), Immunofluorescence (IF), Immunoprecipitation (IP), Western blot (WB)
Arabidopsis thaliana auxin efflux carrier component AtPIN2 encoded by the AtPIN2 gene (also known as EIR1 and AGR1). AtPIN proteins are asymmetrically localized within plant plasma membranes and mediate polar auxin transport. AtPIN2 is a key regulator of the response of Arabidopsis roots to gravity. Alternative names: Auxin efflux carrier AGR, Ethylene-insensitive root 1, AtEIR1, Polar-auxin-transport efflux component AGR1, Protein AGRAVITROPIC 1, AtAGR1, Protein WAVY 6.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Beta vulgaris, Brassica napus, Camelina sativa, Cannabis sativa, Capsella rubella, Cucumis melo, Eucalyptus grandis, Eutrema salsugineum, Glycine max, Malus domestica, Morus notabilis, Prunus dulcis, Raphanus sativus, Spinacia oleracea, Vitis vinifera Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated mixture of two synthetic peptides derived from AtPIN2 sequence, UniProt:Q9LU77, TAIR:At5g57090
VSP (Vegetative storage protein 1) may function as somatic storage protein during early seedling development. Expression of VSP1 is enhanced by wounding and protein is localized to vacuole.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Full length, purified recombinant His6-tagged VSP1 of Arabidopsis thaliana UniProt: O49195, TAIR: At5g24780
Reactivity of this antibody to VSP2 has not been determined, Sequence conservation of VSP1 and VSP2 is 86 % therefore, it is most likely that this antibody will also recognize VSP2,
Application Details:
1: 1000 - 1: 2000 (WB)
Purity:
Total IgG, purified on Protein A in PBS, 50 % glycerol, filter sterilized.
Molecular Weight:
28 | 27 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Matsushima et al. (2002). An endoplasmic reticulum-derived structure that is induced under stress conditions in Arabidopsis.Plant Physiol. 2002 Dec;130(4):1807-14. doi: 10.1104/pp.009464.
MnSOD3 (Superoxide dismutase) is an chloroplastic enzyme which destroys radicals which are normally produced within the cells and which are toxic to biological systems. It is induced under Fe limitation, Mn Deficiency, and H2O2 stress as shown by Page et al. (2012).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii
Expected Species:
green algaeSpecies of your interest not listed? Contact us
Immunogen:
Recombinant MnSOD3 of Chlamydomonas reinhardtii, product of a MSD3 gene Cre16.g676150; Phytozome
Specific extraction method requires to be applied, check as published in Page et al. (2012).MnSOD3 can be only detected in Fe-limited cells (0.5 or 0.2 mM added Fe) (i.e., samples exhibiting the novel MnSOD activity) but not in cells grown with higher concentrations of added Fe.
Application Details:
1: 1000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
32 | 35 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Page et al. (2012) Fe sparing and Fe recycling contribute to increased superoxide dismutase capacity in iron-starved Chlamydomonas reinhardtii. Plant Cell. 2012 Jun;24(6):2649-65. doi: 10.1105/tpc.112.098962. Epub 2012 Jun 8. PMID: 22685165; PMCID: PMC3406916.
HSP23.5 (Heat shock protein 23.5 (mitochondrial) is involved in plant heat shock response.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
mNeonGreen (Fluorescent Protein) is a new bright monomertic yellow-green fluorescent, with low conservation level to GFP. It has an excitation maximum at 506 nm and an emission maximum at 517 nm and therefore is compatible with the most GFP filter sets. mNeonGreen is 3x brighter compare to GFP, more stable and does not bleach so fast as GFP, which makes it very suitable for confocal and super resolution microscopy, for fusion proteins with low expression levels. It can be used in bicistronic vectors, which will allow simultaneous expression of two proteins separately, from the same RNA transcript. mNeonGreen has MW of 26.6 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
mNG tag in plant (Arabidopsis thaliana) and algal vectors (Chlamydomonas reinhardtii)
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from synthetic peptide, UniProt: A0A1S4NYF2 from common lancelet Branchiostoma lanceolatum
This antibody is detecting protein sequence of mNG tag in plant and algal vectors.This antibody is also reacting to some degree with YFP and mCherry.
Application Details:
1 g/1ml (IF), 1 : 1000 - 1: 5000 (WB)
Purity:
Immunogen affinity purified serum, in PBS pH 7.4.
Reconstitution:
For reconstitution add 50 l, of sterile water.
Molecular Weight:
Depends upon used fusion partner
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known.
Selected references:
To be added when available, antibody available in November 2021.
Special application note:
The peptide used to elicit this antibody is conserved in the following expression vectors: dCas9-P2A-DHFR(TSc3)-T2A-mNeonGreen [Cloning vector pBM020]Cas9-P2A-DHFR(TSc3)-T2A-mNeonGreen [Cloning vector pBM006]mNeonGreen4-tDeg [Cloning vector pminiCMV-mNeonGreen4-tDeg]ER-localized mNEONGREEN [Binary vector pKT-NM-erNEON]mNeonGreen-3xFLAG [Cloning vector pLM160-mNeonGreen]mNeonGreen-ty1 [Cloning vector pSAG1-mNeonGreen_TUB1-dTomato]mNeonGreen, partial [Binary vector pRATIO2131]The peptide used to elicit this antibody is not conserved in GFP protein sequence. Antibody is also recognzing mCheery sequence.
Strep-tag II is a synthetic peptide consisting of eight amino acids (Trp-Ser-His-Pro-Gln-Phe-Glu-Lys) and this peptide sequence shows high affinity towards Strep-Tactin , a specifically engineered streptavidin, and can be N- or C- terminally fused to recombinant proteins.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Strep-tag II-proteins
Immunogen:
KLH-conjugated synthetic peptide Strep-tag II epitope tag, sequence: ASWSHPQFEKGA
The two Arabidopsis POLLUX-like homologs PEC1 and PEC2 represent plastid envelope membrane cation channels with K + conductivity that are required for the stress triggered Ca 2+ release into the stroma.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Camelina sativa, Capsella rubella, Nicotiana benthamiana, Noccaea caerulescens, Pisum sativum, Raphanus sativus, Species of your interest not listed? Contact us
Immunogen:
The soluble domain 466 (M244 until stop codon, ≈ 64 kDa) was cloned into pET16b and transformed into BLR 21 for 467 expression in Escherichia coli UniProt: Q8VZM7-1, TAIR: At5g02940
V lkner et al (2021) Two plastid POLLUX ion channel-like proteins are required for stress-triggered stromal Ca2+release, Plant Physiology, Volume 187, Issue 4, December 2021, Pages 2110–2125, https://doi.org/10.1093/plphys/kiab424
Special application note:
This antibody is recognizing PEC1, but not PEC2 or DMI1
The anti-Myc tag is a primary antibody which is used to detect proteins containing the Myc epitope tag. The Myc tag contains the amino acid sequence EQKLISEEDL, corresponding to amino acids 410-419 of human Myc.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Myc epitope tag, fused to N- or C-terminal of proteins
Immunogen:
KLH-conjugated synthetic peptide: EQKLISEEDL (Myc tag), derived from UniProt: Q6LBK7
Cat2 (Catalase 2) is an enzyme which occurs in almost all aerobically respiring organisms and serves to protect cells from the toxic effects of hydrogen peroxide.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Alternative oxidases (AOX) are quinol oxidases located in the inner mitochondrial membrane of plants. They function as terminal oxidases in the alternate electron transport pathway, oxidizing ubiquinone to reduce oxygen to water.
Product Type:
Antibody
Antibody Type:
Polyclonal
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from Arabidopsis thaliana AOX2 protein sequence, UniProt: O22049 , TAIR: At5g64210
LexA represor binds specifically to the SOS-box sequence and represses the genes belonging to the SOS regulation. In response to DNA damage, RecA protein is activated by ss-DNA accumulated in the damaged cells and promotes autocleavage of LexA repressor by its coprotease activity. As a result, DNA repair genes and error prone polymerases are induced, and DNA damage is repaired and mutation is induced (1). The lexA gene is used for yeast two-hybrid experiments as a bait to identify the protein-protein interaction in vivo.Alternative names: exrA, spr, tsl, umuA
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Hishida et al (2004) Role of the Escherichia coli RecQ DNA helicase in SOS signaling and genome stabilization at stalled replication forks. Genes Dev. 2004 Aug 1;18(15):1886-97. doi: 10.1101/gad.1223804. PMID: 15289460; PMCID: PMC517408.
Special application note:
This product can be used in:studies of SOS regulation in E.coli detection of bait constructs in yeast two-hybrid systemimmunolocalization of LexA fusion proteins (fixed with 4 % formaldehyde)immunoprecipiation and ChIP
Escherichia coli LexA protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA). LexA‘s self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As a result, the expression of genes belonging to the S
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at -20 °C or -80°Cfor a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
LexA protein is full length, highly purified (over 90 %, SDS-PAGE) provided at a concentration of 1 mg/ml estimated by BCA method. UniProt: P0A7C2
Purity:
Contains 50% glycerol, 10 mM Tris-HCl (pH 7,5), 2 mM EDTA, 100 mM NaCl, 1 mM DTT. Over 90 % pure by SDS-PAGE.
Molecular Weight:
22,3 | 23 kDa
Special application note:
This product can be used in:Functional studies of E.coli SOS response. This product will bind to SOS box in vitro and repress the expression of the genes belonging to SOS regulationWestern blot as a positive control, to confirm that the bait construct is expressed in yeast two-hybrid sstem using lexA genecontrol in ChIP in combination with anti-LexA antibodies
RecA (Recombinase A) plays critically important roles in homologous recombination, recombination repair and regulation of cellular responses to DNA damage (SOS response). RecA promotes auto-cleavage of LexA repressor by its coprotease activity after DNA damage, and induces many proteins related to DNA repair including RecA itself.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Immunogen:
Hihgly purified, full length (352 amino acids) RecA protein of E.coli, UniProt: P0A7G6
Applications:
ELISA (ELISA), Indirect immunofluorescent (IF), Immunoprecipitation (IP), Western blot (WB)
E. coli RecA protein is a very important enzyme for homologous recombination and recombinational repair. Its synthesis is induced by SOS response caused by DNA damage. RecA protein has multiple functions such as single stranded DNA dependent ATPase activity, DNA annealing activity, formation of D-loop and Holliday structure in homologous recombination reaction, and coprotease activities that promote self-cleavages of LexA repressor, lambda phage repressor and UmuD protein. RecA protein binds to single and double stranded DNA for nucleofilament formation. It carries out a central role in homologous recombination.
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at -20 °C or -80°Cfor a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
RecA protein is full length, highly purified (over 90 %, SDS-PAGE) by several steps of chromatography. Provided at a concentration of 1 mg/ml estimated by BCA method. UniProt: P0A7G6
Purity:
Contains 50% glycerol, 20 mM Tris-HCl (pH 8), 1 mM EDTA, 150 mM KCl, 1 mM DTT. Over 90 % pure, by SDS-PAGE
Molecular Weight:
38 kDa
Selected references:
Ishibashi, Oura S & Umemura (2017) Adsorption of DNA binding proteins to functionalized carbon nanotube surfaces with and without DNA wrapping. Eur Biophys J. 2017 Sep;46(6):541-547. doi: 10.1007/s00249-017-1200-3. Epub 2017 Feb 15. PMID: 28204854.Oura et al. (2015) Biomolecular recognition ability of RecA proteins for DNA on single-walled carbon nanotubes. Colloids Surf B Biointerfaces. 2015 Feb 1;126:496-501. doi: 10.1016/j.colsurfb.2015.01.002. Epub 2015 Jan 10. PMID: 25612818.
RuvA protein of Escherichia coli binds specifically to the Holliday structure which is the intermediate of recombination at the late stage of homologous recombination and recombination repair, and forms a complex with RuvB motor protein, allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region. In solution, it forms a tetramer and binds to the cross-like DNA of the Holliday junction from below and above, holding it in between
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor up to 6 monthss, for longer storage-80°Cis recommended; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Immunogen:
Purified, full length RuvA protein of Escherichia coli, UniProt: P0A809
RuvA protein of Escherichia coli binds specifically to the Holliday structure which is the intermediate of recombination at the late stage of homologous recombination and recombination repair and forms a complex with RuvB motor protein allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region. In solution, it forms a tetramer and binds to the cross-like DNA of the Holliday junction from below and above holding it in between.
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at 4°Cor -20 °C for a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
RuvA protein is full length, highly purified (over 90 %, SDS-PAGE). UniProt: P0A809
Purity:
Contains 50% glycerol, 10 mM Tris-HCl (pH 7,5), 2 mM EDTA, 100 mM NaCl, 5 mM mercaptoethanol. Over 90 % pure by SDS-PAGE.
Molecular Weight:
22 kDa (monomer)
Selected references:
Han et al. (2006). Direct observation of DNA rotation during branch migration of Holliday junction DNA by Escherichia coli RuvA-RuvB protein complex. Proc Natl Acad Sci U S A. 2006 Aug 1;103(31):11544-8. doi: 10.1073/pnas.0600753103. Epub 2006 Jul 24. PMID: 16864792; PMCID: PMC1544206.Iwasaki et al. (1992) Escherichia coli RuvA and RuvB proteins specifically interact with Holliday junctions and promote branch migration. Genes Dev. 1992 Nov;6(11):2214-20. doi: 10.1101/gad.6.11.2214. PMID: 1427081.
Special application note:
This product can be used in functional studies as Holliday junction specific binding protein, which promotes Holliday-junction branch migration in combination with RuvB protein
RuvB protein of Escherichia coli forms a complex with RuvA protein and the complex promotes branch migration of Holliday junction at the late stage of homologous recombination and recombination repair. RuvB is a DNA motor protein which possesses the ATPase activity, activated by DNA and RuvA protein. RuvB in the absence of ATP, it predominantly occurs in a monomer form. In the presence of ATP, it forms dimer and hexamer depending upon the concentration. With RuvA and Holliday junction., it forms a double hexamer.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor up to 6 monthss, afterwards at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Immunogen:
Purified, full length, recombinant RuvB protein from E.coli, UniProt: P0A812
E. coli RuvB protein forms a complex with RuvA protein at the late stage of homologous recombination and recombination repair and binds specifically to the Holliday structure which is the intermediate of recombination, allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region.
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at -20 °C or -80°Cfor a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
RuvB protein is full length, highly purified (over 95 %, SDS-PAGE), recombinant. UniProt: P0A812
Purity:
Contans 50% glycerol, 10 mM Tris-HCl (pH 7,5), 2 mM EDTA, 100 mM NaCl, 5 mM mercaptoethanol. Over 95 % pure by SDS-PAGE.
Molecular Weight:
37 kDa
Selected references:
Mazina et al. (2012) Polarity and bypass of DNA heterology during branch migration of Holliday junctions by human RAD54, BLM, and RECQ1 proteins. J Biol Chem. 2012 Apr 6;287(15):11820-32. doi: 10.1074/jbc.M112.341347. Epub 2012 Feb 22. PMID: 22356911; PMCID: PMC3320930.Han et al. (2006). Direct observation of DNA rotation during branch migration of Holliday junction DNA by Escherichia coli RuvA-RuvB protein complex. Proc Natl Acad Sci U S A. 2006 Aug 1;103(31):11544-8. doi: 10.1073/pnas.0600753103. Epub 2006 Jul 24. PMID: 16864792; PMCID: PMC1544206.Iwasaki et al. (1992) Escherichia coli RuvA and RuvB proteins specifically interact with Holliday junctions and promote branch migration. Genes Dev. 1992 Nov;6(11):2214-20. doi: 10.1101/gad.6.11.2214. PMID: 1427081.
Special application note:
This product can be used in:in vitro functional studies. RuvA and RuvB are forming a complex that promotes Holiday junction ( a recombination intermediate) branch-migration by using ATP hydrolysis energy.As a positive control in Western blot and standar in ELISA.
E. coli RuvC protein is a structurally specific endonuclease which binds specifically to the Holliday structure, an intermediate of recombination, at the late stage of homologous recombination and recombination repair and introduces nicks at the symmetrical points of the Holliday junction, cleaving and resolving the recombinant.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 6 monthss, afterwards at -80 C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Immunogen:
Purified, full length, recombinant RuvC protein from E.coli, UniProt: P0A814
Ichiyanagi et al. (1998). Mutational analysis on structure-function relationship of a holliday junction specific endonuclease RuvC. Genes Cells. 1998 Sep;3(9):575-86. doi: 10.1046/j.1365-2443.1998.00213.x. PMID: 9813108.Shinagawa & Iwasaki (1996). Processing the holliday junction in homologous recombination. Trends Biochem Sci. 1996 Mar;21(3):107-11. PMID: 8882584.Saito et al (1995). Identification of four acidic amino acids that constitute the catalytic center of the RuvC Holliday junction resolvase. Proc Natl Acad Sci U S A. 1995 Aug 1;92(16):7470-4. doi: 10.1073/pnas.92.16.7470. PMID: 7638215; PMCID: PMC41361.
E. coli RuvC protein (19 kDa) is a structurally specific endonuclease which binds specifically to the Holliday structure, an intermediate of recombination, at the late stage of homologous recombination and recombination repair and introduces a nick in the symmetrical point of the Holliday junction cleaving and resolving the recombinant.
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at -20 °C or -80°Cfor a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
RuvC protein is full length, highly purified (over 95 %, SDS-PAGE), recombinant without a tag at a concentration of 1 mg/ml (determined by BCA method). UniProt: P0A814
Purity:
Contans 50% glycerol, 10 mM Tris-HCl (pH 7,5), 2 mM EDTA, 100 mM NaCl, 5 mM mercaptoethanol. Over 95 % pure by SDS-PAGE.
Molecular Weight:
18,7 | 19 kDa
Selected references:
Shinagawa & Iwasaki (1996). Processing the holliday junction in homologous recombination. Trends Biochem Sci. 1996 Mar;21(3):107-11. PMID: 8882584.Iwasaki et al. (1991) Escherichia coli RuvC protein is an endonuclease that resolves the Holliday structure. EMBO J. 1991 Dec;10(13):4381-9. PMID: 1661673; PMCID: PMC453191.
Special application note:
This product can be used in:in vitro functional studies. RuvC cleaves recombination intermediate at Holiday JunctionAs a positive control in Western blot and standard in ELISA.
The products of umuD , umuC , and recA genes (SOS genes) are required for mutagenesis induced by radiation or chemical agents. Transcription of these SOS genes is repressed by a repressor, LexA protein in uninduced cells. Exposure of cells to DNA-damaging agents activates RecA protein to promote proteolytic cleavage of LexA protein. Inactivation of LexA protein by the cleavage consequently derepresses the SOS genes, umuD, C and recA . UmuD protein is then auto-cleaved, which is promoted by RecA protein ssDNA in a ATP-dependent manner. The processed UmuD protein is the active form for mutagenesis and the UmuD-UmuC complex functions as an error-prone translesion DNA polymerase.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C and make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Immunogen:
Highly purified, full length, recombinant UmuD protein from E.coli, UniProt: P0AG11
Shinagawa et al. (1998). RecA protein-dependent cleavage of UmuD protein and SOS mutagenesis. Proc Natl Acad Sci U S A. 1988 Mar;85(6):1806-10. doi: 10.1073/pnas.85.6.1806. PMID: 3126496; PMCID: PMC279868.
E. coli DNA polymerase 1 (928 aa; 103 kDa) is encoded by polA gene and involved in DNA replication and repair. In addition to polymerase activity, this DNA polymerase exhibits 3' to 5' and 5' to 3' exonuclease activity. It is able to utilize nicked circular duplex DNA as a template and can unwind the parental DNA strand from its template.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Purified, full length, recombinant POL I protein from E.coli, UniProt: P00582
Cyclobutane Pyrimidine Dimer photolyase (Deoxyribodipyrimidine photo-lyase) is involved in repair of UV radiation-induced DNA damage. Catalyzes the light-dependent monomerization (300-600 nm) of cyclobutyl pyrimidine dimers (in cis-syn configuration), which are formed between adjacent bases on the same DNA strand upon exposure to ultraviolet radiation. Upon absorption of visible light electrons are transferred from Trp-307 through Trp-360 to Trp 383, and from there to FADH, giving rise to the fully reduced catalytic FADH .
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Purified, full length, recombinant DNA photolyase protein from E.coli, UniProt: P00914
Applications:
ELISA (ELISA), Immunoprecipitation (IP), Western blot (WB)
S. cerevisiae Rad 51 protein (400 aa, 43 kDa) is a functional and structural homolog of E.coli RecA and human Rad51 proteins and plays a central role in DNA homologous recombination and recombination repair by promoting homologous DNA strand exchange reaction. Dmcl, Rad55, Rad57 are paralogs of Rad51 and they form complex with Rad51 and Rad52 in mediating recombination processes.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Purified, full length, recombinant and HIS tagged RAD51 protein from Saccharomyces cerevisiae, UniProt: P25454
Applications:
ELISA (ELISA), Chromatin immunoprecipitation (ChIP), Immunofluorescence (IF), Immunoprecipitation (IP), Western blot (WB)
Rfa1 (Replication Factor A protein 1) as part of the replication protein A (RPA/RP-A), a single-stranded DNA-binding heterotrimeric complex, may play an essential role in DNA replication, recombination and repair. Binds and stabilizes single-stranded DNA intermediates, preventing complementary DNA reannealing and recruiting different proteins involved in DNA metabolism. Binds to single-stranded sequences participating in DNA replication in addition to those mediating transcriptional repression (URS1) and activation (CAR1). Stimulates the activity of a cognate strand exchange protein (SEP1). It cooperates with T-AG and DNA topoisomerase I to unwind template DNA containing the simian virus 40 origin of DNA replication.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Purified, recombinant Rfa1 protein (without a tag) from Saccharomyces cerevisiae, UniProt: P22336
Subunit of heterotrimeric Replication Protein A (RPA); RPA is a highly conserved single-stranded DNA binding protein complex involved in DNA replication, repair, recombination; RPA protects against inappropriate telomere recombination, and upon telomere uncapping, prevents cell proliferation by a checkpoint-independent pathway; with Sgs1p-Top2p-Rmi1p, stimulates DNA catenation/decatenation activity of Top3p; protein abundance increases in response to DNA replication stress.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Recombinant Rfa3 protein from Saccharomyces cerevisiae, UniProt: P26755
This protein is an auxiliary protein of DNA polymerase delta and is involved in the control of eukaryotic DNA replication by increasing the polymerase's accessibility during elongation of the leading strand. Involved in DNA repair and recombination.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C and avoid temperature below -25°C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Recombinant PCNA protein from Saccharomyces cerevisiae, UniProt: P15873
Applications:
Chromatin immunoprecipitation (ChIP), Inmunoprecipitation (IP), Western blot (WB)
Rhp51 protein of Schizosaccharomyces pombe (fission yeast) is a functional and structural homolog of E.coli RecA protein and Rad51 proteins of eukaryotes, which play a major role in genetic recombination and recombination repair by mediating strand exchange reaction between homologous DNA strands.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces pombe
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Purified, full length, recombinant Rhp51 protein from Saccharomyces pombe, UniProt: P36601
Applications:
Chromatin immunoprecipitation (ChIP), Immunoprecipitation (IP),Immunofluorescence (IF), Western blot (WB)
Akamatsu et al. (2007) Fission yeast Swi5/Sfr1 and Rhp55/Rhp57 differentially regulate Rhp51-dependent recombination outcomes. EMBO J. 2007 Mar 7;26(5):1352-62. doi: 10.1038/sj.emboj.7601582. Epub 2007 Feb 15. PMID: 17304215; PMCID: PMC1817630.Lambert et al. (2005). Gross chromosomal rearrangements and elevated recombination at an inducible site-specific replication fork barrier. Cell. 2005 Jun 3;121(5):689-702. doi: 10.1016/j.cell.2005.03.022. PMID: 15935756. (Immunoflourescence)Akamatsu et al. (2003) Two different Swi5-containing protein complexes are involved in mating-type switching and recombination repair in fission yeast. Proc Natl Acad Sci U S A. 2003 Dec 23;100(26):15770-5. doi: 10.1073/pnas.2632890100. Epub 2003 Dec 8. PMID: 14663140; PMCID: PMC307643. (Immunoprecipitation, Western Blot)Kibe et al. (2003). Fission yeast Rhp51 is required for the maintenance of telomere structure in the absence of the Ku heterodimer. Nucleic Acids Res. 2003 Sep 1;31(17):5054-63. doi: 10.1093/nar/gkg718. PMID: 12930956; PMCID: PMC212814. (ChIP)
Rad22 protein of Schizosaccharomyces pombe (469 aa, 52 kDa) is a functional and structural homologue of Saccharomyces cerevisiae and human Rad52 proteins, which play a major role together with Rhp51 in genetic recombination and recombination repair, by mediating strand annealing reaction between homologous DNA strands.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces pombe
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Purified, full length, recombinant Rad22 protein from Saccharomyces cerevisiae, UniProt: P36592 overexpressed in E. coli
Applications:
ELISA (ELISA), Immunofluorescence (IF), Immunoprecipiatation (IP), Western blot (WB)
Lehmann (1996). Molecular biology of DNA repair in the fission yeast Schizosaccharomyces pombe. Mutat Res. 1996 Aug 8;363(3):147-61. doi: 10.1016/0921-8777(96)00017-1. PMID: 8765156.
Tubulin is the major constituent of microtubules. There are three members (alpha, beta and gamma) and two subtypes in the tubulin family. Of these members, beta tubulin (449 aa, 51 kDa) is found at microtubule organizing centers (MTOC) such as the spindle poles or the centrosome, suggesting that it is involved in the minus-end nucleation of microtubule assembly during cell cycle.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Schizosaccharomyces pombe
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated C-terminal peptide C-YEIEEEKEPLEY-OH from beta tubulin of Schizosaccharomyces pombe, UniProt: P05219
Applications:
ELISA (ELISA), Immunofluorescence (IF), Western blot (WB)
Immunogen affinity purified serum in PBS and 50 % glycerol, filter sterilized.
Molecular Weight:
51 | 45 kDa
Selected references:
Fedyanina et al. (2009) Tubulin heterodimers remain functional for one cell cycle after the inactivation of tubulin-folding cofactor D in fission yeast cells. Yeast. 2009 Apr;26(4):235-47. doi: 10.1002/yea.1663. PMID: 19330768; PMCID: PMC5705012.
In the eukaryotic cells, DNA is packaged repetitively into nucleosomes by means of interactions among two molecules of four classes of histone, H2A, H2B, H3 and H4. Each of the histone proteins has an evolutionarily conserved amino-terminal ‘tail’ that protrudes from the nucleosome. This tail is the target of numerous diverse signaling pathways, resulting in the addition of many post-translational modifications. These modifications include phosphorylation, acetylation, methylation, ADP-ribosylation and mono-ubiquitination. Many important new modifications within the structured core and the carboxy-terminal tail regions of histones are also being identified. It is becoming increasingly clear that these modifications represent crucial regulatory events that govern the accessibility and function of the genome.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
ChIP method for this antibody is described in Maruyama et al. (2006).
Application Details:
1 : 1000 (WB)
Purity:
Serum. Contains 0.05 % sodium azide.
Molecular Weight:
13,8 | 17, 24-25 kDa (unmodified and mono-ubiquinated H2B)
Selected references:
Maruyama et al (2006). Histone H2B mutations in inner region affect ubiquitination, centromere function, silencing and chromosome segregation. EMBO J. 2006 Jun 7;25(11):2420-31. doi: 10.1038/sj.emboj.7601110. Epub 2006 May 11. PMID: 16688222; PMCID: PMC1478186.
DNA methylation is a type of chemical modification of DNA that can be inherited and subsequently removed without changing the original DNA sequence. Therefore it is part of the epigenetic code and is also the most well characterized epigenetic mechanism. DNA methylation results in addition of a methyl group to DNA — for example, to the number 5 carbon of the cytosine pyrimidine ring — which involves reduction in gene expression. In adult somatic tissues, DNA methylation typically occurs in a CpG dinucleotide context; non-CpG methylation is prevalent in embryonic stem cells.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Purified IgM in PBS. Contains 50 % glycerol, filter sterilized.
Selected references:
Sharif et al. (2007) The SRA protein Np95 mediates epigenetic inheritance by recruiting Dnmt1 to methylated DNA. Nature. 2007 Dec 6;450(7171):908-12. doi: 10.1038/nature06397. Epub 2007 Nov 11. PMID: 17994007.Nishiyama et al. (2002) A chloroplast-resident DNA methyltransferase is responsible for hypermethylation of chloroplast genes in Chlamydomonas maternal gametes. Proc Natl Acad Sci U S A. 2002 Apr 30;99(9):5925-30. doi: 10.1073/pnas.082120199. PMID: 11983892; PMCID: PMC122878.Sano, Imokawa & Sager (1988) Detection of heavy methylation in human repetitive DNA subsets by a monoclonal antibody against 5-methylcytosine. Biochim Biophys Acta. 1988 Nov 10;951(1):157-65. doi: 10.1016/0167-4781(88)90036-x. PMID: 2847796.Sano, Royer & Sager (1980) Identification of 5-methylcytosine in DNA fragments immobilized on nitrocellulose paper. Proc Natl Acad Sci U S A. 1980 Jun;77(6):3581-5. doi: 10.1073/pnas.77.6.3581. PMID: 6251470; PMCID: PMC349661.
DNA methylation is a type of chemical modification of DNA that can be inherited and subsequently removed without changing the original DNA sequence. Therefore it is part of the epigenetic code and is also the most well characterized epigenetic mechanism. DNA methylation results in addition of a methyl group to DNA — for example, to the number 5 carbon of the cytosine pyrimidine ring — which involves reduction in gene expression. In adult somatic tissues, DNA methylation typically occurs in a CpG dinucleotide context; non-CpG methylation is prevalent in embryonic stem cells.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
PhyB (Phytochrome B) is a Red/far-red photoreceptor involved in the regulation of de-etiolation. Protein exists in two inter-convertible forms: Pr and Pfr (active). Involved in the light-promotion of seed germination and in the shade avoidance response. Alternative names: Protein LONG HYPOCOTYL 3, Protein OUT OF PHASE 1, OOP1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Arabis alpina, Camelina sativa, Capsella rubella, Brassica napus, Brassica oleracea, Eutrema salsugineum, Raphanus sativusSpecies of your interest not listed? Contact us
CALS12/PMR4 (Callose synthase 12) is involved in sporophytic and gametophytic development and required for normal leaf development and callose formation induced by wounding and pathogen attack. Alternative names: 1,3-beta-glucan synthase, Protein GLUCAN SYNTHASE-LIKE 5, Protein POWDERY MILDEW RESISTANT 4.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Capsella rubella, Camelina sativa, Eutrema salsugineum, Brassica napus, Brassica oleracea, Brassica rapa, Tarenaya hasslerianaSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana CALS12 protein sequence, UniProt: Q9ZT82 , TAIR: At4g03550
Glyoxalase I (GLO1) is an enzyme that plays a role in the detoxification of methylglyoxal (MG), a side-product of glycolysis, via condensation with glutathione to produce S-lactoyl-glutathione. GLO1 is a zinc metalloenzyme whose crystal structure has been solved. The bacterial and yeast enzymes are monomeric while the mammalian one is homodimeric and its sequence is well conserved. GLO1 is found over-expressed in some tumors. GLO1 has also been suggested to be involved in anxiety diseases, autism, and Alzheimer’s disease.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rat
Species Reactivity:
Human, simian, mouse
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Recombinant, full length mouse GLO1 UniProt: Q9CPU0 fused to GST
Applications:
ELISA (ELISA), Immunofluorescence (IF), Western blot (WB)
Jiang et al. (2018). Role of the Glyoxalase System in Alzheimer's Disease. J Alzheimers Dis. 2018;66(3):887-899. doi: 10.3233/JAD-180413. PMID: 30400091.Hovatta et al. (2005) Glyoxalase 1 and glutathione reductase 1 regulate anxiety in mice. Nature. 2005 Dec 1;438(7068):662-6. doi: 10.1038/nature04250. Epub 2005 Oct 23. PMID: 16244648.Junaid et al. (2004) Proteomic studies identified a single nucleotide polymorphism in glyoxalase I as autism susceptibility factor. Am J Med Genet A. 2004 Nov 15;131(1):11-7. doi: 10.1002/ajmg.a.30349. PMID: 15386471; PMCID: PMC1360505.
Caspases are a family of cysteine proteases which play essential roles in apoptosis. Among them, Caspase 3 is a frequently activated death protease, catalyzing the specific cleavage of many key cellular proteins. Caspase 3 is synthesized as an inactive 32 kDa pro-enzyme which undergo proteolytic processing in response to apoptotic stimulation to produce the active form which consists of the p20/p17, and p12 subunits. Caspase 3 is the predominant caspase involved in the cleavage of Alzheimer amyloid precursor protein (APP), which is associated with neuronal death in Alzheimer ‘s disease. An antibody (named ACP3) against activated caspase 3 was raised in rabbit. This antibody recognizes the active form of human caspase 3, p20/p17 subunit but does not recognize the proenzyme p32.
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Human, Mouse and Rat
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide corresponding to the human caspase 3 cleavage site, 6 aa (CGIETD) UniProt: P42574
Applications:
ELISA (ELISA), Immunolocalisation (IL), Western blot (WB)
The antibody does not react with the proenzyme p32
Application Details:
1: 500 - 1: 1000 (IL), 1:3000-1:1000 (WB)
Purity:
Serum. Contains 0.05 % sodium azide.
Molecular Weight:
31,6 | 17 and 19 kDa
Selected references:
Nishimura et al (2003). Upregulation and antiapoptotic role of endogenous Alzheimer amyloid precursor protein in dorsal root ganglion neurons. Exp Cell Res. 2003 Jun 10;286(2):241-51. doi: 10.1016/s0014-4827(03)00066-1. PMID: 12749853.Nishimura et al. (2002) Cell death induced by a caspase-cleaved transmembrane fragment of the Alzheimer amyloid precursor protein. Cell Death Differ. 2002 Feb;9(2):199-208. doi: 10.1038/sj.cdd.4400931. PMID: 11840170.
The Alzheimer Amyloid Precursor Protein (APP) is a transmembrane protein whose abnormal processing is associated with the pathogenesis of Alzheimer’s disease. APP695 lacking the protease inhibitor domain is the predominant form in neuronal tissues. APP695 is cleaved by caspases into the 664-residue amino (N)-terminal fragment that lacks the carboxyl C-terminal 31-residues (APPC31) and the 31-residues C-terminal fragment (APP-C31). Both fragments might be potent inducers of neuronal apoptosis. An antibody (named ACT1) against the N-terminus of caspase 3-generated APP C-terminal 31 aa of human APP695 (APP-C31 ) was raised in rabbit.
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Human, Mouse, Rat
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Synthetic peptide corresponding to the N-terminal of human caspase 3-generated APP C-terminal 31 amino acids (aa 665-670) UniProt: P05067
Applications:
ELISA (ELISA), Immunolocalisation (IL), Western blot (WB)
Nishimura et al. (2002) Cell death induced by a caspase-cleaved transmembrane fragment of the Alzheimer amyloid precursor protein. Cell Death Differ. 2002 Feb;9(2):199-208. doi: 10.1038/sj.cdd.4400931. PMID: 11840170.
The Alzheimer amyloid precursor protein (APP) is a transmembrane protein whose abnormal processing is associated with the pathogenesis of Alzheimer’s disease. APP695 lacking the protease inhibitor domain is the predominant form in neuronal tissues. APP695 is cleaved by caspases into the 664-residue amino (N)-terminal fragment that lacks the carboxyl C-terminal 31-residues (APP delataC31) and the 31-residues C-terminal fragment (APP-C31). APP delta C31 potentially plays pathophysiological roles in neuronal death.
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Human, mouse, rat
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide corresponding to the C-terminal of the caspase 3-cleaved human APP (aa 658-664 of human APP695) UniProt: P05067
Applications:
ELISA (ELISA), Immunolocalisation (IL), Western blot (WB)
Nishimura et al (2003). Upregulation and antiapoptotic role of endogenous Alzheimer amyloid precursor protein in dorsal root ganglion neurons. Exp Cell Res. 2003 Jun 10;286(2):241-51. doi: 10.1016/s0014-4827(03)00066-1. PMID: 12749853.Nishimura et al. (2002) Cell death induced by a caspase-cleaved transmembrane fragment of the Alzheimer amyloid precursor protein. Cell Death Differ. 2002 Feb;9(2):199-208. doi: 10.1038/sj.cdd.4400931. PMID: 11840170.
Based on IEP this antibody reacts with: F(ab')2 fragment of human IgG. Based on IEP no reactivity is observed to: non-immunoglobulin human serum proteinsFc fragment of human IgG
Application Details:
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified goat IgG.
Special application note:
Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 0.05 % (w/v) of sodium azide as preservative. It is a clear, colourless liquid, filter sterilized.Antibody purity ≥95% based on SDS-PAGE.
Based on IEP this antibody reacts with: F(ab')2 fragment of human IgG. Based on IEP no reactivity is observed to: Fc fragment of human IgGnon-immunoglobulin human serum proteinsserum proteins from bovine, horse and mouse
Application Details:
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified goat IgG.
Special application note:
Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 0.05 % (w/v) of sodium azide as preservative. It is a clear, colourless liquid, filter sterilized.Antibody purity ≥95% based on SDS-PAGE.
Nucleaoprotein (N) of Novel Coronavirus SARS-CoV-2/ 2019-nCoV (human) plays a fundamental role during virion assembly through packaging of the positive strand viral genome RNA into a helical ribonucleocapsid (RNP).Alternative names: NC, Protein N, Nucleocapsid protein
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80°C. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Human Nucleoprotein (N) of Novel Coronavirus SARS-CoV-2/ 2019-nCoV
Immunogen:
Recombinant Human Novel Coronavirus Nucleoprotein (N) (1-419aa), UniProt: P0DTC9
Affinity chrompatography purified in 10 mM PBS, pH 7.4, 50 % glycerol, 0.03% Proclin 300.
Molecular Weight:
48 | 55 kDa
Special application note:
This product is a capture antibody, which can be combined with Detection antibody: AS21 4577 | Anti-Nucleoprotein (N) of Novel Coronavirus SARS-CoV-2/ 2019-nCoV (human), monoclonal antibodiesand Positive control: AS20 4388 | Human Novel Coronavirus Nucleoprotein(N)
Nucleaoprotein (N) of Novel Coronavirus SARS-CoV-2/ 2019-nCoV (human) plays a fundamental role during virion assembly through packaging of the positive strand viral genome RNA into a helical ribonucleocapsid (RNP).Alternative names: NC, Protein N, Nucleocapsid protein
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C or -80°C. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Human Nucleoprotein (N) of Novel Coronavirus SARS-CoV-2/ 2019-nCoV
Immunogen:
Recombinant Human Novel Coronavirus Nucleoprotein (N) (1-419aa), UniProt: P0DTC9
Affinity chrompatography purified in 10 mM PBS, pH 7.4, 50 % glycerol, 0.03% Proclin 300.
Molecular Weight:
48 | 55 kDa
Special application note:
This is a detection antibody, which can be combined with Capture antibody:AS21 4576 | Anti-Nucleoprotein (N) of Novel Coronavirus SARS-CoV-2/ 2019-nCoV (human), monoclonal antibodies and Positive control: AS20 4388 | Human Novel Coronavirus Nucleoprotein(N)
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
AKIN10 (E.C.= 2.7.11.1) is a catalytic subunit of the putative trimeric SNF1-related protein kinase (SnRK) complex, which may play a role in a signal transduction cascade regulating gene expression and carbohydrate metabolism in higher plants. Synonymes: AKIN alpha-2
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica oleracea, Brassica napus, Camelina sativa, Capsella rubella, Eutrema salsugineum, Raphanus sativusSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from C-terminal part of Arabidopsis thaliana AKIN10 sequence UniProt: Q38997, TAIR: At3g01090
EGFP is an Energy-transfer acceptor. Its role is to transduce the blue chemiluminescence of the protein aequorin into green fluorescent light by energy transfer. Fluoresces in vivo upon receiving energy from the Ca(2+)-activated photoprotein aequorin. Contains a chromophore consisting of modified amino acid residues. The chromophore is formed by autocatalytic backbone condensation between Xaa-N and Gly-(N+2), and oxidation of Tyr-(N+1) to didehydrotyrosine. Maturation of the chromophore requires nothing other than molecular oxygen.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lypholized antibody at 4 °C. After reconstitution keep aliquots at -20 °C for a higher stability. Avoid repetitive freeze/thaw cycles. Centrifuge briefly to remove any insoluble material.Expiry date: 12 months after purchase if unopened
Host Animal:
Rabbit
Species Reactivity:
GFP, EGFP
Immunogen:
Recombinant GFP from Aequorea coerulescens (belt jellyfish) overexpressed and purified from E.coli, UniProt: Q6YGZ0
LEA (Late embryogenesis abundant) proteins are very hydrophilic proteins, described over 25 years ago as accumulating during late stages of plant seed development. Found in vegetative plant tissues following exposure to environmental stress.Synonymes: Putative late embryogenesis abundant protein LEA.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana (recombinant LEA6)
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana LEA6 protein sequences, UniProt: O64820, TAIR: At2g23110, UniProt: Q8S8R1 TAIR: AT2G23120 and UniProt: O23658, TAIR: AT2G33690
HaloTag is derived from the haloalkane dehalogenase enzyme DhaA of Rhodococcus rhodochrous and can be incorporated to a protein of interest (POI) and facilitate cellular and biochemical analysis.. HaloTag is a trademark of Promega Corporation.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Recombinant proteins with HaloTag
Expected Species:
Recombinant proteins with HaloTag
Immunogen:
KLH-conjugated peptide derived from DhaA of Rhodococcus rhodochrous, so called HaloTag .
Saccharomyces cerevisiae Rnr1 (EC=1.17.4.1) is an enzyme from ribonucleoside diphosphate reductase large chain family. Is localized to cytoplasm and provides precursors necessary for DNA synthesis. Alternative names: ribonucleotide reductase large subunit 1, ribonucleotide reductase R1 subunit 1
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Two KLH-conjugated synthetic peptides derived from c-terminal of Saccharomyces cerevisiae Rnr1 protein, sequence UniProt: P21524
PDLP1 (Plasmodesmata-located protein 1) mediates callose deposit during fungal infection and is required for systemic acquired resistance (SAR), mediated by azelaic acid (AzA), glycerol-3-phosphate (G3P), and salicylic acid (SA). Alternative names: PD-located protein 1,Cysteine-rich repeat secretory protein 56, Plasmodesmata localizing protein 1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Phosphinothricin N-acetyltransferase (BAR) is an enzyme is an effector of phosphinothricin tripeptide (PTT or bialaphos) resistance, herbicide resitance gene. BAR (BASTA) gene is used as a selectable marker for genetic transformation of plants.Alternative names: PPT N-acetyltransferase, Phosphinothricin-resistance protein.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
BAR (BASTA)
Expected Species:
Streptomyces viridochromogenesSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from position 170-183 of Phosphinothricin N-acetyltransferase (BAR or BASTA), UniProt: P16426
BAR (BASTA) gene is a selectable marker of plant genetic transformation, Nada (2016). Novel recombinant binary vectors harboring Basta (bar) gene as a plant selectable marker for genetic transformation of plants. Physiol Mol Biol Plants. 2016 Apr; 22(2): 241–251.
Application Details:
1 : 1000 - 1: 5000 (WB)
Purity:
Antigen affinity purified serum, in PBS pH 7.4
Reconstitution:
For reconstitution add 50 l, of sterile or deionized water.
Molecular Weight:
20.6 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
To be added when available, antibody available in May 2023.
Phosphinothricin N-acetyltransferase (BAR) is an enzyme is an effector of phosphinothricin tripeptide (PTT or bialaphos) resistance, herbicide resitance gene. BAR (BASTA) gene is used as a selectable marker for genetic transformation of plants.Alternative names: PPT N-acetyltransferase, Phosphinothricin-resistance protein.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
BAR (BASTA)
Expected Species:
Streptomyces viridochromogenesSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from position 36-50 of Phosphinothricin N-acetyltransferase (BAR or BASTA), UniProt: P16426
BAR (BASTA) gene is a selectable marker of plant genetic transformation, Nada (2016). Novel recombinant binary vectors harboring Basta (bar) gene as a plant selectable marker for genetic transformation of plants. Physiol Mol Biol Plants. 2016 Apr; 22(2): 241–251.
Application Details:
1 : 1000 (WB)
Purity:
Antigen affinity purified serum, in PBS pH 7.4
Reconstitution:
For reconstitution add 50 l, of sterile or deionized water.
Molecular Weight:
20.6 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
To be added when available, antibody available in May 2023.
This is a key enzyme of plant metabolism catalyzing the first reaction in the biosynthesis from L-phenylalanine of a wide variety of natural products based on the phenylpropane skeleton.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Nicotiana benthamiana
Expected Species:
Arabidopsis thaliana, Hibiscus syriacus, Lotus corniculatus, Solanum dulcamara, Solanum lycopersicum,Vigna unguiculata, Species of your interest not listed? Contact us
Actin is a highly conserved protein and an essential component of cell cytoskeleton and plays an important role in cytoplasmic streaming, cell shape determination, cell division, organelle movement and extension growth. Preferentially expressed in young and expanding tissues, floral organ primordia, developing seeds and emerging inflorescence.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Beta-Galactosidase is an enzyme (EC:3.2.1.23) involved in hydrolysis of terminal non-reducing beta-D-galactose residues into beta-D-galactosides. The protein is encoded by lacZ gene.Alternative names: Beta-gal, Lactase, GalB
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on the label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Escherichia coli, GalB-tagged fusion proteins
Immunogen:
beta-Galactosidase purified from E. coli. UniProt: P00722
Horseradish peroxidase removes hydrogen peroxide, acts in oxidation of toxic reductants, biosynthesis and degradation of lignin, response to environmental stresses such as wounding, pathogen attack and oxidative stress. HRP is also used as an epitope tag, for protein overexpression.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on the label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Immunocytochemistry: this was successfully used for staining of formaldehyde-fixed, Triton-permeabilized cells transfected with HRP gene
Application Details:
1 g/ml (WB)
Conjugation:
IgG1
Isotype:
IgG1
Purity:
Purified by precipitation and chromatography.
Selected references:
To be added when available. Antibody released in October 2021.
Special application note:
The antibody binds horseradish peroxidase, It is suitable for preparation of PAP (Peroxidase-Anti-Peroxidase soluble complexes), where three molecules of HRP are complexed with two molecules of anti-HRP antibodies
Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on the label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Species independent
Immunogen:
BSA-conjugated phosphotyrosine
Applications:
Immunocyto chemistry (ICC), Flowcyt (FC), Western blot (WB)
Mouse anti-DYKDDDDK is a primary antibody which binds to DYKDDDDK (Sigma FLAG ). The small size of this tag and its high hydrophilicity decrease the probability of interference with its expression, proteolytic maturation, antigenicity, localization and function.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on the label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
DYKDDDDK (Sigma FLAG ) epitope tag
Immunogen:
KLH-conjugated synthetic peptide: DYKDDDDK (Sigma FLAG )
c-Myc is derived from Myc proto-oncogene protein. The c-Myc protein is a transcription factor (nuclear localization). c-Myc is commonly activated in a variety of tumor cells and plays an important role in cellular proliferation, differentiation, apoptosis and cell cycle progression. A short peptide was used as an epitope tag, that is easily recognized by tag specific antibodies. This is a universal detection reagent which will allow detection of any c-Myc tag containing protein.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on the label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
c-Myc tagged fusion proteins
Immunogen:
Conjugated synthetic peptide: AEEQKLISEEDLL derived from the C-terminal region of human c-Myc. UniProt: P01106
Applications:
Flow cytometry (Flowcyt), Immunohistochemistry (IHC), paraffin, Immunoprecipitation (IP), Western blot (WB)
GST-tag (glutathione S-transferase) from a parasite Schistosoma japonicum is a tag added to a protein of interest as a fusion protein for protein purification and detection. It allows purification by affinity chromatography on immobilized glutathione. GST is utilized as a fusion protein with foreign proteins in a range of prokaryotic expression vectors, including the pGEX family of vectors. The tag is 220 amino acid long, ca. 26 kDa which makes it quite large compare to Myc or FLAG tags.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on the label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
To be added when available, antibody released in October 2021.
Special application note:
This antibody is recognizing native and denatured fusion proteins containing the GST-Tag sequence expressed in E. coli, yeast, mammalian, and in vitro transcription/translation systems. It can be also used for immuno purification of GST-tagged proteins.
Nitrotyrosine can be detected in proteins from a variety of tissues, usually in association with pathological conditions. Reaction of nitric oxide with superoxide produces peroxynitrite, which can undergo heterolytic cleavage into nitronium and hydroxyl ions. Nitration of tyrosine residues by nitronium ion forms nitrotyrosine groups in the respective proteins. Nitrotyrosine is thus a marker for inflammation-associated tissue damage.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on the label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Nitrotyrosine ,Nitrotyrosine
Immunogen:
NO2-Tyr-CH2-Thyroglobulin
Applications:
Immunohistochemistry (IHC) paraffin, Iimmunohistochemistry (IHC) frozen sections, Western blot (WB)
Dendra2 is an improved version of green-to-red photo switchable protein Dendra, from an octocoral (Dendronephthya) and compared to it, Dendra2 exhibits brighter fluorescence before and after photoswitching. Excitation maximum of Dendra2 is 490 nm before and 553 nm after photoactivation, and its emission maximum is 507 nm before and 573 nm after photoactivation. Activating light for Dendra2 is UV/violet to blue. Nonactivated Dendra2 spectral characteristics are similar to EGFP, and this green fluorescence can be detected at low light intensities of blue light. At high intensities of the same blue light (or of UV/violet light) Dendra2 is photoactivated and gets emission characteristics similar to TRITC.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on the label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Dendra2-tagged proteins
Immunogen:
Dendra2 tag protein
Applications:
Immunocytochemistry (ICC), Flow cytometry (FlowCyt) (QC tested), Western blot (WB)
Tubulin alpha (TUA) together with beta tubulin is making up microtubules. The microtubules are intracellular dynamic polymers made up of evolutionarily conserved polymorphic alpha/beta-tubulin heterodimers and a large number of microtubule-associated proteins (MAPs). The microtubules consist of 13 protofilaments and have an outer diameter 25 nm. Microtubules have their intrinsic polarity; highly dynamic plus ends and less dynamic minus ends. Microtubules are required for vital processes in eukaryotic cells including mitosis, meiosis, maintenance of cell shape and intracellular transport.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on the label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
c-Myc is derived from Myc proto-oncogene protein. The c-Myc protein is a transcription factor (nuclear localization). c-Myc is commonly activated in a variety of tumor cells and plays an important role in cellular proliferation, differentiation, apoptosis and cell cycle progression. A short peptide was used as an epitope tag, that is easily recognized by tag specific antibodies. This is a universal detection reagent which will allow detection of any c-Myc tag containing protein.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on the label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
c-Myc tagged fusion proteins
Immunogen:
Conjugated synthetic peptide: AEEQKLISEEDLL derived from the C-terminal region of human c-Myc. UniProt: P01106
Applications:
Immunoprecipitation (IP), Immunohistochemisty (IHC), paraffin, Flow cytometry (Flowcyt), Western blot (WB)
Tubulin alpha (TUA) together with beta tubulin is making up microtubules. The microtubules are intracellular dynamic polymers made up of evolutionarily conserved polymorphic alpha/beta-tubulin heterodimers and a large number of microtubule-associated proteins (MAPs). The microtubules consist of 13 protofilaments and have an outer diameter 25 nm. Microtubules have their intrinsic polarity; highly dynamic plus ends and less dynamic minus ends. Microtubules are required for vital processes in eukaryotic cells including mitosis, meiosis, maintenance of cell shape and intracellular transport.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store in the dark at 2-8°C. Do not freeze. Avoid prolonged exposure to light. Do not use after expiration date stamped on vial label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
c-Myc is derived from Myc proto-oncogene protein. The c-Myc protein is a transcription factor (nuclear localization). c-Myc is commonly activated in a variety of tumor cells and plays an important role in cellular proliferation, differentiation, apoptosis and cell cycle progression. A short peptide was used as an epitope tag, that is easily recognized by tag specific antibodies. This is a universal detection reagent which will allow detection of any c-Myc tag containing protein.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store in the dark at 2-8°C. Do not freeze. Avoid prolonged exposure to light. Do not use after expiration date stamped on vial label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
c-Myc tagged fusion proteins
Immunogen:
Conjugated synthetic peptide: AEEQKLISEEDLL derived from the C-terminal region of human c-Myc. UniProt: P01106
c-Myc is derived from Myc proto-oncogene protein. The c-Myc protein is a transcription factor (nuclear localization). c-Myc is commonly activated in a variety of tumor cells and plays an important role in cellular proliferation, differentiation, apoptosis and cell cycle progression. A short peptide was used as an epitope tag, that is easily recognized by tag specific antibodies. This is a universal detection reagent which will allow detection of any c-Myc tag containing protein.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 mg/ml.
Storage Temp:
Store in the dark at 2-8°C. Do not freeze. Avoid prolonged exposure to light. Do not use after expiration date stamped on vial label. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
c-Myc tagged fusion proteins
Immunogen:
Conjugated synthetic peptide: AEEQKLISEEDLL derived from the C-terminal region of human c-Myc. UniProt: P01106
Luciferase is an enzyme that catalyzes a light-emitting reaction and can be found in bacteria, algae, fungi, jellyfish, insects, shrimp, and squid, and the resulting light that these organisms produce is termed bioluminescence. Bacterial luciferase genes (luxA, luxB, luxC, luxD, and luxE), responsible for the light-emitting reaction (the lux genes) have been used in construction of bioreporters that emit a blue-green light with a maximum intensity at 490 nm.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Photobacterium fischeri
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Luciferase isolated and purified from Photobacterium fischeri
Applications:
ELISA (ELISA),Dot blot (Dot), Indirect immunofluorescence (indirect IF), Western blot (WB)
Luciferase is an enzyme that catalyzes a light-emitting reaction and can be found in bacteria, algae, fungi, jellyfish, insects, shrimp, and squid, and the resulting light that these organisms produce is termed bioluminescence. Bacterial luciferase genes (luxA, luxB, luxC, luxD, and luxE), responsible for the light-emitting reaction (the lux genes) have been used in construction of bioreporters that emit a blue-green light with a maximum intensity at 490 nm.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Photobacterium fischeri
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Luciferase isolated and purified from Photobacterium fischeri
Applications:
ELISA (ELISA), Dot blot (Dot), Indirect immunofluorescence (indirect IF), Western blot (WB)
NADH-FMN oxidoredutase is an enzyme involved in riboflavin metabolism and often forms a two-component system with monooxygenases and displays a strong preference for NADH over NADPH. Alternative names: FMN reductase (NADH); NADH-FMN reductase; NADH-dependent FMN reductase; NADH:FMN oxidoreductase; NADH:flavin oxidoreductase
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Photobacterium fischeriSpecies of your interest not listed?Contact us.support@agrisera.com
Expected Species:
Species of your interest not listed?Contact us.support@agrisera.com
Immunogen:
NADH-FMN oxidoredutase isolated and purified from Photobacterium fischeri
Applications:
ELISA (ELISA), Dot blot (Dot), Indirect immunofluorescence (indirect IF), Western blot (WB)
Nuclease from Staphylococcus aureus is an enzyme secreted by these bacteria to degrade neutrophil extracellular trap of a host.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Staphylococcus aureus
Expected Species:
Species of your interest not listed?Contact us
Immunogen:
Nuclease isolated and purified from Staphylococcus aureus
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF),Western blot (WB)
Nuclease from Staphylococcus aureus is an enzyme secreted by these bacteria to degrade neutrophil extracellular trap of a host.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Staphylococcus aureus
Expected Species:
Species of your interest not listed?Contact us
Immunogen:
Nuclease isolated and purified from Staphylococcus aureus
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Ribonucleic acid polymerase DNA-dependent RNA polymerase (RNAP) catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. This subunit plays an important role in subunit assembly since its dimerization is the first step in the sequential assembly of subunits to form the holoenzyme.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Ribonucleic acid polymerase isolated and purified from Escherichia coli, UniProt: P0A7Z4
Applications:
Indirect immunofluorescence (indirect IF)ELISA (ELISA),Dot blot (Dot),Western blot (WB)
Ribonucleic acid polymerase DNA-dependent RNA polymerase (RNAP) catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. This subunit plays an important role in subunit assembly since its dimerization is the first step in the sequential assembly of subunits to form the holoenzyme.
Product Type:
Antibody
Antibody Type:
PolyclonalRibonucleic acid polymerase isolated and purified from Escherichia coli, Freund's complete adjuvant is used in the first step of the immunization procedure
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Ribonucleic acid polymerase isolated and purified from Escherichia coli, UniProt: P0A7Z4
Applications:
Dot blot (Dot), ELISA (ELISA),Immunocytochemistry (IHC), (ICC),Immunohistochemistry (paraffin), Western blot (WB)
Gluconate kinase is involved in the pathway D-gluconate degradation, which is part of carbohydrate acid metabolism.Alternative names: Gluconate kinase 2, Thermoresistant gluconokinase
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Gluconate kinase is isolated and purified from Escherichia coli, UniProt: P46859
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Gluconate kinase is involved in the pathway D-gluconate degradation, which is part of carbohydrate acid metabolism.Alternative names: Gluconate kinase 2, Thermoresistant gluconokinase
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Gluconate kinase isolated and purified from Escherichia coli, UniProt: P46859
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Phosphoglucose isomerase, is a cytoplasmic enzyme, which catalyses the conversion of glucose-6-phosphate to fructose-6-phosphate, the second step in glycolysis, and the reverse reaction during gluconeogenesis. Alternative names: GPI , Phosphoglucose isomerase, PGI Phosphohexose isomerase, PHI
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Phosphoglucose isomerase isolated and purified from Saccharomyces cerevisiae, UniProt: P12709
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Phosphoglucose isomerase, is a cytoplasmic enzyme, which catalyses the conversion of glucose-6-phosphate to fructose-6-phosphate, the second step in glycolysis, and the reverse reaction during gluconeogenesis. Alternative names: GPI , Phosphoglucose isomerase, PGI Phosphohexose isomerase, PHI
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Phosphoglucose isomerase isolated and purified from Saccharomyces cerevisiae, UniProt: P12709
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
3-Phosphoglyceric phosphokinase is an enzyme which generates ATP by catalysing the transfer of a phosphate group from 1,3-diphosphoglycerate to ADP, in glycolysis and gluconeogenesis.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
3-Phosphoglyceric phosphokinase isolated and purified from Saccharomyces cerevisiae, UniProt: P00560
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
3-Phosphoglyceric phosphokinase is an enzyme which generates ATP by catalysing the transfer of a phosphate group from 1,3-diphosphoglycerate to ADP, in glycolysis and gluconeogenesis.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
3-Phosphoglyceric phosphokinase isolated and purified from Saccharomyces cerevisiae
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Alkaline phosphatase is an enzyme which is involved in dephosphorylation process. Found in periplasmic space in Escherichia coli. Alternative name: APase
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Alkaline phosphatase isolated and purified from Escherichia coli, UniProt: P00634
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Alkaline phosphatase is an enzyme which is involved in dephosphorylation process. Found in periplasmic space in Escherichia coli. Alternative name: APase
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Alkaline phosphatase isolated and purified from Escherichia coli, UniProt: P00634
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Hexokinase is an enzyme which catalyzes the phosphorylation of hexose, such as D-glucose and D-fructose, to hexose 6-phosphate (D-glucose 6-phosphate and D-fructose 6-phosphate, respectively).Alternative names: Hexokinase PII, Hexokinase-B
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Hexokinase isolated and purified from Saccharomyces cerevisiae, UniProt: P04807
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Hexokinase is an enzyme which catalyzes the phosphorylation of hexose, such as D-glucose and D-fructose, to hexose 6-phosphate (D-glucose 6-phosphate and D-fructose 6-phosphate, respectively).Alternative names: Hexokinase PII, Hexokinase-B
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Hexokinase isolated and purified from Saccharomyces cerevisiae, UniProt: P04807
Glyceraldehyde-3-phosphate dehydrogenase is an enzyme of a first step of the pathway that synthesizes pyruvate from D-glyceradehyde 3-phosphate. Alternative name: GAPDH 3
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Glyceraldehyde-3-phosphate dehydrogenase isolated and purified from Saccharomyces cerevisiae, UniProt: P00359
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Glyceraldehyde-3-phosphate dehydrogenase is an enzyme of a first step of the pathway that synthesizes pyruvate from D-glyceradehyde 3-phosphate. Alternative name: GAPDH 3
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Glyceraldehyde-3-phosphate dehydrogenase isolated and purified from Saccharomyces cerevisiae, UniProt: P00359
Applications:
Dot blot (Dot), ELISA (ELISA), Immunocytochemistry (IHC), Western blot (WB)
Glutathion reductase (GR) is an enzyme responsible for maintaining of high levels of reduced glutathionein the cytosol.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Glutathione reductase isolated and purified from Saccharomyces cerevisiae, UniProt: P41921
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Glutathion reductase (GR) is an enzyme responsible for maintaining of high levels of reduced glutathionein the cytosol.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Glutathione reductase isolated and purified from Saccharomyces cerevisiae, UniProt: P41921
Beta-Galactosidase is an enzyme involved in hydrolysis of terminal non-reducing beta-D-galactose residues in beta-D-galactosides. Alternative names: Beta-gal, Lactase
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
beta-Galactosidase is isolated and purified from Escherichia coli, UniProt: P00722
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Beta-Galactosidase is an enzyme involved in hydrolysis of terminal non-reducing beta-D-galactose residues in beta-D-galactosides. Alternative names: Beta-gal, Lactase
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
beta-Galactosidase is isolated and purified from Escherichia coli, UniProt: P00722
Applications:
Dot blot (Dot), ELISA (ELISA), Immunocytochemistry (IHC), Western blot (WB)
Formate dehydrogenase is an enzyme which is catalysing oxidation of formate to carbon dioxide.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Isolated and purified formate dehydrogenase from Saccharomyces cerevisiae, UniProt: Q08911
Applications:
Dot blot (Dot), ELISA (ELISA), Indirect immunofluorescence (indirect IF), Western blot (WB)
Formate dehydrogenase is an enzyme which is catalysing oxidation of formate to carbon dioxide.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Formate dehydrogenase is isolated and purified from Saccharomyces
Applications:
Dot blot (Dot), ELISA (ELISA),Immunocytochemistry (IHC), (ICC),Immunohistochemistry (paraffin), Western blot (WB)
Choline kinase is an enzyme which catalyzes the committed step in the synthesis of phosphatidylcholine by the CDP-choline pathway. Alternative name: ATP:choline phosphotransferase
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Choline kinase isolated and purified from Saccharomyces cerevisiae, UniProt: P20485
Applications:
ELISA (ELISA), Dot blot (Dot), Indirect immunofluorescence (indirect IF), Western blot (WB)
Choline kinase is an enzyme which catalyzes the committed step in the synthesis of phosphatidylcholine by the CDP-choline pathway. Alternative name: ATP:choline phosphotransferase
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Choline kinase isolated and purified from Saccharomyces cerevisiae, UniProt: P20485
Aldehyde dehydrogenase in an enzyme involved in synthesis of acetate from ethanol. Alternative name: Aldehyde dehydrogenase 1, mitochondrial
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Aldehyde dehydrogenase isolated and purified from Saccharomyces cerevisiae, UniProt: P22281
Applications:
ELISA (ELISA), Dot blot (Dot), Indirect immunofluorescence (indirect IF), Western blot (WB)
Aldehyde dehydrogenase in an enzyme involved in synthesis of acetate from ethanol. Alternative name: Aldehyde dehydrogenase 1, mitochondrial
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Aldehyde dehydrogenase isolated and purified from Saccharomyces cerevisiae, UniProt: P22281
Applications:
ELISA (ELISA), Dot blot (Dot), Immunocytochemistry (IHC), Western blot (WB)
Alcohol dehydrogenase is an isozyme which preferentially catalyzes the conversion of primary unbranched alcohols to a corresponding aldehydes. Alternative names: Alcohol dehydrogenase I, YADH-1
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Alcohol dehydrogenase isolated and purified from UniProt: P00330
Applications:
ELISA (ELISA), Dot blot (Dot), Indirect immunofluorescence (indirect IF), Western blot (WB)
ATP synthase is the universal enzyme that synthesizes ATP from ADP and phosphate using the energy stored in a transmembrane ion gradient. AtpA is the largest subunit of the membrane-extrinsic ATP synthase subcomplex.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii
Expected Species:
Colemanosphaera charkowiensis, Eudorina elegans,Gonium pectorale, Pandorina colemaniae, Pleodorina starrii, Volvox africanus, Yamagishiella unicocca Species of your interest not listed? Contact us
Immunogen:
CF 1 alpha subunit of the chloroplast ATP synthase complex isolated from Chlamydomonas reinhardtii, UniProt: P26526
mStrawberry is constitutively fluorescent, red fluorescent protein derived from Discosoma sp. developed in Dr. Roger Tsien’s lab by directed mutagenesis of mRFP (Shaner et al. 2004). The mStrawberry fluorescent protein photobleaches rapidly, threfore mCherry is recommended for applications in which require a more photostable red monomer.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tube.
V5-tag is a tag that can be added to a protein of interest as a fusion protein to enable purification and detection. It is derived from a small epitope (Pk) present on the P and V proteins of the paramyxovirus of simian virus (SV5). Addition of a V5-Tag to a protein of interest makes it possible to localize a specific gene product in a variety of cell types, study the topology of proteins and protein complexes, identify associated proteins, and characterize newly identified, low abundance or poorly immunogenic proteins when protein specific antibodies are not available.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
V5-tagged fusion proteins
Immunogen:
KLH-conjugated GKPIPNPLLGLDST synthetic peptide
Applications:
ELISA (ELISA), Immunofluorescence (IF), Immunoprecipitation (IP), Western blot (WB)
GST-tag (glutathione S-transferase) is a tag added to a protein of interest as a fusion protein to unable purification and detection. The tag is 220 amino acid long, ca. 26 kDa which makes it quite large compare to Myc or FLAG tags.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C for up to 3 years, Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Immunogen:
GST (glutathione S-transferase) recombinant protein
MBP (Maltose binding protein) is encoded by the malE gene of E.coli and is a commonly used tag when studying protein expression using a wide range of applications. MBP tag enables easy purification of proteins from bacterial extracts under mild conditions.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C for up to 1 year, Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
T7 epitope tag consists of 11 amino acids in the leader sequence of T7 bacteriophage gene10 and is used as a tag in many expression vectors including pET system. Specific anti-T7 tag antibodies are suitable for detection of T7-tagged proteins.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
KT3 epitope tag consists of 11 amino acids in the leader sequence of T7 bacteriophage gene10 and is used as a tag in many expression vectors including pET system. Specific anti-T7 tag antibodies are suitable for detection of T7-tagged proteins.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
HSV (herpes simplex virus) eptiope tag originates from envelope glycoprotein D. It is frequently used to target N- or C- terminus of a protein of interest to allow target protein detection, in case when specific antibodies are not available.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Strep-tag II is a synthetic peptide consisting of eight amino acids (Trp-Ser-His-Pro-Gln-Phe-Glu-Lys) and this peptide sequence shows high affinity towards Strep-Tactin , a specifically engineered streptavidin, and can be N- or C- terminally fused to recombinant proteins.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Trx (Thioredoxin 1) is a redox protein with a primary domain conserved across a number of Trx family members. The protein contains a conserved catalytic site Cys-Gly-Pro-Cys. The protein is used as a fusion tag in a number of molecular biology applications.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
S-tag from pancreatic ribonuclease A (RNase A). Due to abundance of charged and polar residues, this tag may improve solubility of recombinant proteins. It can be fused at the N- or C-terminus of a target protein.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
The anti-Myc tag is a primary antibody which is used to detect proteins containing the Myc epitope tag. The Myc tag contains the amino acid sequence EQKLISEEDL, corresponding to amino acids 410-419 of human Myc.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
CBP tag comes from muscle myosin light-chain kinase and contains 26 amino acid residues with the molecular weight of 4 kDa. This tag is characterized by the relatively high affinity for calmodulin (CaM), which makes it possible to purify CBP-tagged proteins from crude cell extracts using of a resin with CaM affinity. This antibody allows detection of CBP-tagged proteins.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
TAP (tandem-affinity-purification) epitope tag makes a rapid purification of low abundance complexes. TAP approach can be combined with mass spectrometry to allow identification of protein interactions with a given target protein.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C, Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
TAP epitope tag
Immunogen:
TAP epitope tag, sequence: CSSGALDYDIPTTASENLYFQ, derived from the C-terminus of the TAP-tag construct after TEV cleavage,
The PsbO protein is an extrinisic subunit of the water splitting photosystem II (PSII) complex. The protein is exposed on the luminal side of the thylakoid membrane, and is hihgly conserved in all known oxygenic photosynthetic organisms.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii
Expected Species:
Halomicronema hongdechloris, Synechocystissp., Synechococcus elongatusSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Chlamydomonas reinhardtii PsbO protein sequence, UniProt: P12853
ASY1 (Asynapsis 1) is a protein required for normal meiosis in male and female gametophytes, which plays a crucial role in coordinating the activity of DMC1. Alternative names: Meiosis-specific protein ASY1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Hordeum vulgare
Expected Species:
Arabidopsis thaliana, Hordeum vulgare, Oryza sativa, Triticum aestivum, Zea maysSpecies of your interest not listed? Contact us
Immunogen:
Recombinant ASY1 protein from Hordeum vulgare, UniProt: A0A8I6YI54
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at +4°C(short term) and at -20 °C (long term).
Rabbit IgG negative control for ChIP is suitable for chromatin immunoprecipitation (ChIP) and has been validated for this assay as well as for MeDIP, IF and other experiments where primary antibodies made in a rabbit are used. This preparation contains a pool of the IgG subclasses from the serum of healthy rabbits.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cor -20 °C; and make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Mouse IgG negative control for ChIP is suitable for chromatin immunoprecipitation (ChIP) and has been validated for this assay as well as for MeDIP, IF and other experiments where primary antibodies made in a mouse are used. This preparation contains a pool of the IgG subclasses from the serum of healthy mice.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 4°Cor -20 °C; and make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
GFP (Green fluorescent protein) was originally identified in photo organs on jellyfish Aequorea victoria. It is a naturally fluorescent protein which emits green light at a maximum wavelength of 509 nm when excited by blue or UV light. It is extensively used in laboratory as a reporter molecule to label and study cellular and subcellular proteins in living cells using a wide range of applications. Antibodies to GFP protein are used in immunoblotting and ELISA. GFP protein has molecular weight of 27 kDa.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes
Host Animal:
Mouse
Species Reactivity:
GFP-tagged proteins
Immunogen:
Recombinant GFP protein derived from Aequorea victoria, UniProt: P42212
Botulinum toxin is a toxin produced by the anaerobic, gram-positive, bacterium of the genus Clostridium (C. botulinum, C. butyricum, C. baratii and C. argentinense). These strains are widely distributed and can be found in soil and dust. Eight types of botulinum toxin are distinguished, named type A–H. Type A and B are capable of causing disease in humans (botulism) and have longest activity in vivo, and are also used commercially (BOTOX) and medically. Types C–G are less common; types E and F can cause disease in humans, while the other types cause disease in other animals. Type E is a cause of botulism in humans. BotE is cleaved into two chains: heavy and light. Alternative names: Bontoxilysin-E, BoNT, BotE,
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Antibody should be stored at -20 °C.Aliquote to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
Clostridium botulinum
Immunogen:
Recombinant Botulinum Neurotoxin Type E Light Chain (Clostridium botulinum).
Botulinum toxin is a toxin produced by the anaerobic, gram-positive, bacterium of the genus Clostridium (C. botulinum, C. butyricum, C. baratii and C. argentinense). These strains are widely distributed and can be found in soil and dust. Eight types of botulinum toxin are distinguished, named type A–H. Type A and B are capable of causing disease in humans (botulism) and have longest activity in vivo, and are also used commercially (BOTOX) and medically. Types C–G are less common; types E and F can cause disease in humans, while the other types cause disease in other animals. Type E is a cause of botulism in humans. BotE is cleaved into two chains: heavy and light. Alternative names: Bontoxilysin-E, BoNT, BotE,
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Antibody should be stored at -20 °C.Aliquote to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
Clostridium botulinum
Immunogen:
Recombinant Botulinum Neurotoxin Type E Light Chain (Clostridium botulinum).
Botulinum toxin is a toxin produced by the anaerobic, gram-positive, bacterium of the genus Clostridium (C. botulinum, C. butyricum, C. baratii and C. argentinense). These strains are widely distributed and can be found in soil and dust. Eight types of botulinum toxin are distinguished, named type A–H. Type A and B are capable of causing disease in humans (botulism) and have longest activity in vivo, and are also used commercially (BOTOX) and medically. Types C–G are less common; types E and F can cause disease in humans, while the other types cause disease in other animals. Type E is a cause of botulism in humans. BotE is cleaved into two chains: heavy and light. Alternative names: Bontoxilysin-E, BoNT, BotE,
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Antibody should be stored at -20 °C.Aliquote to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
Clostridium botulinum
Immunogen:
Recombinant Botulinum Neurotoxin Type E Light Chain (Clostridium botulinum).
TOC1 /TIMING OF CAB EXPRESSION 1) is involved in a negative regulation of gene expression and cytokinin activated signaling. Influences carbon fixation and biomass through the circadian clock period.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana TOC1 phosphorylated protein sequence, UniProt: A0A178UC73, TAIR: AT5G61380
TOC1 is heat sensitive and requires specific extraction buffer and denaturation conditions, described in application example. Using other conditions, may contribute to lack of detection of phosphorylation of TOC1 using this antibody.
Application Details:
1 : 1000 (WB)
Purity:
Antigen affinity purified serum, in PBS pH 7.4
Reconstitution:
For reconstitution add 50 l, of sterile or deionized water.
Molecular Weight:
69.195 | kDa (due to N-terminal or C-terminal processing)
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
To be added when available, antibody available in December 2022.
FREE1 (Protein FREE1) is involved in the regulation of mulitivesicular/prevacuolar compartment protein sorting. Regulates multivesicular body (MVB) protein sorting and plant growth. Alternative names: FYVE domain protein required for endosomal sorting 1, FYVE domain-containing protein 1,FYVE1, PDE330, Pigment Defective Embryo 330.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana FREE1 protein sequence, UniProt: Q9ASS2, TAIR: At1g20110
PetD (Cytochrome b6-f complex subunit 4) is the component of the cytochrome b6-f complex, which mediates electron transfer between photosystem II (PSII) and photosystem I (PSI), cyclic electron flow around PSI, and state transitions. Alternative name: 17 kDa polypeptide
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
CHLH (GUN5) (Magnesium-chelatase subunit ChlH, chloroplastic) is a protein involved in chlorophyll synthesis, plastid to nucleus retrograde signaling and ABA perception. Alternative names: ABA-binding protein, Mg-protoporphyrin IX chelatase subunit ChlH, Protein CONDITIONAL CHLORINA, Protein GENOMES UNCOUPLED 5, Protein RAPID TRANSPIRATION IN DETACHED LEAVES 1
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Hordeum vulgare
Expected Species:
Acaryochloris marina, Halomicronema hongdechloris, Synechocystis sp. 6803Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana CHLH protein sequence, UniProt: Q9FNB0, TAIR: At5g13630
UVR8 (Ultraviolet-B receptor UVR8) is a signaling component that acts as UV-B photoreceptor and plays a key role in establishing UV-protective responses in plants. Upon UV-B irradiation, UVR8 undergoes an immediate switch from homodimer to monomer, accumulates in the nucleus, interacts with the photomorphogenic repressor COP1 and regulates the expression of the transcription factor HY5 by associating with chromatin (through histone H2B binding) in the HY5 promoter region. Involved in controlling aspects of leaf growth and morphogenesis in response to UV-B, is required for normal progression of endocycle and has a regulatory role in stomatal differentiation as well as is required for plant circadian clock response to photomorphogenic UV-B light. Promotes photosynthetic efficiency at elevated levels of UV-B. Plays a role in mediating the effects of UV-B radiation on pathogen resistance by controlling the expression of the sinapate biosynthetic pathway. Alternative names: RCC1 domain-containing protein UVR8,Protein UV-B RESISTANCE 8.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica napus, Coffea arabica, Capsicum annuum, Glycine soja, Gossypium australe, Hordeum vulgare, Ipomoea triloba, Malus domestica, Nicotiana benthamiana, Nicotiana tabacum, Solanum lycopersicum, Solanum tuberosum, Oryza sativa, Phtheirospermum japonicum, Populus alba x Populus x berolinensis, Senna tora, Triticum aestivum, Triticum urartu, Turnera subulata, Zea maysSpecies of your interest not listed? Contact us
AURKAIP1 mouse (Aurora kinase A-interacting protein) may act as a negative regulator of Aurora-A kinase, by down-regulation through proteasome-dependent degradation. Alternative names: 28S ribosomal protein S38, mitochondrial (MRP-S38), AURKA-interacting protein.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Mouse
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Recombinat mouse AURKAIP1 protein expressed in E.coli, UniProt: Q9DCJ7
DCL5 (Zea mays Dicer-like 102) may be involved in precise slicing in a range of monocots.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Zea mays DCL5 protein sequence UniProt: A0A1D6KSK2
PsaD (PSI-D subunit of photosystem I) can form complexes with ferredoxin and ferredoxin-oxidoreductase in photosystem I (PS I) reaction center. Alternative names: Photosystem I 20 kDa subunit, PSI-D.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii
Immunogen:
PsaD of Chlamydomonas reinhardtii, UniProt: Q39615
PsaE (PSI-E subunit of photosystem I) assists in docking of the ferredoxin to PSI and stabilizes the interaction between PsaC and the PSI core. Alternative names: P30 protein, Photosystem I 8.1 kDa protein,Photosystem I reaction center subunit IV, chloroplastic, PSI-E.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii
Immunogen:
PsaE of Chlamydomonas reinhardtii, UniProt: P12352
PsaF (PSI-F subunit of photosystem I) is a plastocyanin-docking protein, involved in electron transfer from plastocyanin to c553. Alternative names: PSI-F.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii
Immunogen:
PsaF of Chlamydomonas reinhardtii, UniProt: A8J4S1
Alb3.2 (Inner membrane ALBINO3-like protein 2, chloroplastic) is involved in the assembly of the light-harvesting complex and interacts with reaction center polypeptides of PSI and PSII.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii
Expected Species:
Scenedesmus sp. PABB004
Immunogen:
6xHis tagged, recombinant C-terminal part of Chlamydomonas reinhardtii Alb3.2, UniProt Q8LKI3. Chosen sequence is not conserved in Alb3.1.
Can be provided with ProClin, if requested. For Western blot image, check the original publication G hre et al. 2006.
Application Details:
1: 5000 - 1 : 10 000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water.
Molecular Weight:
44.7 kDa
Not reactive in:
Arabidopsis thaliana, Zea mays
Selected references:
Gohre et al (2006). One of two alb3 proteins is essential for the assembly of the photosystems and for cell survival in Chlamydomonas. Plant Cell. 2006 Jun;18(6):1454-66. doi: 10.1105/tpc.105.038695. Epub 2006 May 5. PMID: 16679460; PMCID: PMC1475496.
VSV-G tag corresponds to the partial peptide sequence of the vesicular stomatitis virus glycoprotein from Rhabdoviridae family, and consists of a single RNA molecule that encodes five proteins, one of which is a surface glycoprotein (G).. This epitope tag can be added to a protein from any species to allow further protein detection using different techniques like: immunolocalization, immunoprecipitation or Western blot.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid in PBS
Storage Temp:
Store at -20 °C; Avoid repeated freeze/thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes. For long term storage, transfer to -80 C
Strep-tag II is a synthetic peptide consisting of eight amino acids (Trp-Ser-His-Pro-Gln-Phe-Glu-Lys coded also as WSHPQFEKGS) and can be N- or C- terminally fused to recombinant proteins.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid in PBS at 0.5 mg/ml.
Storage Temp:
Store at 4°C for 1-2 weeks (short term). For log term storage, aliquot and store at -20 °C and below, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Mouse
Species Reactivity:
Artificial sequence (3x WSHPQFEKGS)
Immunogen:
Recombinant human protein containing three tandem repeated Strep II tags (3xStrep-tag), separated by GlySer-linker sequence, at the N-terminus (expressed in HEK293 cells).
Xyloglucans are polysaccharides commonly referred to as hemicelluloses found in the primary cell walls of vascular plants. Species of trees known as sycamore include: Acer pseudoplatanus, Ficus sycomorus, Platanus orientalis,Platanus occidentalis,Platanus racemosa,Platanus wrightii.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store up to 1 month at 4 C, later at -80°C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Mouse
Species Reactivity:
Fucosylated xyloglucan, epitope XXFG
Immunogen:
BSA-conjugated (covalently) xyloglucan of Acer pseudoplatanus
Xylans are polysaccharides and belong to a group of hemicelluloses found in cell walls of plants and in red and green algae. Their backbones are built by beta-1,4-linked xylosyl residues.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store up to 1 month at 4 C, later at -80°C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Mouse
Species Reactivity:
Phormium cookianum, Sorghum bicolor, Zea mays
Immunogen:
High arabinose xylan from Phormium cookianum conjugated to Me-BSA
Xylans are polysaccharides and belong to a group of hemicelluloses found in cell walls of plants and in red and green algae. Their backbones are built by beta-1,4-linked xylosyl residues.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store up to 1 month at 4 C, later at -80°C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Mouse
Species Reactivity:
Xylan (low arab) from Phormium tenax, Phormium spp.
Mucilage, a thick, viscous, gley substance of a polar glycoprotein and exopolysaccharide, is found on nearly all plants and some micoorganisms. It plays a role in the storage of water and food, thickening membranes and seed germination.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -80°C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Rat
Species Reactivity:
Higher plants
Immunogen:
Polysaccharide Arabinogalactan-protein (AGP) from Oryza sativa
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Rat
Species Reactivity:
Higher plants
Immunogen:
Polysaccharide Arabinogalactan-protein (AGP) from Oryza sativa
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Rat
Species Reactivity:
Higher plants
Immunogen:
Polysaccharide Arabinogalactan-protein (AGP) from Oryza sativa
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Rat
Species Reactivity:
Higher plants
Immunogen:
Polysaccharide Arabinogalactan-protein (AGP) from Oryza sativa
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Rat
Species Reactivity:
Higher plants
Immunogen:
Polysaccharide Arabinogalactan-protein (AGP) from Oryza sativa
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Rat
Species Reactivity:
Higher plants
Immunogen:
Polysaccharide Arabinogalactan-protein (AGP) from Oryza sativa
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Rat
Species Reactivity:
Higher plants
Immunogen:
Polysaccharide Arabinogalactan-protein (AGP) from Oryza sativa
Xylan is a group of hemicelluloses that reside in plant cells walls and also can be found in some algae (both green and red). Xylans are polysaccharides whose backbone consists of beta-1,4-linked xylosyl residues. This backbone can be substituted with side-chains of arabinosyl, glucuronosyl, and 4-O-mthylglucuronosyl residues, and can also be further modified by acetyl substitution on the hydroxyls of the xylosyl residues.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles, Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Biotin has a high affinity to avidin or streptavidin and is there used as a common tag.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Lyophilized powder is stable for a minimum of 2 years at -20 °C. Reconstitute in distilled water before use. Store reconstituted antibodies at 4°Cfor up to a month and make aliquots for extended storage.
Host Animal:
Mouse
Species Reactivity:
Antibody detects free biotin and biotin bound on a carrier protein.
Immunogen:
Biotin
Applications:
ELISA (ELISA), Immunohistochemistry (IHC), Western blot (WB)
Digoxigenin (DIG) is an hapten from plants (Digitalis) and can be used as an epitope tag in many biological applications.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Lyophilized powder is stable for a minimum of 2 years at -20 °C. Reconstitute in distilled water before use. Store reconstituted antibodies at 4°Cfor up to a month and make aliquots for extended storage.
Host Animal:
Mouse
Species Reactivity:
Antibody detects free and bound digoxigenin tag
Immunogen:
Digoxigenin
Applications:
ELISA (ELISA), Immunohistochemistry (IHC), Western blot (WB)
Fluorescein, a fluorophore is a commonly used dye in microscopy studies.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Lyophilized powder is stable for a minimum of 2 years at -20 °C. Reconstitute in distilled water before use. Store reconstituted antibodies at 4°Cfor up to a month and make aliquots for extended storage.
Host Animal:
Mouse
Species Reactivity:
Antibody detects free and bound fluorescein.
Immunogen:
Fluorescein
Applications:
ELISA (ELISA), Immunocytochemistry (ICC), Western blot (WB)
Aflatoxins are naturally occurring mycotoxins that are produced by many species of Aspergillus. Aflatoxins are toxic and among the most carcinogenic substances known. Crops which are frequently affected by Asperiillus include cereals (maize, sorghum, pearl millet, rice, wheat), oilseeds (peanut, soybean, sunflower, cotton), spices (chile peppers, black pepper, coriander, turmeric, ginger), and tree nuts (almond, pistachio, walnut, coconut, brazil nut).
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Lyophilized powder is stable for a minimum of 2 years at -20 °C. Reconstitute in distilled water before use. Store reconstituted antibodies at 4°Cfor up to a month and make aliquots for extended storage.
Host Animal:
Mouse
Species Reactivity:
Antibody detects aflatoxin B1 from Aspergillus sp.
Zearalenone is a RAL and F-2 mycotoxin produced by some Fusarium and Gibberella species. It is a potent estrogenic metabolite and is the primary toxin causing infertility, abortion or other breeding problems, especially in swine. Zearalenone is found in a many cereal crops, such as maize, barley, oats, wheat, rice, sorghum as well as in bread all over the world.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Lyophilized powder is stable for a minimum of 2 years at -20 °C. Reconstitute in distilled water before use. Store reconstituted antibodies at 4°Cfor up to a month and make aliquots for extended storage.
Host Animal:
Mouse
Species Reactivity:
Antibody detects zearalenone mycotoxin of Fusarium sp.
Keyhole limpet hemocyanin (KLH) is a large cooper-containing protein consisting of subunits with MW of 400 kDa. It is found in the hemolymph of the sea mollusk Megathura crenulata. This extracellular respiratory protein has many immunostimulatory properties, including the ability to enhance the host’s immune response by interacting with T cells, monocytes, macrophages, and polymorphonuclear lymphocytes. Since its discovery, KLH has been used primarily as a carrier for vaccines and antigens and as adjuvant treatment in regimens such as antimicrobial therapy.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Lyophilized powder is stable for a minimum of 2 years at -20 °C. Reconstitute in distilled water before use. Store reconstituted antibodies at 4°Cfor up to a month and make aliquots for extended storage.
Host Animal:
Mouse
Species Reactivity:
Reacts with Keyhole Limpet 8-9 kDa Hemocyanin protein.
Protein present in plant vascular tissue (xylem and vascular cambium) is detected by anti-KLH antibodies (H glund et al. 2002) which might lead to false results in IL when using anti-peptide antibodies generated to KLH-conjugated peptide.
MBP (Maltose binding protein) is encoded by the malE gene of E.coli and is a commonly used tag when studying protein expression using a wide range of applications. MBP tag enables easy purification of proteins from bacterial extracts under mild conditions.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Lyophilized powder is stable for a minimum of 2 years at -20 °C. Reconstitute in distilled water before use. Store reconstituted antibodies at 4°Cfor up to a month and make aliquots for extended storage.
Host Animal:
Mouse
Species Reactivity:
MBP maltose binding protein epitope tag
Immunogen:
MBP epitope tag protein.
Applications:
ELISA (ELISA), Immunocytochemistry (ICC), Immunofluorescence (IF), Western blot (WB)
Aflatoxins are naturally occurring mycotoxins that are produced by many species of Aspergillus. Aflatoxins are toxic and among the most carcinogenic substances known. Crops which are frequently affected by Asperiillus include cereals (maize, sorghum, pearl millet, rice, wheat), oilseeds (peanut, soybean, sunflower, cotton), spices (chile peppers, black pepper, coriander, turmeric, ginger), and tree nuts (almond, pistachio, walnut, coconut, brazil nut).
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Lyophilized powder is stable for a minimum of 2 years at -20 °C. Reconstitute in distilled water before use. Store reconstituted antibodies at 4°Cfor up to a month and make aliquots for extended storage.
Aflatoxins are naturally occurring mycotoxins that are produced by many species of Aspergillus. Aflatoxins are toxic and among the most carcinogenic substances known. Crops which are frequently affected by Asperiillus include cereals (maize, sorghum, pearl millet, rice, wheat), oilseeds (peanut, soybean, sunflower, cotton), spices (chile peppers, black pepper, coriander, turmeric, ginger), and tree nuts (almond, pistachio, walnut, coconut, brazil nut).
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Lyophilized powder is stable for a minimum of 2 years at -20 °C. Reconstitute in distilled water before use. Store reconstituted antibodies at 4°Cfor up to a month and make aliquots for extended storage.
Heat-shock protein 70 (Hsp70) is the major stress-inducible protein in vertebrates and is highly conserved throughout evolution. It plays a role as a molecular chaperone and is important for allowing cells to cope with acute stressor insult, especially those affecting the protein machinery. Heat shock cognate protein 70 (HSC70), is a highly conserved protein and a member of the family of molecular chaperones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid at 1 g/ l
Storage Temp:
Stable for at least one year at -20 °C. Avoid multiple freeze-thaw cycles, prepare aliquotes. Please, remember to spin a tube briefly prior opening them to avoid any loses that might occur from material adhering to the cap or sides of the tube.
Cas9 (CRISPR-associated endonuclease 9) is an RNA-guided DNA endonuclease associated with the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) type II adaptive immunity system. CRISPR clusters are transcribed and processed into CRISPR RNA (crRNA). Cas9 protein serves as a genome engineering tool to induce site-directed double strand breaks in DNA. Alternative name: Csn1.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 4 C; Please remember to spin tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tubes.
Host Animal:
Mouse
Species Reactivity:
Cas9 from Streptococcus pyogenes
Immunogen:
Recombinant protein part from the N-terminus of Cas9 from Streptococcus pyogenes.
Ribosomal protein L4, chloroplastic, is one of the primary proteins involved in rRNA-binding, located in chloroplast. Alternative names: EMB2784, EMBRYO DEFECTIVE 2784, PLASTID RIBOSOMAL PROTEIN L4, PRPL4, RIBOSOMAL PROTEIN L4.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Psb27-H1 (Photosystem II repair protein 27) is involved in repair of photodamaged photosystem II (PSII). Localized in the chloroplast lumen, and involved in cellular response to light intensity. Alternative name: Thylakoid lumenal protein PSB27-H1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica oleracea, Brassica rapa,Capsella rubella, Coffea arabica,Camellia sinensis,Cucurbita pepo subsp. pepo, Erythranthe guttata,Gossypium hirsutum, Hevea brasiliensis, Hibiscus syriacu,Morus notabilis, Populus alba, Populus trichocarpa,Raphanus sativus, Quillaja saponaria Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana PSB27-H1 protein sequence, UniProt: Q9LR64, TAIR: At1g03600
Freshly extracted samples are recommended for the analysis. For protein transfer, use a membrane with a pore size of 0.2 m to secure that the protein will transfer correctly, as described here.
Application Details:
1 : 1000 (WB)
Purity:
Antigen affinity purified serum, in PBS pH 7.4
Reconstitution:
For reconstitution, add 50 l, of sterile or deionized water.
Molecular Weight:
18.8 | 11.7 | kDa (due to terminal processing)
Not reactive in:
Chlamydomonas reinhardtii
Selected references:
To be added when available, antibody available in April 2023.
The plasma membrane H+ ATPase of plants and fungi generates a proton gradient that drives the active transport of nutrients by H+-symport
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
ELF4 (Early flowering 4) is the component of the central CCA1/LHY-TOC1 negative feedback loop in the circadian clock that promotes clock accuracy and is required for sustained rhythms in the absence of daily light/dark cycles. Increases ELF3 nuclear distribution and localization in nuclear bodies. ELF4 is necessary for light-induced expression of both CCA1 and LHY and mediates both entrainment to an environmental cycle and circadian rhythm sustainability under constant conditions. Controls flowering time. Alternative name: Protein ARRHYTHMIC 44.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Lyophilized antibody can be stored at -20 °C for up to several years. Once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Immunogen:
KLH-conjugated peptide derived from N-terminal of Arabidopsis thaliana ELF4, UniProt: O04211, TAIR: AT2G40080
LEA (Late embryogenesis abundant) proteins are very hydrophilic proteins, described over 25 years ago as accumulating during late stages of plant seed development. Found in vegetative plant tissues following exposure to environmental stress. Synonymes: Putative late embryogenesis abundant protein LEA.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. This antibody, directed to branched galactan, is now a cell wall marker that can facilitate the study of vascular development across a range of different angiosperms.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Torode, O Neill, Marcus et al. (2018) Branched Pectic Galactan in Phloem-Sieve-Element Cell Walls: Implications for Cell Mechanics. Plant Physiol. 2018;176(2):1547-1558. doi:10.1104/pp.17.01568
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Marcus et al. (2010) Restricted access of proteins to mannan polysaccharides in intact plant cell walls, the plant joutnal, volume 64, Issue 2, October 2010
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Davies et al. (1997) Induction of extracellular matrix glycoproteins in Brassica petioles by wounding and in response to Xanthomonas campestris. Mol Plant Microbe Interact. 1997;10(7):812-820. doi:10.1094/MPMI.1997.10.7.812Wang. et al. (1995) The monoclonal antibody JIM19 modulates abscisic acid action in barley aleurone protoplasts. Planta 196, 271-276 (1995). https://doi.org/10.1007/BF00201384
The plant cell wall surrounds the plant cell as a complex network of polysaccharides classed as: cellulose, hemicelluloses and pectic polysaccharides and glycoproteins. Anchored to or embedded into plant cell wall are other polymers, like: lignin, suberin or cutin. Arabinogalactans can be found in plants as free glycans, or attached to rhamnogalacturonan-I or protein backbones.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C. Make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from any material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Davies et al. (1997) Induction of extracellular matrix glycoproteins in Brassica petioles by wounding and in response to Xanthomonas campestris. Mol Plant Microbe Interact. 1997;10(7):812-820. doi:10.1094/MPMI.1997.10.7.812Wang. et al. (1995) The monoclonal antibody JIM19 modulates abscisic acid action in barley aleurone protoplasts. Planta 196, 271-276 (1995). https://doi.org/10.1007/BF00201384
Rubisco catalyzes the rate-limiting step of carbon dioxide fixation in photosynthesis. This enzyme contains two subunits, each present in eight copies. In plants and green algae, 55-kD large subunit is coded by the chloroplast rbcL gene, and the 15-kD small subunit is coded by a family of nuclear RbcS genes.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
LEA (Late embryogenesis abundant) proteins are very hydrophilic proteins, described over 25 years ago as accumulating during late stages of plant seed development. Found in vegetative plant tissues following exposure to environmental stress. Synonymes: Putative late embryogenesis abundant protein LEA.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
LEA (Late embryogenesis abundant) proteins are very hydrophilic proteins, described over 25 years ago as accumulating during late stages of plant seed development. Found in vegetative plant tissues following exposure to environmental stress. Synonymes: Putative late embryogenesis abundant protein LEA.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Part of a recombinant Arabidopsis thaliana LEA4-5, corresponding to position 78-158, UniProt: Q9FG31 , TAIR: AT5G06760
LEA (Late embryogenesis abundant) proteins are very hydrophilic proteins, described over 25 years ago as accumulating during late stages of plant seed development. Found in vegetative plant tissues following exposure to environmental stress. Synonymes: Putative late embryogenesis abundant protein LEA.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
TIPs belong to MIP/aquaporin protein family. Alternative names: Aquaporin TIP1-1,gamma-tonoplast intrinsic protein, gamma-TIP, aquaporin TIP, gamma-tonoplast intrinsic protein, gamma-TIP, aquaporin TIP, tonoplast intrinsic protein, root-specific RB7, gamma-tonoplast intrinsic protein 2, gamma-TIP2, salt stress-induced tonoplast intrinsic protein
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Oryza sativa
Expected Species:
Brassica napus, Gossypium hirsutum, Hordeum vulgare, Populus trichocarpa, Raphanus sativus, Ricinus communisSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide conserved in Raphanus sativus TIP1;1 and TIP1;2 (protein accesion number available in Suga et al. 2001). Peptide is also conserved in Arabidopsis thaliana TIP1-1 P25818, At2g36830, TIP1-2 Q41963, At3g26520
Protein or membrane sample should be treated at 70 C for 10 min before loading on the gel.Diluted antibody solution can be used 2 to 3 times within one month if it contains 0.1 % sodium azide as preservative and is stored at -20 °C to -80 C.Triton X-100 should not be included in the protein extraction buffer, when cell organelles or membrane proteins must be separated from soluble proteins. Because, Triton X breaks membrane structure and solubilizes most membranes proteins. Furthermore, it should be noted that Triton X at high concentrations binds SDS and mask the detergent effect of SDS for SDS-PAGE. Also, micelles of Triton X behave as a large complex with molecular mass of 90 kDa at high concentrations in SDS-PAGE.
Application Details:
1 : 1000 (WB)
Purity:
Antigen affinity purified serum, in PBS pH 7.4
Reconstitution:
For reconstitution, add 50 l of sterile water.
Molecular Weight:
25,8 | 23 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Mao and Sun (2015). Arabidopsis seed-specific vacuolar aquaporins are involved in maintaining seed longevity under the control of ABSCISIC ACID INSENSITIVE 3. J Exp Bot. 2015 May 26. pii: erv244.Suga et al. (2001). Specificity of the accumulation of mRNAs and proteins of the plasma membrane and tonoplast aquaporings in radish organs. Planta 212:294-304.
PDR8 protein is a key factor which controls the extent of cell death in defense response. Alternative names: ABC transporter ABCG.36, AtABCG36, pleiotropic drug resistance protein 8, protein PENETRATION 3
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Camelina sativa, Eutrema salsugineumSpecies of your interest not listed? Contact us
XLG2 protein is involved in G protein-coupled receptor signaling pathway and is involved in defense response, hypersensitive response and response to bacterium.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Recombinant XLG2 of Arabidopsis thaliana UniProt: C6KIE6, TAIR: AT4G34390
Keyhole limpet hemocyanin (KLH) is a large cooper-containing protein consisting of subunits with MW of 400 kDa. It is found in the hemolymph of the sea mollusk Megathura crenulata. This extracellular respiratory protein has many immunostimulatory properties, including the ability to enhance the host’s immune response by interacting with T cells, monocytes, macrophages, and polymorphonuclear lymphocytes. Since its discovery, KLH has been used primarily as a carrier for vaccines and antigens and as adjuvant treatment in regimens such as antimicrobial therapy.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Megathura crenulata - most commonly used carrier protein
Antibody can be used as a negative control to determine if observed signal is generated by anti-KLH or anti-peptide antibodies, Due to its large size KLH protein will be very difficult to separate on SDS-PAGE
Application Details:
1: 10 000 (ELISA), 1: 10 000 (WB), 1: 1000 (IL)
Purity:
Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
ca, 400 kDa/subunit
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Geadkaew et al. (2014). Bi-functionality of Opisthorchis viverrini aquaporins. doi:10.1016/j.biochi.2014.11.013.H glund et al. (2002). An Antigen Expressed During Plant Vascular Development Crossreacts with Antibodies Towards KLH (Keyhole Limpet Hemocyanin). J of Histochem & Cytochem. 50:999-1003.
Special application note:
Protein present in plant vascular tissue (xylem and vascular cambium) is detected by anti-KLH antibodies (H glund et al. 2002) which might lead to false results in IL when using anti-peptide antibodies generated to KLH-conjugated peptide.
Keyhole limpet hemocyanin (KLH) is a large cooper-containing protein consisting of subunits with MW of 400 kDa. It is found in the hemolymph of the sea mollusk Megathura crenulata. This extracellular respiratory protein has many immunostimulatory properties, including the ability to enhance the host’s immune response by interacting with T cells, monocytes, macrophages, and polymorphonuclear lymphocytes. Since its discovery, KLH has been used primarily as a carrier for vaccines and antigens and as adjuvant treatment in regimens such as antimicrobial therapy.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
Megathura crenulata - most commonly used carrier protein
Antibody can be used as a negative control to determine if observed signal is generated by anti-KLH or anti-peptide antibodies. Due to its large size KLH protein will be very difficult to separate on SDS-PAGE.Optimal working dilution has to be determined by end user.
Application Details:
1 : 5 000 (ELISA), 1 : 1000 (IL), 1 : 5 000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4, conjugated to ALP.
Molecular Weight:
ca, 400 kDa/subunit
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Protein present in plant vascular tissue (xylem and vascular cambium) is detected by anti-KLH antibodies (H glund et al. 2002) which might lead to false results in IL when using anti-peptide antibodies generated to KLH-conjugated peptide. Further information about it can be found here.
Keyhole limpet hemocyanin (KLH) is a large cooper-containing protein consisting of subunits with MW of 400 kDa. It is found in the hemolymph of the sea mollusk Megathura crenulata. This extracellular respiratory protein has many immunostimulatory properties, including the ability to enhance the host’s immune response by interacting with T cells, monocytes, macrophages, and polymorphonuclear lymphocytes. Since its discovery, KLH has been used primarily as a carrier for vaccines and antigens and as adjuvant treatment in regimens such as antimicrobial therapy.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
Megathura crenulata - most commonly used carrier protein
Antibody can be used as a negative control to determine if observed signal is generated by anti-KLH or anti-peptide antibodies, Due to its large size KLH protein will be very difficult to separate on SDS-PAGE
Application Details:
1: 5 000 (ELISA), 1: 5 000 (WB), 1: 1000 (IL)
Purity:
Immunogen affinity purified serum in PBS, pH 7.4, conjugated to biotin.
Molecular Weight:
ca, 400 kDa/subunit
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Protein present in plant vascular tissue (xylem and vascular cambium) is detected by anti-KLH antibodies (H glund et al. 2002) which might lead to false results in IL when using anti-peptide antibodies generated to KLH-conjugated peptide.
Keyhole limpet hemocyanin (KLH) is a large cooper-containing protein consisting of subunits with MW of 400 kDa, It is found in the hemolymph of the sea mollusk Megathura crenulata, This extracellular respiratory protein has many immunostimulatory properties, including the ability to enhance the host's immune response by interacting with T cells, monocytes, macrophages, and polymorphonuclear lymphocytes, Since its discovery, KLH has been used primarily as a carrier for vaccines and antigens and as adjuvant treatment in regimens such as antimicrobial therapy.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 488.
Molecular Weight:
ca, 400 kDa/subunit
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known.
Selected references:
To be added when available. Antibody released in May 2023.
Special application note:
Protein present in plant vascular tissue (xylem and vascular cambium) is detected by anti-KLH antibodies (H glund et al, 2002) which might lead to false results in IL when using anti-peptide antibodies generated to KLH-conjugated peptide.DyLight 488 Amax = 493 nm, Emax = 519 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
Keyhole limpet hemocyanin (KLH) is a large cooper-containing protein consisting of subunits with MW of 400 kDa, It is found in the hemolymph of the sea mollusk Megathura crenulata, This extracellular respiratory protein has many immunostimulatory properties, including the ability to enhance the host's immune response by interacting with T cells, monocytes, macrophages, and polymorphonuclear lymphocytes, Since its discovery, KLH has been used primarily as a carrier for vaccines and antigens and as adjuvant treatment in regimens such as antimicrobial therapy.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 594.
Molecular Weight:
ca, 400 kDa/subunit
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known,
Selected references:
To be added when available. Antibody released in May 2023.
Special application note:
Protein present in plant vascular tissue (xylem and vascular cambium) is detected by anti-KLH antibodies (H glund et al, 2002) which might lead to false results in IL when using anti-peptide antibodies generated to KLH-conjugated peptide.DyLight 594 has Amax = 593 nm, Emax = 618 nm.DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
Keyhole limpet hemocyanin (KLH) is a large cooper-containing protein consisting of subunits with MW of 400 kDa, It is found in the hemolymph of the sea mollusk Megathura crenulata, This extracellular respiratory protein has many immunostimulatory properties, including the ability to enhance the host's immune response by interacting with T cells, monocytes, macrophages, and polymorphonuclear lymphocytes, Since its discovery, KLH has been used primarily as a carrier for vaccines and antigens and as adjuvant treatment in regimens such as antimicrobial therapy.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 650.
Molecular Weight:
ca, 400 kDa/subunit
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known.
Selected references:
To be added when available. Antibody released in May 2023.
Special application note:
Protein present in plant vascular tissue (xylem and vascular cambium) is detected by anti-KLH antibodies (H glund et al, 2002) which might lead to false results in IL when using anti-peptide antibodies generated to KLH-conjugated peptide.DyLight 650 has Amax = 652 nm, Emax = 672 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
Keyhole limpet hemocyanin (KLH) is a large cooper-containing protein consisting of subunits with MW of 400 kDa. It is found in the hemolymph of the sea mollusk Megathura crenulata. This extracellular respiratory protein has many immunostimulatory properties, including the ability to enhance the host’s immune response by interacting with T cells, monocytes, macrophages, and polymorphonuclear lymphocytes. Since its discovery, KLH has been used primarily as a carrier for vaccines and antigens and as adjuvant treatment in regimens such as antimicrobial therapy.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
Megathura crenulata - most commonly used carrier protein
Antibody can be used as a negative control to determine if observed signal is generated by anti-KLH or anti-peptide antibodies, Due to its large size KLH protein will be very difficult to separate on SDS-PAGE
Application Details:
1: 10 000 (ELISA), 1: 10 000 (WB), 1: 1000 (IL)
Purity:
Immunogen affinity purified serum in PBS pH 7.4, conjugated to HRP.
Molecular Weight:
ca, 400 kDa/subunit
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Protein present in plant vascular tissue (xylem and vascular cambium) is detected by anti-KLH antibodies (H glund et al. 2002) which might lead to false results in IL when using anti-peptide antibodies generated to KLH-conjugated peptide.
Detergents typically present in cell lysis buffers are thought to disrupt organelles and compartments and increase the exposure of soluble phospho-proteins to phosphatases and proteases thereby resulting in uncontrolled dephosphorylation and proteolysis. Phospho-Sure RTD Neuronal extraction buffer is optimized for the extraction of phosphorylated proteins from neuronal and other soft tissues types. The buffer extracts the phosphoproteins in a native state without the use of harsh detergents or oxidizers, and it is specially formulated to help maintain phosphoproteins and protect them from degradation better than traditional detergent based extraction buffers.
Product Type:
Buffer & Reagent
Format:
Powder
Applications:
IP,WB
Application Details:
Please download the protocol below for detailed instructions on how to use Phospho-Sure in neuronal and other soft tissues.
Alternative Names:
Phospho-sure
Biosensis Brand:
Phospho-Sure RTD
Shelf Life:
Powdered format can be stored up to 12 months after purchase under cool, dry conditions.
Use:
For research use only.
Product references:
1. Suneja SK, Mo Z, Potashner SJ. (2006) Phospho-CREB and other phospho-proteins: improved recovery from brain tissue. J Neurosci Methods. 2006 Jan 30;150(2):238-41. 2. Elvira Mass, Dagmar Wachten, Anna C. Aschenbrenner, Andre Voelzmann, Michael Hochemail (2014) Murine Creld1 Controls Cardiac Development through Activation of Calcineurin/NFATc1 Signaling, Developmental Cell Volume 28, Issue 6, p711-726
Storage:
The dry, unopened container should be stored at room temperature in a dry or desiccated location protected from light. Do not store in the refrigerator unless material is in a dry, moisture free environment. Material is hydroscopic so once the seal is broken it should be hydrated and not resealed while dry. Once hydrated, the buffer can be stored at 2-8°C for up to 3 months. Solution can be frozen but clumping may occur upon thawing and is not recommended.
Detergents typically present in cell lysis buffers are thought to disrupt organelles and compartments and increase the exposure of soluble phospho-proteins to phosphatases and proteases thereby resulting in uncontrolled dephosphorylation and proteolysis. Phospho-Sure RTD Neuronal extraction buffer is optimized for the extraction of phosphorylated proteins from neuronal and other soft tissues types. The buffer extracts the phosphoproteins in a native state without the use of harsh detergents or oxidizers, and it is specially formulated to help maintain phosphoproteins and protect them from degradation better than traditional detergent based extraction buffers.
Product Type:
Buffer & Reagent
Format:
Powder
Applications:
IP,WB
Application Details:
Please download the protocol below for detailed instructions on how to use Phospho-Sure in neuronal and other soft tissues.
Alternative Names:
Phospho-sure
Biosensis Brand:
Phospho-Sure RTD
Shelf Life:
Powdered format can be stored up to 12 months after purchase under cool, dry conditions.
Use:
For research use only.
Product references:
1. Suneja SK, Mo Z, Potashner SJ. (2006) Phospho-CREB and other phospho-proteins: improved recovery from brain tissue. J Neurosci Methods. 2006 Jan 30;150(2):238-41. 2. Elvira Mass, Dagmar Wachten, Anna C. Aschenbrenner, Andre Voelzmann, Michael Hochemail (2014) Murine Creld1 Controls Cardiac Development through Activation of Calcineurin/NFATc1 Signaling, Developmental Cell Volume 28, Issue 6, p711-726
Storage:
The dry, unopened container should be stored at room temperature in a dry or desiccated location protected from light. Do not store in the refrigerator unless material is in a dry, moisture free environment. Material is hydroscopic so once the seal is broken it should be hydrated and not resealed while dry. Once hydrated, the buffer can be stored at 2-8°C for up to 3 months. Solution can be frozen but clumping may occur upon thawing and is not recommended.
30 mM Triethanolamine, pH 7.2, 5 mM Magnesium Chloride, 0.1 mM Zinc Chloride, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Country Of Origin:
US Origin
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Tris, 150 mM Sodium Chloride, pH 8.2, 1% (w/v) Bovine Serum Albumin (Protease/IgG free)
Storage:
2-8 °C
Country Of Origin:
US Origin
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Streptavidin has been conjugated to Horseradish Peroxidase (HRP) is used with biotinylated antibodies. Streptavidin binds to biotin and the conjugated HRP provides enzyme activity for detection using an appropriate substrate system. This particular product has been used primarily in sandwich ELISA applications to provide consistent measurement of biotinylated detection antibodies.
Concentration:
1.0 mg/ml (E 1% at 280 nm = 32.0)
Conjugate:
Horseradish Peroxidase
Form:
Lyophilized
Purification:
N/A
Host:
Bacterial
Immunogen:
N/A
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.1% (v/v) Kathon CG
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Country Of Origin:
US Origin
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
100 mM Sodium Phosphate (pH 7.4), 100 mM NaCl, 50 mM Sucrose, 1.5% BSA and 0.01% Thimerosal
Storage:
2-8 °C, DO NOT FREEZE
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
100 mM NaPO4 (pH 7.4), 100 mM NaCl, 2 mM Sodium Azide
Storage:
2-8 °C
Country Of Origin:
US Origin
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
The Biosensis Mature BDNF Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the quantification of mature BDNF in less than 3 hours in cell culture supernatants, serum, plasma (citrate and EDTA), pig serum, cell lysates, brain extracts, human milk and Sheep CSF only if used as directed, with a simplified protocol and no loss of sensitivity or specificity. Please refer to the kit protocol for specific use instructions for each substrate application, in particular blood samples, human milk and CSF. Note that accurate quantification of BDNF in human milk requires a secretory IgA (sIgA) blocker which can be purchased separately ( BL-001-1250 ). For measurement of mature BDNF in CSF samples, please contact us at sales@biosensis.com . This ELISA kit has been tested in independent research laboratories and found to achieve highest reproducibility with intra- and inter-assay CVs as low as 1% and 5%, respectively (Polacchini et al., 2015). This ELISA kit consists of a pre-coated mouse monoclonal anti-mature BDNF capture antibody, a biotinylated anti-mature BDNF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a coloured reaction product which is directly proportional to the concentration of mature BDNF present in samples and protein standards. A BDNF positive control (QC sample) is provided to assure consistent assay performance. This Mature BDNF ELISA kit employs a recombinant human mature BDNF standard approved by the World Health Organization (WHO, www.nibsc.org ). The amino acid sequence of mature BDNF is identical for human, mouse, rat and a number of other species. This kit therefore is suitable to measure mature BDNF in all these species and uses the same antibodies and antigen. Extensive validation has demonstrated that the Mature BDNF Rapid TM ELISA shows only minimal cross-reactivity with proBDNF. Please refer to our Technical Note #5 for further details on ELISA assay validation for BDNF isoform detection and quanification. This ELISA kit has not been tested for other applications. It has been configured for research use only and is not to be used for diagnostic or clinical procedures. For in-vitro diagnostic (IVD) applications in the European Economic Area (EEA), we refer to the CE Marked BDNF ELISA kit (BEK-2211-CE) .
Background Info:
BDNF belongs to the neurotrophin family and regulates the survival and differentiation of neurons during development. The alterations in BDNF expression induced by various kinds of brain insult including stress, ischemia, seizure activity and hypoglycemia, may contribute to some pathologies such as depression, epilepsy, Alzheimer's, and Parkinson's disease. FUNCTION: Promotes the survival of neuronal populations that are all located either in the central nervous system or directly connected to it. Major regulator of synaptic transmission and plasticity at adult synapses in many regions of the CNS. The versatility of BDNF is emphasized by its contribution to a range of adaptive neuronal responses including long-term potentiation (LTP), long-term depression (LTD), certain forms of short-term synaptic plasticity, as well as homeostatic regulation of intrinsic neuronal excitability. SUBUNIT: Monomers and homodimers. Binds to NTRK2/TRKB. SUBCELLULAR LOCATION: Secreted protein. Post Translation Modification (PTM): The propeptide is N-glycosylated and glycosulfated. PTM: Converted into mature BDNF by plasmin (PLG) (By similarity). DISEASE: Defects in BDNF are a cause of congenital central hypoventilation syndrome (CCHS); also known as congenital failure of autonomic control or Ondine curse. CCHS is a rare disorder characterized by abnormal control of respiration in the absence of neuromuscular or lung disease, or an identifiable brain stem lesion. A deficiency in autonomic control of respiration results in inadequate or negligible ventilatory and arousal responses to hypercapnia and hypoxemia. CCHS is frequently complicated with neurocristopathies such as Hirschsprung disease that occurs in about 16% of CCHS cases. SIMILARITY: Belongs to the NGF-beta family.
Product Type:
ELISA Assay
Species Reactivity:
Human,Mouse,Rat
Immunogen:
Recombinant human BDNF with an N-terminal methionine residue, made in E. coli (WHO reference reagent)
Applications:
ELISA
Application Details:
ELISA. For the quantification of Brain-derived neurotrophic factor, mature (BDNF, mature) in Culture Supernatant, Serum, Plasma (Citrate), Plasma (EDTA), Cell Lysates, Tissue Homogenates, Human Milk, CSF. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
The ELISA kit box contains 96-well pre-coated strip plate(s), protein standards, QC sample, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Total Number of References: 99 Latest Publications (2019-2022):
Meshkat S et al. (2022) Brain-Derived Neurotrophic Factor (BDNF) as a biomarker of treatment response in patients with Treatment Resistant Depression (TRD): A systematic review & meta-analysis Psychiatry Res. 317:114857 Application: Human, serum. Cook A et al. (2022) Activation of TrkB-Akt signaling rescues deficits in a mouse model of SCA6 Sci Adv. [Epub ahead of print] Application: Mouse, brain extracts. Tsotsoros CE et al. (2022) Pilot Associations between Adverse Childhood Experiences, Executive Function, and Brain-Derived Neurotrophic Factor (BDNF) among Adults with Excess Adiposity Obesities. 2, 276-284. Application: Human, serum. Salem HA et al. (2022) Neuroprotective Effect of Morin Hydrate against Attention-Deficit/Hyperactivity Disorder (ADHD) Induced by MSG and/or Protein Malnutrition in Rat Pups: Effect on Oxidative/Monoamines/Inflammatory Balance and Apoptosis Pharmaceuticals. 15, 1012. Application: Rat, brain supernatant. Aldhshan MS & Mizuno TM. (2022) Effect of environmental enrichment on aggression and the expression of brain-derived neurotrophic factor transcript variants in group-housed male mice Behav Brain Res. [Epub ahead of print]. Application: Mouse, brain tissue homogenate. Fujino M et al. (2022) Orally Administered Plasmalogens Alleviate Negative Mood States and Enhance Mental Concentration: A Randomized, Double-Blind, Placebo-Controlled Trial Front Cell Dev Biol. 10:894734 Application: Human, plasma. Abrial E et al. (2022) Investigating Predictive Factors of Suicidal Re-attempts in Adolescents and Young Adults After a First Suicide Attempt, a Prospective Cohort Study. Study Protocol of the SURAYA Project Front. Psychiatry. [Epub ahead of print] Application: Human, plasma. Tanaka-Kanegae R et al. (2022) Sufficiently Elevated Core Body Temperature May Be Necessary to Maintain Cerebral Blood Flow Response throughout the Morning Neurosci Med. 13, 70-90 Application: Human, serum. Merlo S et al. (2022) Microglial polarization differentially affects neuronal vulnerability to the ?-amyloid protein: Modulation by melatonin Biochem Pharmacol. 202:115151 Application: Human, cell culture supernatant. Dalile B et al. (2022) Extruded Wheat Bran Consumption Increases Serum Short-Chain Fatty Acids but Does Not Modulate Psychobiological Functions in Healthy Men: A Randomized, Placebo-Controlled Trial Front Nutr. 9:896154 Application: Human, serum. Agapouda A et al. (2022) Rhodiola Rosea Extract Counteracts Stress in an Adaptogenic Response Curve Manner via Elimination of ROS and Induction of Neurite Outgrowth Oxid. Med. Cell. Longev. [Epub ahead of print] Application: Human, cell lysates. Breazeale S et al. (2022) Symptom cluster profiles following traumatic orthopaedic injuries Injury. [Epub ahead of print] Application: Human, serum. Jaehne EJ et al. (2022) Behavioral phenotyping of a rat model of the BDNF Val66Met polymorphism reveals selective impairment of fear memory Transl Psychiatry. 12(1):93 Application: Rat, acid extracted tissue lysates. Wang RY et al. (2022) The SDF1-CXCR4 Axis Is Involved in the Hyperbaric Oxygen Therapy-Mediated Neuronal Cells Migration in Transient Brain Ischemic Rats. Int J Mol Sci. 23, 1780 Application: Rat, brain tissue homogenate and serum. Hugues N et al. (2022) Time-Dependent Cortical Plasticity during Moderate-Intensity Continuous Training Versus High-Intensity Interval Training in Rats. Cereb Cortex. [Epub ahead of print] Application: Rat, cortical tissue homogenate. Cefis M et al. (2021) Endothelial cells are an important source of BDNF in rat skeletal muscle. Sci Rep. 12(1):311 Application: Rat, skeletal muscle tissue homogenate. Becker AM et al. (2021) Acute Effects of Psilocybin After Escitalopram or Placebo Pretreatment in a Randomized, Double-Blind, Placebo-Controlled, Crossover Study in Healthy Subjects. Clin Pharmacol Ther. [Epub ahead of print] Application: Human, plasma. Berbenetz N et al. (2021) The Relationship Between Brain Derived Neurotrophic Factor (BDNF) and Symptoms Following Catheter Ablation for Paroxysmal Atrial Fibrillation (AF)- NEURO-AF Study. Circulation. [Epub ahead of print] Application: Human, serum. Walsh JJ et al. (2021) Short-term ketone monoester supplementation improves cerebral blood flow and cognition in obesity: A randomized cross-over trial. J Physiol. [Epub ahead of print] Application: Human, serum, platelet-poor plasma. Boukhatem I et al. (2021) The brain-derived neurotrophic factor prompts platelet aggregation and secretion. Blood Adv. 5(18):3568-3580 Application: Human, plasma. Yi X et al. (2021) Serum mBDNF and ProBDNF Expression Levels as Diagnosis Clue for Early Stage Parkinson's Disease. Front Neurol. 12:680765 Application: Human, serum. Inoue T et al. (2021) Ipsilateral BDNF mRNA expression in the motor cortex positively correlates with motor function of the affected forelimb after intracerebral hemorrhage. Brain Res. [Epub ahead of print] Application: Rat, brain homogenate. Shoshina II et al. (2021) Visual processing and BDNF levels in first-episode schizophrenia. Psychiatry Res. [Epub ahead of print] Application: Human, serum. Cappoli N et al. (2021) Effects of remifentanil on human C20 microglial pro-inflammatory activation. Eur Rev Med Pharmacol Sci. 25(16):5268-5274 Application: Human, cell culture. March B et al. (2021) ELISA-based quantification of neurotrophic growth factors in urine from prostate cancer patients. FASEB Bioadv. [Epub ahead of print] Application: Human, urine. Mori Y et al. (2021) Serum BDNF as a Potential Biomarker of Alzheimer's Disease: Verification Through Assessment of Serum, Cerebrospinal Fluid, and Medial Temporal Lobe Atrophy. Front Neurol. 12:653267 Application: Human, serum. Seno S et al. (2021) Effects of Selective Serotonin Reuptake Inhibitors on Depression-Like Behavior in a Laser-Induced Shock Wave Model. Front Neurol. 12:602038 Application: Mouse, hippocampal homogenates. Medeiros GC et al. (2021) Treatment of depression with ketamine does not change plasma levels of brain-derived neurotrophic factor or vascular endothelial growth factor. J Affect Disord. 280(Pt A):136-139 Application: Human, plasma. Dorandish S et al. (2021) Differences in the Relative Abundance of ProBDNF and Mature BDNF in A549 and H1299 Human Lung Cancer Cell Media. Int J Mol Sci. 22(13):7059 Application: Human, culture supernatant. Yap NY et al. (2021) Relationship between cytokines and brain-derived neurotrophic factor (BDNF) in trajectories of cancer-related cognitive impairment. Cytokine. [Epub ahead of print] Application: Human, plasma. Wang L et al. (2021) The mediating effect of brain-derived neurotrophic factor levels on childhood trauma and psychiatric symptoms in patients with first-episode schizophrenia. Aust N Z J Psychiatry. [Epub ahead of print] Application: Human. Mallik SB et al. (2021) Remedial effects of caffeine against depressive-like behaviour in mice by modulation of neuroinflammation and BDNF. Nutr Neurosci. [Epub ahead of print] Application: Mouse. Nomura S et al. (2021) Effects of a Tea Cultivar "MK5601" on Behaviors and Hippocampal Neurotrophin-3 Levels in Middle-Aged Mice. J Nutr Sci Vitaminol (Tokyo). 67(3):170-179 Application: Mouse, hippocampal RIPA homogenates. Caruso GI et al. (2021) SIRT1-Dependent Upregulation of BDNF in Human Microglia Challenged with A?: An Early but Transient Response Rescued by Melatonin. Biomedicines. 9(5):466 Application: Human, cell culture supernatant. Miller KM et al. (2021) Striatal Afferent BDNF Is Disrupted by Synucleinopathy and Partially Restored by STN DBS. J Neurosci. 41(9):2039-52 Application: Rat, tissue homogenates (RIPA). Vickneson K et al. (2021) Cold-induced dishabituation in rodents exposed to recurrent hypoglycaemia. Diabetologia. 64(6):1436-41 Application: Rat, blood. Li P et al. (2021) Intermediation of perceived stress between early trauma and plasma M/P ratio levels in obsessive-compulsive disorder patients. J Affect Disord. 285:105-111 Application: Human, plasma. Lai NS et al. (2021) Increased Serum Levels of Brain-Derived Neurotrophic Factor Contribute to Inflammatory Responses in Patients with Rheumatoid Arthritis. Int. J. Mol. Sci. 22(4):1841 Application: Human, serum and culture supernatants. Pan S et al. (2021) The microRNA-195 - BDNF pathway and cognitive deficits in schizophrenia patients with minimal antipsychotic medication exposure. Transl Psychiatry. 11(1):117 Application: Human, plasma. Miyamoto T et al. (2021) Effect of pedaling cadence on serum levels of brain-derived neurotrophic factor during ergometric exercise in healthy adults. Sport Sci Health. Application: Human, serum. Normann AJ (2020) The Effect of Light Therapy and Acute Aerobic Exercise on Serum Brain Derived Neurotrophic Factor in Older Adults. MSc Thesis. Application: Human, serum. Holze F et al. (2020) Acute dose-dependent effects of lysergic acid diethylamide in a double-blind placebo-controlled study in healthy subjects. Neuropsychopharmacology. [Epub ahead of print]. Application: Human, plasma. Hasler G et al. (2020) The Association Between Adolescent Residential Mobility and Adult Social Anxiety, BDNF and Amygdala-Orbitofrontal Functional Connectivity in Young Adults With Higher Education. Front. Psychiatry. Application: Human, serum. Wallace AW (2020) The Impact of Six Weeks of Intermittent Fasting, With and Without Aerobic Exercise, on Serum BDNF in Young Adult Males. MSc Thesis. Application: Human, serum. Walsh JJ et al. (2020) The Effect of Exogenous Ketone Monoester Ingestion on Plasma BDNF During an Oral Glucose Tolerance Test. Front Physiol. 11:1094. Application: Human, plasma. Meade GM et al. (2020) A Model of Negative Emotional Contagion Between Male-Female Rat Dyads: Effects of Voluntary Exercise on Stress-Induced Behavior and BDNF-TrkB Signaling. Physiol Behav. 113286 Application: Rat, serum. Hutten NRPW et al. (2020) Low Doses of LSD Acutely Increase BDNF Blood Plasma Levels in Healthy Volunteers. ACS Pharmacol. Transl. Sci. Application: Human, plasma. Barbosa AC et al. (2020) Assessment of BDNF serum levels as a diagnostic marker in children with autism spectrum disorder. Sci Rep. 10(1):17348. Application: Human, serum. Okamura M et al. (2020) Low-Level Inhibition of GABAergic Synapses Enhances Gene Expressions Crucial for Neuronal Plasticity in the Hippocampus After Ischemic Stroke. J Stroke Cerebrovasc Dis. 29(12):105316. Application: Rat, hippocampus homogenate. Payne AJ et al. (2020) The Effects of Alcohol on BDNF and CD5 Dependent Pathways. PhD Thesis. Application: Mouse, RIPA tissue homogenate. Nishiyama M et al. (2020) Homostachydrine is a Xenobiotic Substrate of OCTN1/SLC22A4 and Potentially Sensitizes Pentylenetetrazole-Induced Seizures in Mice. Neurochem Res. [Epub ahead of print]. Application: Mouse, acid-extracted hippocampal homogenate. Lorinczova HT et al. (2020) Co-Administration of Iron and a Bioavailable Curcumin Supplement Increases Serum BDNF Levels in Healthy Adults. Antioxidants (Basel). 9(8):E645. Application: Human serum. Yap NY F et al. (2020) Associations of plasma brain-derived neurotrophic factor (BDNF) and Val66Met polymorphism (rs6265) with long-term cancer-related cognitive impairment in survivors of breast cancer. Breast Cancer Res Treat. [Epub ahead of print]. Application: Human plasma. Vasilopoulou F et al. (2020) Amelioration of BPSD-Like Phenotype and Cognitive Decline in SAMP8 Mice Model Accompanied by Molecular Changes After Treatment With I 2-Imidazoline Receptor Ligand MCR5. Pharmaceutics. 12(5):E475. Application: Mouse hippocampus RIPA-homogenates. Mueller ST et al. (2020) Negative Association Between Left Prefrontal GABA Concentration and BDNF Serum Concentration in Young Adults. Heliyon. 6(5):e04025. Application: Human serum. Chen LF et al. (2020) The NMDA receptor subunit GluN3A regulates synaptic activity-induced and myocyte enhancer factor 2C (MEF2C)-dependent transcription. J Biol Chem. [Epub ahead of print]. Application: Rat neuronal cell lysate, acid-extracted. Companys-Alemany J et al. (2020) A Novel NMDA Receptor Antagonist Protects against Cognitive Decline Presented by Senescent Mice. Pharmaceutics. 12(3), 284. Application: Mouse hippocampal homogenates. Furukawa Y et al. (2020) Citrus Auraptene Induces Expression of Brain-Derived Neurotrophic Factor in Neuro2a Cells. Molecules. 25(5). Application: Mouse Neuro2a culture supernatant. Holze F et al. (2019) Distinct acute effects of LSD, MDMA, and D-amphetamine in healthy subjects. Neuropsychopharmacology. [Epub ahead of print]. Application: Human plasma. Sumiyoshi E et al. (2019) Sub-Chronic Consumption of Dark Chocolate Enhances Cognitive Function and Releases Nerve Growth Factors: A Parallel-Group Randomized Trial. Nutrients. 11(11). Application: Human plasma. Sartori A et al. (2019) Interferon-beta, but not Glatiramer Acetate treatment induces gender-specific increase in BDNF serum levels in relapsing-remitting multiple sclerosis female patients. Res J Neuro N Disord. 1:5-18. Application: Human serum. Please refer to our Technical Note #5 for validation experiments disproving the author's claim that the Biosensis Mature BDNF Rapid TM ELISA quantifies total BDNF! Vanicek T et al. (2019) Repetitive Enhancement of Serum BDNF Subsequent to Continuation ECT. Acta Psychiatr Scand. [Epub ahead of print]. Application: Human serum. Gejl AK et al. (2019) Associations between serum and plasma brain-derived neurotrophic factor and influence of storage time and centrifugation strategy. Sci Rep. 9(1):9655. Application: Human serum and EDTA-plasma. Li X et al. (2019) Exercise enhances the expression of brain-derived neurotrophic factor in the hippocampus accompanied by epigenetic alterations in senescence-accelerated mice prone 8. Neurosci Lett. [Epub ahead of print]. Application: Mouse brain homogenates. Yang CY et al. (2019) Panax notoginsenoside Rb1 Restores the Neurotrophic Imbalance Following Photothrombotic Stroke in Rats. Neurotox Res. [Epub ahead of print]. Application: Rat brain homogenates. Du Y et al. (2019) Genome-Wide, Integrative Analysis Implicates Exosome-Derived MicroRNA Dysregulation in Schizophrenia. Schizophr Bull. [Epub ahead of print]. Application: Human serum. Vanicek T et al. (2019) Acute and Subsequent Continuation Electroconvulsive Therapy Elevates Serum BDNF Levels in Patients with Major Depression. Brain Stimul. [In press]. Application: Human serum, plasma. Duart-Castells L et al. (2019) 7,8-dihydroxyflavone blocks the development of behavioral sensitization to MDPV, but not to cocaine: differential role of the BDNF-TrkB pathway. Biochem Pharmacol. [Epub ahead of print]. Application: Mouse RIPA tissue homogenates.
Typical limit of detection (LOD) for BDNF is less than 2 pg/mL, determined as 150% of the blank value.
Cross Reactivity:
No cross-reactivity is observed for nerve growth factor (NGF), neurotrophin-3 (NT-3), NT-4/5, glial cell line-derived neurotrophic factor (GDNF) and vascular endothelial growth factor (VEGF165) tested at 25 ng/mL in assay buffer. The reactivity of full-length proBDNF (0.125 ng/mL - 5 ng/mL) was determined in six independent assays using proBDNF proteins from four different sources (mammalian and bacterial, wild-type and mutated). The average cross-reactivity of proBDNF was found to be 5.3% +/- 0.5% in weight (w/v) concentration, or 12.1% +/- 1.2% in molar concentration (mean +/- SEM). Additional proBDNF cross-reactivity experiments were conducted as summarized in our <a class="newA" target="_blank" href="https://www.biosensis.com/documents/enhancedinfo/Technical-Note-5-Mature-BDNF-Isoform-Detection-and-Quantification-by-ELISA.pdf">Technical Note #5</a>.
The Biosensis CE Marked BDNF Rapid enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the preferential quantification of mature BDNF in less than 3 hours. This kit consists of a pre-coated mouse monoclonal anti-BDNF capture antibody, a biotinylated anti-BDNF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product which is directly proportional to the concentration of BDNF present in samples and protein standards. This BDNF ELISA kit employs a recombinant human BDNF standard approved by the World Health Organization (WHO, www.nibsc.org ). This kit is suitable to measure mature BDNF in human serum and citrate-treated plasma samples only. The antibodies used in this ELISA kit bind epitopes within the mature domain of the protein and therefore recognize the mature as well as the pro-form of BDNF. However, cross-reactivity to the full-length proBDNF protein is low. This CE Marked BDNF Rapid ELISA [Cat. No. BEK-2211-CE] Kit is approved for in-vitro diagnostic (IVD) applications in the European Economic Area (EEA). It has been developed by Biosensis and is manufactured by Calbiotech Inc. ( www.calbiotech.com ) for Biosensis. BEK-2211-CE is not approved for in-vitro diagnostic (IVD) applications in the United States. For research on human blood, customers MUST order the catalog number BEK-2211 . This research-use-only ELISA kit can be used for human and animal research purposes worldwide, and has been validated for a wider range of sample types and species.
Background Info:
BDNF belongs to the neurotrophin family and regulates the survival and differentiation of neurons during development. The alterations in BDNF expression induced by various kinds of brain insult including stress, ischemia, seizure activity and hypoglycemia, may contribute to some pathologies such as depression, epilepsy, Alzheimer's, and Parkinson's disease. FUNCTION: Promotes the survival of neuronal populations that are all located either in the central nervous system or directly connected to it. Major regulator of synaptic transmission and plasticity at adult synapses in many regions of the CNS. The versatility of BDNF is emphasized by its contribution to a range of adaptive neuronal responses including long-term potentiation (LTP), long-term depression (LTD), certain forms of short-term synaptic plasticity, as well as homeostatic regulation of intrinsic neuronal excitability. SUBUNIT: Monomers and homodimers. Binds to NTRK2/TRKB. SUBCELLULAR LOCATION: Secreted protein. Post Translation Modification (PTM): The propeptide is N-glycosylated and glycosulfated. PTM: Converted into mature BDNF by plasmin (PLG) (By similarity). DISEASE: Defects in BDNF are a cause of congenital central hypoventilation syndrome (CCHS); also known as congenital failure of autonomic control or Ondine curse. CCHS is a rare disorder characterized by abnormal control of respiration in the absence of neuromuscular or lung disease, or an identifiable brain stem lesion. A deficiency in autonomic control of respiration results in inadequate or negligible ventilatory and arousal responses to hypercapnia and hypoxemia. CCHS is frequently complicated with neurocristopathies such as Hirschsprung disease that occurs in about 16% of CCHS cases. SIMILARITY: Belongs to the NGF-beta family.
Product Type:
ELISA Assay
Species Reactivity:
Human
Immunogen:
Recombinant human BDNF with an N-terminal methionine residue, made in E. coli (WHO reference reagent)
Applications:
ELISA
Application Details:
ELISA. For the quantification of Brain-derived neurotrophic factor, mature (BDNF, mature) in Serum, Plasma (Citrate). BEK-2211-CE is expressly designed and tested only for use on human blood and plasma samples. Any other use is deemed "off label use" and thus the performance characteristics of the assay will have to be determined by the end user, and such results are not supported by Biosensis or CalBioTech at this time. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
See BEK-2211-1P-CE protocol insert for specific expiration dating of the kit and its components.
Use:
Approved for in-vitro diagnostic (IVD) applications in the European Economic Area (EEA). It has been developed by Biosensis and is manufactured by Calbiotech Inc. (www.calbiotech.com) for Biosensis.
This kit is not approved for in-vitro diagnostic (IVD) applications in the United States. For research on human blood, customers MUST order the catalog number BEK-2211.
Kit Components:
The ELISA kit box contains 96-well pre-coated strip plate(s), protein standards, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Reed JL et al. (2021) The effects of high-intensity interval training, Nordic walking and moderate-to-vigorous intensity continuous training on functional capacity, depression and quality of life in patients with coronary artery disease enrolled in cardiac rehabilitation: A randomized controlled trial (CRX study). Prog Cardiovasc Dis. [Epub ahead of print]. Application: Human blood. Valkenborghs SR et al. (2019) Aerobic exercise and consecutive task-specific training (AExaCTT) for upper limb recovery after stroke: A randomized controlled pilot study. Physiother Res Int. [Epub ahead of print]. Application: Human serum.
Specificity:
Human BDNF when used as directed.
Storage:
Store at 2-8°C
Range:
7.8 pg/mL - 500 pg/mL
Sample Type:
Plasma (Citrate),Serum
Sensitivity:
Typical limit of detection (LOD) for BDNF is < 3 pg/mL determined by calculating the mean + 2x standard deviation of mean of blank (n=20).
The Biosensis Mature BDNF Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the quantification of mature BDNF in less than 3 hours in cell culture supernatants, serum, plasma (citrate and EDTA), pig serum, cell lysates, brain extracts, human milk and Sheep CSF only if used as directed, with a simplified protocol and no loss of sensitivity or specificity. Please refer to the kit protocol for specific use instructions for each substrate application, in particular blood samples, human milk and CSF. Note that accurate quantification of BDNF in human milk requires a secretory IgA (sIgA) blocker which can be purchased separately ( BL-001-1250 ). For measurement of mature BDNF in CSF samples, please contact us at sales@biosensis.com . This ELISA kit has been tested in independent research laboratories and found to achieve highest reproducibility with intra- and inter-assay CVs as low as 1% and 5%, respectively (Polacchini et al., 2015). This ELISA kit consists of a pre-coated mouse monoclonal anti-mature BDNF capture antibody, a biotinylated anti-mature BDNF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a coloured reaction product which is directly proportional to the concentration of mature BDNF present in samples and protein standards. A BDNF positive control (QC sample) is provided to assure consistent assay performance. This Mature BDNF ELISA kit employs a recombinant human mature BDNF standard approved by the World Health Organization (WHO, www.nibsc.org ). The amino acid sequence of mature BDNF is identical for human, mouse, rat and a number of other species. This kit therefore is suitable to measure mature BDNF in all these species and uses the same antibodies and antigen. Extensive validation has demonstrated that the Mature BDNF Rapid TM ELISA shows only minimal cross-reactivity with proBDNF. Please refer to our Technical Note #5 for further details on ELISA assay validation for BDNF isoform detection and quanification. This ELISA kit has not been tested for other applications. It has been configured for research use only and is not to be used for diagnostic or clinical procedures. For in-vitro diagnostic (IVD) applications in the European Economic Area (EEA), we refer to the CE Marked BDNF ELISA kit (BEK-2211-CE) .
Background Info:
BDNF belongs to the neurotrophin family and regulates the survival and differentiation of neurons during development. The alterations in BDNF expression induced by various kinds of brain insult including stress, ischemia, seizure activity and hypoglycemia, may contribute to some pathologies such as depression, epilepsy, Alzheimer's, and Parkinson's disease. FUNCTION: Promotes the survival of neuronal populations that are all located either in the central nervous system or directly connected to it. Major regulator of synaptic transmission and plasticity at adult synapses in many regions of the CNS. The versatility of BDNF is emphasized by its contribution to a range of adaptive neuronal responses including long-term potentiation (LTP), long-term depression (LTD), certain forms of short-term synaptic plasticity, as well as homeostatic regulation of intrinsic neuronal excitability. SUBUNIT: Monomers and homodimers. Binds to NTRK2/TRKB. SUBCELLULAR LOCATION: Secreted protein. Post Translation Modification (PTM): The propeptide is N-glycosylated and glycosulfated. PTM: Converted into mature BDNF by plasmin (PLG) (By similarity). DISEASE: Defects in BDNF are a cause of congenital central hypoventilation syndrome (CCHS); also known as congenital failure of autonomic control or Ondine curse. CCHS is a rare disorder characterized by abnormal control of respiration in the absence of neuromuscular or lung disease, or an identifiable brain stem lesion. A deficiency in autonomic control of respiration results in inadequate or negligible ventilatory and arousal responses to hypercapnia and hypoxemia. CCHS is frequently complicated with neurocristopathies such as Hirschsprung disease that occurs in about 16% of CCHS cases. SIMILARITY: Belongs to the NGF-beta family.
Product Type:
ELISA Assay
Species Reactivity:
Human,Mouse,Rat
Immunogen:
Recombinant human BDNF with an N-terminal methionine residue, made in E. coli (WHO reference reagent)
Applications:
ELISA
Application Details:
ELISA. For the quantification of Brain-derived neurotrophic factor, mature (BDNF, mature) in Culture Supernatant, Serum, Plasma (Citrate), Plasma (EDTA), Cell Lysates, Tissue Homogenates, Human Milk, CSF. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
The ELISA kit box contains 96-well pre-coated strip plate(s), protein standards, QC sample, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Total Number of References: 99 Latest Publications (2019-2022):
Meshkat S et al. (2022) Brain-Derived Neurotrophic Factor (BDNF) as a biomarker of treatment response in patients with Treatment Resistant Depression (TRD): A systematic review & meta-analysis Psychiatry Res. 317:114857 Application: Human, serum. Cook A et al. (2022) Activation of TrkB-Akt signaling rescues deficits in a mouse model of SCA6 Sci Adv. [Epub ahead of print] Application: Mouse, brain extracts. Tsotsoros CE et al. (2022) Pilot Associations between Adverse Childhood Experiences, Executive Function, and Brain-Derived Neurotrophic Factor (BDNF) among Adults with Excess Adiposity Obesities. 2, 276-284. Application: Human, serum. Salem HA et al. (2022) Neuroprotective Effect of Morin Hydrate against Attention-Deficit/Hyperactivity Disorder (ADHD) Induced by MSG and/or Protein Malnutrition in Rat Pups: Effect on Oxidative/Monoamines/Inflammatory Balance and Apoptosis Pharmaceuticals. 15, 1012. Application: Rat, brain supernatant. Aldhshan MS & Mizuno TM. (2022) Effect of environmental enrichment on aggression and the expression of brain-derived neurotrophic factor transcript variants in group-housed male mice Behav Brain Res. [Epub ahead of print]. Application: Mouse, brain tissue homogenate. Fujino M et al. (2022) Orally Administered Plasmalogens Alleviate Negative Mood States and Enhance Mental Concentration: A Randomized, Double-Blind, Placebo-Controlled Trial Front Cell Dev Biol. 10:894734 Application: Human, plasma. Abrial E et al. (2022) Investigating Predictive Factors of Suicidal Re-attempts in Adolescents and Young Adults After a First Suicide Attempt, a Prospective Cohort Study. Study Protocol of the SURAYA Project Front. Psychiatry. [Epub ahead of print] Application: Human, plasma. Tanaka-Kanegae R et al. (2022) Sufficiently Elevated Core Body Temperature May Be Necessary to Maintain Cerebral Blood Flow Response throughout the Morning Neurosci Med. 13, 70-90 Application: Human, serum. Merlo S et al. (2022) Microglial polarization differentially affects neuronal vulnerability to the ?-amyloid protein: Modulation by melatonin Biochem Pharmacol. 202:115151 Application: Human, cell culture supernatant. Dalile B et al. (2022) Extruded Wheat Bran Consumption Increases Serum Short-Chain Fatty Acids but Does Not Modulate Psychobiological Functions in Healthy Men: A Randomized, Placebo-Controlled Trial Front Nutr. 9:896154 Application: Human, serum. Agapouda A et al. (2022) Rhodiola Rosea Extract Counteracts Stress in an Adaptogenic Response Curve Manner via Elimination of ROS and Induction of Neurite Outgrowth Oxid. Med. Cell. Longev. [Epub ahead of print] Application: Human, cell lysates. Breazeale S et al. (2022) Symptom cluster profiles following traumatic orthopaedic injuries Injury. [Epub ahead of print] Application: Human, serum. Jaehne EJ et al. (2022) Behavioral phenotyping of a rat model of the BDNF Val66Met polymorphism reveals selective impairment of fear memory Transl Psychiatry. 12(1):93 Application: Rat, acid extracted tissue lysates. Wang RY et al. (2022) The SDF1-CXCR4 Axis Is Involved in the Hyperbaric Oxygen Therapy-Mediated Neuronal Cells Migration in Transient Brain Ischemic Rats. Int J Mol Sci. 23, 1780 Application: Rat, brain tissue homogenate and serum. Hugues N et al. (2022) Time-Dependent Cortical Plasticity during Moderate-Intensity Continuous Training Versus High-Intensity Interval Training in Rats. Cereb Cortex. [Epub ahead of print] Application: Rat, cortical tissue homogenate. Cefis M et al. (2021) Endothelial cells are an important source of BDNF in rat skeletal muscle. Sci Rep. 12(1):311 Application: Rat, skeletal muscle tissue homogenate. Becker AM et al. (2021) Acute Effects of Psilocybin After Escitalopram or Placebo Pretreatment in a Randomized, Double-Blind, Placebo-Controlled, Crossover Study in Healthy Subjects. Clin Pharmacol Ther. [Epub ahead of print] Application: Human, plasma. Berbenetz N et al. (2021) The Relationship Between Brain Derived Neurotrophic Factor (BDNF) and Symptoms Following Catheter Ablation for Paroxysmal Atrial Fibrillation (AF)- NEURO-AF Study. Circulation. [Epub ahead of print] Application: Human, serum. Walsh JJ et al. (2021) Short-term ketone monoester supplementation improves cerebral blood flow and cognition in obesity: A randomized cross-over trial. J Physiol. [Epub ahead of print] Application: Human, serum, platelet-poor plasma. Boukhatem I et al. (2021) The brain-derived neurotrophic factor prompts platelet aggregation and secretion. Blood Adv. 5(18):3568-3580 Application: Human, plasma. Yi X et al. (2021) Serum mBDNF and ProBDNF Expression Levels as Diagnosis Clue for Early Stage Parkinson's Disease. Front Neurol. 12:680765 Application: Human, serum. Inoue T et al. (2021) Ipsilateral BDNF mRNA expression in the motor cortex positively correlates with motor function of the affected forelimb after intracerebral hemorrhage. Brain Res. [Epub ahead of print] Application: Rat, brain homogenate. Shoshina II et al. (2021) Visual processing and BDNF levels in first-episode schizophrenia. Psychiatry Res. [Epub ahead of print] Application: Human, serum. Cappoli N et al. (2021) Effects of remifentanil on human C20 microglial pro-inflammatory activation. Eur Rev Med Pharmacol Sci. 25(16):5268-5274 Application: Human, cell culture. March B et al. (2021) ELISA-based quantification of neurotrophic growth factors in urine from prostate cancer patients. FASEB Bioadv. [Epub ahead of print] Application: Human, urine. Mori Y et al. (2021) Serum BDNF as a Potential Biomarker of Alzheimer's Disease: Verification Through Assessment of Serum, Cerebrospinal Fluid, and Medial Temporal Lobe Atrophy. Front Neurol. 12:653267 Application: Human, serum. Seno S et al. (2021) Effects of Selective Serotonin Reuptake Inhibitors on Depression-Like Behavior in a Laser-Induced Shock Wave Model. Front Neurol. 12:602038 Application: Mouse, hippocampal homogenates. Medeiros GC et al. (2021) Treatment of depression with ketamine does not change plasma levels of brain-derived neurotrophic factor or vascular endothelial growth factor. J Affect Disord. 280(Pt A):136-139 Application: Human, plasma. Dorandish S et al. (2021) Differences in the Relative Abundance of ProBDNF and Mature BDNF in A549 and H1299 Human Lung Cancer Cell Media. Int J Mol Sci. 22(13):7059 Application: Human, culture supernatant. Yap NY et al. (2021) Relationship between cytokines and brain-derived neurotrophic factor (BDNF) in trajectories of cancer-related cognitive impairment. Cytokine. [Epub ahead of print] Application: Human, plasma. Wang L et al. (2021) The mediating effect of brain-derived neurotrophic factor levels on childhood trauma and psychiatric symptoms in patients with first-episode schizophrenia. Aust N Z J Psychiatry. [Epub ahead of print] Application: Human. Mallik SB et al. (2021) Remedial effects of caffeine against depressive-like behaviour in mice by modulation of neuroinflammation and BDNF. Nutr Neurosci. [Epub ahead of print] Application: Mouse. Nomura S et al. (2021) Effects of a Tea Cultivar "MK5601" on Behaviors and Hippocampal Neurotrophin-3 Levels in Middle-Aged Mice. J Nutr Sci Vitaminol (Tokyo). 67(3):170-179 Application: Mouse, hippocampal RIPA homogenates. Caruso GI et al. (2021) SIRT1-Dependent Upregulation of BDNF in Human Microglia Challenged with A?: An Early but Transient Response Rescued by Melatonin. Biomedicines. 9(5):466 Application: Human, cell culture supernatant. Miller KM et al. (2021) Striatal Afferent BDNF Is Disrupted by Synucleinopathy and Partially Restored by STN DBS. J Neurosci. 41(9):2039-52 Application: Rat, tissue homogenates (RIPA). Vickneson K et al. (2021) Cold-induced dishabituation in rodents exposed to recurrent hypoglycaemia. Diabetologia. 64(6):1436-41 Application: Rat, blood. Li P et al. (2021) Intermediation of perceived stress between early trauma and plasma M/P ratio levels in obsessive-compulsive disorder patients. J Affect Disord. 285:105-111 Application: Human, plasma. Lai NS et al. (2021) Increased Serum Levels of Brain-Derived Neurotrophic Factor Contribute to Inflammatory Responses in Patients with Rheumatoid Arthritis. Int. J. Mol. Sci. 22(4):1841 Application: Human, serum and culture supernatants. Pan S et al. (2021) The microRNA-195 - BDNF pathway and cognitive deficits in schizophrenia patients with minimal antipsychotic medication exposure. Transl Psychiatry. 11(1):117 Application: Human, plasma. Miyamoto T et al. (2021) Effect of pedaling cadence on serum levels of brain-derived neurotrophic factor during ergometric exercise in healthy adults. Sport Sci Health. Application: Human, serum. Normann AJ (2020) The Effect of Light Therapy and Acute Aerobic Exercise on Serum Brain Derived Neurotrophic Factor in Older Adults. MSc Thesis. Application: Human, serum. Holze F et al. (2020) Acute dose-dependent effects of lysergic acid diethylamide in a double-blind placebo-controlled study in healthy subjects. Neuropsychopharmacology. [Epub ahead of print]. Application: Human, plasma. Hasler G et al. (2020) The Association Between Adolescent Residential Mobility and Adult Social Anxiety, BDNF and Amygdala-Orbitofrontal Functional Connectivity in Young Adults With Higher Education. Front. Psychiatry. Application: Human, serum. Wallace AW (2020) The Impact of Six Weeks of Intermittent Fasting, With and Without Aerobic Exercise, on Serum BDNF in Young Adult Males. MSc Thesis. Application: Human, serum. Walsh JJ et al. (2020) The Effect of Exogenous Ketone Monoester Ingestion on Plasma BDNF During an Oral Glucose Tolerance Test. Front Physiol. 11:1094. Application: Human, plasma. Meade GM et al. (2020) A Model of Negative Emotional Contagion Between Male-Female Rat Dyads: Effects of Voluntary Exercise on Stress-Induced Behavior and BDNF-TrkB Signaling. Physiol Behav. 113286 Application: Rat, serum. Hutten NRPW et al. (2020) Low Doses of LSD Acutely Increase BDNF Blood Plasma Levels in Healthy Volunteers. ACS Pharmacol. Transl. Sci. Application: Human, plasma. Barbosa AC et al. (2020) Assessment of BDNF serum levels as a diagnostic marker in children with autism spectrum disorder. Sci Rep. 10(1):17348. Application: Human, serum. Okamura M et al. (2020) Low-Level Inhibition of GABAergic Synapses Enhances Gene Expressions Crucial for Neuronal Plasticity in the Hippocampus After Ischemic Stroke. J Stroke Cerebrovasc Dis. 29(12):105316. Application: Rat, hippocampus homogenate. Payne AJ et al. (2020) The Effects of Alcohol on BDNF and CD5 Dependent Pathways. PhD Thesis. Application: Mouse, RIPA tissue homogenate. Nishiyama M et al. (2020) Homostachydrine is a Xenobiotic Substrate of OCTN1/SLC22A4 and Potentially Sensitizes Pentylenetetrazole-Induced Seizures in Mice. Neurochem Res. [Epub ahead of print]. Application: Mouse, acid-extracted hippocampal homogenate. Lorinczova HT et al. (2020) Co-Administration of Iron and a Bioavailable Curcumin Supplement Increases Serum BDNF Levels in Healthy Adults. Antioxidants (Basel). 9(8):E645. Application: Human serum. Yap NY F et al. (2020) Associations of plasma brain-derived neurotrophic factor (BDNF) and Val66Met polymorphism (rs6265) with long-term cancer-related cognitive impairment in survivors of breast cancer. Breast Cancer Res Treat. [Epub ahead of print]. Application: Human plasma. Vasilopoulou F et al. (2020) Amelioration of BPSD-Like Phenotype and Cognitive Decline in SAMP8 Mice Model Accompanied by Molecular Changes After Treatment With I 2-Imidazoline Receptor Ligand MCR5. Pharmaceutics. 12(5):E475. Application: Mouse hippocampus RIPA-homogenates. Mueller ST et al. (2020) Negative Association Between Left Prefrontal GABA Concentration and BDNF Serum Concentration in Young Adults. Heliyon. 6(5):e04025. Application: Human serum. Chen LF et al. (2020) The NMDA receptor subunit GluN3A regulates synaptic activity-induced and myocyte enhancer factor 2C (MEF2C)-dependent transcription. J Biol Chem. [Epub ahead of print]. Application: Rat neuronal cell lysate, acid-extracted. Companys-Alemany J et al. (2020) A Novel NMDA Receptor Antagonist Protects against Cognitive Decline Presented by Senescent Mice. Pharmaceutics. 12(3), 284. Application: Mouse hippocampal homogenates. Furukawa Y et al. (2020) Citrus Auraptene Induces Expression of Brain-Derived Neurotrophic Factor in Neuro2a Cells. Molecules. 25(5). Application: Mouse Neuro2a culture supernatant. Holze F et al. (2019) Distinct acute effects of LSD, MDMA, and D-amphetamine in healthy subjects. Neuropsychopharmacology. [Epub ahead of print]. Application: Human plasma. Sumiyoshi E et al. (2019) Sub-Chronic Consumption of Dark Chocolate Enhances Cognitive Function and Releases Nerve Growth Factors: A Parallel-Group Randomized Trial. Nutrients. 11(11). Application: Human plasma. Sartori A et al. (2019) Interferon-beta, but not Glatiramer Acetate treatment induces gender-specific increase in BDNF serum levels in relapsing-remitting multiple sclerosis female patients. Res J Neuro N Disord. 1:5-18. Application: Human serum. Please refer to our Technical Note #5 for validation experiments disproving the author's claim that the Biosensis Mature BDNF Rapid TM ELISA quantifies total BDNF! Vanicek T et al. (2019) Repetitive Enhancement of Serum BDNF Subsequent to Continuation ECT. Acta Psychiatr Scand. [Epub ahead of print]. Application: Human serum. Gejl AK et al. (2019) Associations between serum and plasma brain-derived neurotrophic factor and influence of storage time and centrifugation strategy. Sci Rep. 9(1):9655. Application: Human serum and EDTA-plasma. Li X et al. (2019) Exercise enhances the expression of brain-derived neurotrophic factor in the hippocampus accompanied by epigenetic alterations in senescence-accelerated mice prone 8. Neurosci Lett. [Epub ahead of print]. Application: Mouse brain homogenates. Yang CY et al. (2019) Panax notoginsenoside Rb1 Restores the Neurotrophic Imbalance Following Photothrombotic Stroke in Rats. Neurotox Res. [Epub ahead of print]. Application: Rat brain homogenates. Du Y et al. (2019) Genome-Wide, Integrative Analysis Implicates Exosome-Derived MicroRNA Dysregulation in Schizophrenia. Schizophr Bull. [Epub ahead of print]. Application: Human serum. Vanicek T et al. (2019) Acute and Subsequent Continuation Electroconvulsive Therapy Elevates Serum BDNF Levels in Patients with Major Depression. Brain Stimul. [In press]. Application: Human serum, plasma. Duart-Castells L et al. (2019) 7,8-dihydroxyflavone blocks the development of behavioral sensitization to MDPV, but not to cocaine: differential role of the BDNF-TrkB pathway. Biochem Pharmacol. [Epub ahead of print]. Application: Mouse RIPA tissue homogenates.
Typical limit of detection (LOD) for BDNF is less than 2 pg/mL, determined as 150% of the blank value.
Cross Reactivity:
No cross-reactivity is observed for nerve growth factor (NGF), neurotrophin-3 (NT-3), NT-4/5, glial cell line-derived neurotrophic factor (GDNF) and vascular endothelial growth factor (VEGF165) tested at 25 ng/mL in assay buffer. The reactivity of full-length proBDNF (0.125 ng/mL - 5 ng/mL) was determined in six independent assays using proBDNF proteins from four different sources (mammalian and bacterial, wild-type and mutated). The average cross-reactivity of proBDNF was found to be 5.3% +/- 0.5% in weight (w/v) concentration, or 12.1% +/- 1.2% in molar concentration (mean +/- SEM). Additional proBDNF cross-reactivity experiments were conducted as summarized in our <a class="newA" target="_blank" href="https://www.biosensis.com/documents/enhancedinfo/Technical-Note-5-Mature-BDNF-Isoform-Detection-and-Quantification-by-ELISA.pdf">Technical Note #5</a>.
The Biosensis CE Marked BDNF Rapid enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the preferential quantification of mature BDNF in less than 3 hours. This kit consists of a pre-coated mouse monoclonal anti-BDNF capture antibody, a biotinylated anti-BDNF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product which is directly proportional to the concentration of BDNF present in samples and protein standards. This BDNF ELISA kit employs a recombinant human BDNF standard approved by the World Health Organization (WHO, www.nibsc.org ). This kit is suitable to measure mature BDNF in human serum and citrate-treated plasma samples only. The antibodies used in this ELISA kit bind epitopes within the mature domain of the protein and therefore recognize the mature as well as the pro-form of BDNF. However, cross-reactivity to the full-length proBDNF protein is low. This CE Marked BDNF Rapid ELISA [Cat. No. BEK-2211-CE] Kit is approved for in-vitro diagnostic (IVD) applications in the European Economic Area (EEA). It has been developed by Biosensis and is manufactured by Calbiotech Inc. ( www.calbiotech.com ) for Biosensis. BEK-2211-CE is not approved for in-vitro diagnostic (IVD) applications in the United States. For research on human blood, customers MUST order the catalog number BEK-2211 . This research-use-only ELISA kit can be used for human and animal research purposes worldwide, and has been validated for a wider range of sample types and species.
Background Info:
BDNF belongs to the neurotrophin family and regulates the survival and differentiation of neurons during development. The alterations in BDNF expression induced by various kinds of brain insult including stress, ischemia, seizure activity and hypoglycemia, may contribute to some pathologies such as depression, epilepsy, Alzheimer's, and Parkinson's disease. FUNCTION: Promotes the survival of neuronal populations that are all located either in the central nervous system or directly connected to it. Major regulator of synaptic transmission and plasticity at adult synapses in many regions of the CNS. The versatility of BDNF is emphasized by its contribution to a range of adaptive neuronal responses including long-term potentiation (LTP), long-term depression (LTD), certain forms of short-term synaptic plasticity, as well as homeostatic regulation of intrinsic neuronal excitability. SUBUNIT: Monomers and homodimers. Binds to NTRK2/TRKB. SUBCELLULAR LOCATION: Secreted protein. Post Translation Modification (PTM): The propeptide is N-glycosylated and glycosulfated. PTM: Converted into mature BDNF by plasmin (PLG) (By similarity). DISEASE: Defects in BDNF are a cause of congenital central hypoventilation syndrome (CCHS); also known as congenital failure of autonomic control or Ondine curse. CCHS is a rare disorder characterized by abnormal control of respiration in the absence of neuromuscular or lung disease, or an identifiable brain stem lesion. A deficiency in autonomic control of respiration results in inadequate or negligible ventilatory and arousal responses to hypercapnia and hypoxemia. CCHS is frequently complicated with neurocristopathies such as Hirschsprung disease that occurs in about 16% of CCHS cases. SIMILARITY: Belongs to the NGF-beta family.
Product Type:
ELISA Assay
Species Reactivity:
Human
Immunogen:
Recombinant human BDNF with an N-terminal methionine residue, made in E. coli (WHO reference reagent)
Applications:
ELISA
Application Details:
ELISA. For the quantification of Brain-derived neurotrophic factor, mature (BDNF, mature) in Serum, Plasma (Citrate). BEK-2211-CE is expressly designed and tested only for use on human blood and plasma samples. Any other use is deemed "off label use" and thus the performance characteristics of the assay will have to be determined by the end user, and such results are not supported by Biosensis or CalBioTech at this time. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
See BEK-2211-2P-CE protocol insert for specific expiration dating of the kit and its components.
Use:
Approved for in-vitro diagnostic (IVD) applications in the European Economic Area (EEA). It has been developed by Biosensis and is manufactured by Calbiotech Inc. (www.calbiotech.com) for Biosensis.
This kit is not approved for in-vitro diagnostic (IVD) applications in the United States. For research on human blood, customers MUST order the catalog number BEK-2211.
Kit Components:
The ELISA kit box contains 96-well pre-coated strip plate(s), protein standards, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Reed JL et al. (2021) The effects of high-intensity interval training, Nordic walking and moderate-to-vigorous intensity continuous training on functional capacity, depression and quality of life in patients with coronary artery disease enrolled in cardiac rehabilitation: A randomized controlled trial (CRX study). Prog Cardiovasc Dis. [Epub ahead of print]. Application: Human blood. Valkenborghs SR et al. (2019) Aerobic exercise and consecutive task-specific training (AExaCTT) for upper limb recovery after stroke: A randomized controlled pilot study. Physiother Res Int. [Epub ahead of print]. Application: Human serum.
Specificity:
Human BDNF when used as directed.
Storage:
Store at 2-8°C
Range:
7.8 pg/mL - 500 pg/mL
Sample Type:
Plasma (Citrate),Serum
Sensitivity:
Typical limit of detection (LOD) for BDNF is < 3 pg/mL determined by calculating the mean + 2x standard deviation of mean of blank (n=20).
The Biosensis NGF Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the quantification of human NGF in less than 3 hours in cell culture supernatants, serum, plasma (citrate) and brain extracts only if used as directed. Please refer to the kit protocol for specific use instructions for each substrate application, in particular serum and plasma samples. This ELISA kit consists of a pre-coated mouse monoclonal anti-NGF capture antibody, a biotinylated anti-NGF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate 3,3',5,5'-tetramethylbenzidine, TMB yields a colored reaction product which is directly proportional to the concentration of NGF present in samples and protein standards. A human NGF positive control (QC sample) is provided to assure consistent assay performance. This NGF ELISA kit is designed to measure human NGF and thus employs a recombinant human NGF standard approved by the World Health Organization (WHO). Due to a high degree of NGF sequence homology, the antibodies used in this kit will also detect NGF from numerous other species including mouse and rat! The antibodies used in this ELISA kit bind epitopes within the mature domain of the protein and therefore can recognize both the pro- and the mature form of NGF. However, internal validation data demonstrates Note that accurate NGF quantification in human citrate-plasma requires the addition of Heterophilic Antibody Blocker BL-005-500 provided in the kit, and available for purchase separately . This kit has not been tested for other applications. It has been configured for research use only and is not to be used in diagnostic or clinical procedures.
Background Info:
FUNCTION: Nerve growth factor is important for the development and maintenance of the sympathetic and sensory nervous systems. It stimulates division and differentiation of sympathetic and embryonic sensory neurons. SUBUNIT: Homodimer, associated by non-covalent forces. SUBCELLULAR LOCATION: Secreted protein. SIMILARITY: Belongs to the NGF-beta family.
Product Type:
ELISA Assay
Species Reactivity:
Human
Immunogen:
Recombinant human NGF, made in CHO cells (WHO reference reagent)
Applications:
ELISA
Application Details:
ELISA. For the quantification of Nerve growth factor (Beta-NGF) in Culture Supernatant, Serum, Plasma (Citrate), Tissue Homogenates. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
Alternative Names:
Beta-nerve growth factor; Ngfb; NGF;
Biosensis Brand:
Rapid
Detection Method:
Colorimetric
Shelf Life:
12 months from purchase.
Use:
For research use only.
Kit Components:
The ELISA kit box contains 96-well pre-coated strip plate(s), protein standards, QC sample, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Chen S et al. (2022) Newly Generated 3D Schwann-Like Cell Spheroids From Human Adipose-Derived Stem Cells Using a Modified Protocol. Cell Transplant. 31:9636897221093312. Application: Human cell culture supernatant. Chen S et al. (2021) Effective in vitro differentiation of adipose-derived stem cells into Schwann-like cells with folic acid supplementation. J Med Investig. Vol. 68. Application: Human cell culture supernatant. March B et al. (2021) ELISA-based quantification of neurotrophic growth factors in urine from prostate cancer patients. FASEB Bioadv. [Epub ahead of print]. Application: Human urine. Mossa AH et al. (2020) Imbalance of nerve growth factor metabolism in aging women with overactive bladder syndrome. World J Urol. [Epub ahead of print]. Application: Human urine. Sumiyoshi E et al. (2019) Sub-Chronic Consumption of Dark Chocolate Enhances Cognitive Function and Releases Nerve Growth Factors: A Parallel-Group Randomized Trial. Nutrients. 11(11). Application: Human Plasma. Sherif IO & Al-Gayyar MMH (2018) Oleuropein potentiates anti-tumor activity of cisplatin against HepG2 through affecting proNGF/NGF balance. Life Sci. [Epub ahead of print]. Application: Human cell culture.
Typical limit of detection (LOD) for human NGF is 2 pg/mL determined as 150% of the blank value.
Cross Reactivity:
The antibodies used in this ELISA kit bind epitopes within the mature domain of the protein and therefore can recognize both the pro- and the mature form of NGF. However, human proNGF protein shows <0.1% cross-reactivity (determined at 25 ng/mL, diluted in assay buffer), suggesting the preferential quantification of mature NGF over full-length human proNGF.<br><br> This NGF ELISA does not cross-react with brain derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3), NT-4/5, glial cell line-derived neurotrophic factor (GDNF) and vascular endothelial growth factor (VEGF165) tested at 25 ng/mL. Due to a high degree of NGF sequence homology, the antibodies used in this kit will also detect mature NGF from numerous other species including mouse and rat!
The Biosensis NGF Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the quantification of human NGF in less than 3 hours in cell culture supernatants, serum, plasma (citrate) and brain extracts only if used as directed. Please refer to the kit protocol for specific use instructions for each substrate application, in particular serum and plasma samples. This ELISA kit consists of a pre-coated mouse monoclonal anti-NGF capture antibody, a biotinylated anti-NGF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate 3,3',5,5'-tetramethylbenzidine, TMB yields a colored reaction product which is directly proportional to the concentration of NGF present in samples and protein standards. A human NGF positive control (QC sample) is provided to assure consistent assay performance. This NGF ELISA kit is designed to measure human NGF and thus employs a recombinant human NGF standard approved by the World Health Organization (WHO). Due to a high degree of NGF sequence homology, the antibodies used in this kit will also detect NGF from numerous other species including mouse and rat! The antibodies used in this ELISA kit bind epitopes within the mature domain of the protein and therefore can recognize both the pro- and the mature form of NGF. However, internal validation data demonstrates Note that accurate NGF quantification in human citrate-plasma requires the addition of Heterophilic Antibody Blocker BL-005-500 provided in the kit, and available for purchase separately . This kit has not been tested for other applications. It has been configured for research use only and is not to be used in diagnostic or clinical procedures.
Background Info:
FUNCTION: Nerve growth factor is important for the development and maintenance of the sympathetic and sensory nervous systems. It stimulates division and differentiation of sympathetic and embryonic sensory neurons. SUBUNIT: Homodimer, associated by non-covalent forces. SUBCELLULAR LOCATION: Secreted protein. SIMILARITY: Belongs to the NGF-beta family.
Product Type:
ELISA Assay
Species Reactivity:
Human
Immunogen:
Recombinant human NGF, made in CHO cells (WHO reference reagent)
Applications:
ELISA
Application Details:
ELISA. For the quantification of Nerve growth factor (Beta-NGF) in Culture Supernatant, Serum, Plasma (Citrate), Tissue Homogenates. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
Alternative Names:
Beta-nerve growth factor; Ngfb; NGF;
Biosensis Brand:
Rapid
Detection Method:
Colorimetric
Shelf Life:
12 months from purchase.
Use:
For research use only.
Kit Components:
The ELISA kit box contains 96-well pre-coated strip plate(s), protein standards, QC sample, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Chen S et al. (2022) Newly Generated 3D Schwann-Like Cell Spheroids From Human Adipose-Derived Stem Cells Using a Modified Protocol. Cell Transplant. 31:9636897221093312. Application: Human cell culture supernatant. Chen S et al. (2021) Effective in vitro differentiation of adipose-derived stem cells into Schwann-like cells with folic acid supplementation. J Med Investig. Vol. 68. Application: Human cell culture supernatant. March B et al. (2021) ELISA-based quantification of neurotrophic growth factors in urine from prostate cancer patients. FASEB Bioadv. [Epub ahead of print]. Application: Human urine. Mossa AH et al. (2020) Imbalance of nerve growth factor metabolism in aging women with overactive bladder syndrome. World J Urol. [Epub ahead of print]. Application: Human urine. Sumiyoshi E et al. (2019) Sub-Chronic Consumption of Dark Chocolate Enhances Cognitive Function and Releases Nerve Growth Factors: A Parallel-Group Randomized Trial. Nutrients. 11(11). Application: Human Plasma. Sherif IO & Al-Gayyar MMH (2018) Oleuropein potentiates anti-tumor activity of cisplatin against HepG2 through affecting proNGF/NGF balance. Life Sci. [Epub ahead of print]. Application: Human cell culture.
Typical limit of detection (LOD) for human NGF is 2 pg/mL determined as 150% of the blank value.
Cross Reactivity:
The antibodies used in this ELISA kit bind epitopes within the mature domain of the protein and therefore can recognize both the pro- and the mature form of NGF. However, human proNGF protein shows <0.1% cross-reactivity (determined at 25 ng/mL, diluted in assay buffer), suggesting the preferential quantification of mature NGF over full-length human proNGF.<br><br> This NGF ELISA does not cross-react with brain derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3), NT-4/5, glial cell line-derived neurotrophic factor (GDNF) and vascular endothelial growth factor (VEGF165) tested at 25 ng/mL. Due to a high degree of NGF sequence homology, the antibodies used in this kit will also detect mature NGF from numerous other species including mouse and rat!
The Biosensis NGF Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the quantification of mouse NGF in less than 3 hours in cell culture supernatants and brain extracts only if used as directed. Please refer to the kit protocol for specific use instructions for each substrate application. This ELISA kit consists of a pre-coated mouse monoclonal anti-NGF capture antibody, a biotinylated anti-NGF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3,5,5-tetramethylbenzidine, TMB) yields a colored reaction product which is directly proportional to the concentration of NGF present in samples and protein standards. A mouse NGF positive control (QC sample) is provided to assure consistent assay performance. This NGF ELISA kit is designed to measure mouse NGF and thus employs a mouse NGF standard. The mouse NGF standard supplied has been purified from mouse submaxillary glands according to published procedures. The calibrator standard reflects the native state of mouse NGF protein and has been chosen to give most accurate quantification of natural NGF protein levels in mouse samples. Due to a high degree of NGF sequence homology, the antibodies used in this kit will also detect NGF from other species including human and rat! This ELISA kit preferentially detects the mature form of NGF. Cross- reaction of full-length mouse proNGF was This kit has not been tested for other applications. It has been configured for research use only and is not to be used in diagnostic or clinical procedures.
Background Info:
FUNCTION: Nerve growth factor is important for the development and maintenance of the sympathetic and sensory nervous systems. It stimulates division and differentiation of sympathetic and embryonic sensory neurons. SUBUNIT: Homodimer, associated by non-covalent forces. SUBCELLULAR LOCATION: Secreted protein. SIMILARITY: Belongs to the NGF-beta family.
Product Type:
ELISA Assay
Species Reactivity:
Mouse
Immunogen:
Native mouse NGF, purified from submaxillary glands
Applications:
ELISA
Application Details:
ELISA. For the quantification of Nerve growth factor (Beta-NGF) in Culture Supernatant, Tissue Homogenates. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
Alternative Names:
Beta-nerve growth factor; Ngfb; NGF;
Biosensis Brand:
Rapid
Detection Method:
Colorimetric
Shelf Life:
12 months from purchase.
Use:
For research use only.
Kit Components:
The ELISA kit box contains 96-well pre-coated strip plate(s), protein standards, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Luu BE et al. (2022) Modulation of diabetic kidney disease markers by an antagonist of p75NTR in streptozotocin-treated mice Gene. [Epub ahead of print]. Application: Mouse kidney RIPA homogenates. Xu J et al. (2022) NGF-p75 signaling coordinates skeletal cell migration during bone repair Sci Adv. 8(11):eabl5716. Application: Mouse cell lysates. Nomura S et al. (2021) Effects of a Tea Cultivar "MK5601" on Behaviors and Hippocampal Neurotrophin-3 Levels in Middle-Aged Mice. J Nutr Sci Vitaminol (Tokyo). 67(3):170-179. Application: Mouse hippocampal RIPA homogenates. Sugimoto J et al. (2021) Fabry disease-associated globotriaosylceramide induces mechanical allodynia via activation of signaling through proNGF p75NTR but not mature NGF TrkA. Eur. J. Pharmacol. 895. Application: Mouse tissue homogenate (RIPA). La Porta C and Tappe-Theodor A (2020) Differential impact of psychological and psychophysical stress on low back pain in mice. Pain. 161(7):1442-1458. Application: Mouse tissue homogenate. Mossa AH et al. (2020) Antagonism of proNGF or its receptor p75 NTR reverses remodelling and improves bladder function in a mouse model of diabetic voiding dysfunction. Diabetologia. [Epub ahead of print]. Application: Mouse bladder extracts (RIPA). Roy S et al. (2020) Neurogenic Tissue Nanotransfection in the Management of Cutaneous Diabetic Polyneuropathy. Nanomedicine. [Epub ahead of print]. Application: Mouse lysate. Vigli D et al. (2018) Chronic treatment with the phytocannabinoid Cannabidivarin (CBDV) rescues behavioural alterations and brain atrophy in a mouse model of Rett syndrome. Neuropharmacology. 2018 Jul 26; [Epub ahead of print]. Application: Mouse hippocampus homogenate. Ryu JC et al. (2018). Role of proNGF/p75 signaling in bladder dysfunction after spinal cord injury. J Clin Invest. [Epub ahead of print]. Application: Mouse urine.
Storage:
Store at 2-8°C
Range:
3.9 - 250 pg/mL
Sample Type:
Culture Supernatant,Tissue Homogenates
Sensitivity:
Typical limit of detection (LOD) for mouse NGF is 2 pg/mL determined as 150% of the blank value.
Cross Reactivity:
The antibodies used in this ELISA kit bind epitopes within the mature domain of the protein. No cross-reactivity was observed with brain derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3) and NT-4/5 tested at 25 ng/mL in assay buffer. Due to a high degree of NGF sequence homology, the antibodies used in this kit will also detect NGF from other species including human and rat! <br><br>Mature mouse NGF (27 kDa) and full-length mouse proNGF (50 kDa) were assayed in parallel at equimolar protein concentrations across the Mouse NGF ELISA calibration range (3.9-250 pg/mL; 0.14-9.2 pmol/L). OD readings for mouse proNGF were indistinguishable from the assay's blank OD readings.
The Biosensis NGF Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the quantification of mouse NGF in less than 3 hours in cell culture supernatants and brain extracts only if used as directed. Please refer to the kit protocol for specific use instructions for each substrate application. This ELISA kit consists of a pre-coated mouse monoclonal anti-NGF capture antibody, a biotinylated anti-NGF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3,5,5-tetramethylbenzidine, TMB) yields a colored reaction product which is directly proportional to the concentration of NGF present in samples and protein standards. A mouse NGF positive control (QC sample) is provided to assure consistent assay performance. This NGF ELISA kit is designed to measure mouse NGF and thus employs a mouse NGF standard. The mouse NGF standard supplied has been purified from mouse submaxillary glands according to published procedures. The calibrator standard reflects the native state of mouse NGF protein and has been chosen to give most accurate quantification of natural NGF protein levels in mouse samples. Due to a high degree of NGF sequence homology, the antibodies used in this kit will also detect NGF from other species including human and rat! This ELISA kit preferentially detects the mature form of NGF. Cross- reaction of full-length mouse proNGF was This kit has not been tested for other applications. It has been configured for research use only and is not to be used in diagnostic or clinical procedures.
Background Info:
FUNCTION: Nerve growth factor is important for the development and maintenance of the sympathetic and sensory nervous systems. It stimulates division and differentiation of sympathetic and embryonic sensory neurons. SUBUNIT: Homodimer, associated by non-covalent forces. SUBCELLULAR LOCATION: Secreted protein. SIMILARITY: Belongs to the NGF-beta family.
Product Type:
ELISA Assay
Species Reactivity:
Mouse
Immunogen:
Native mouse NGF, purified from submaxillary glands
Applications:
ELISA
Application Details:
ELISA. For the quantification of Nerve growth factor (Beta-NGF) in Culture Supernatant, Tissue Homogenates. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
Alternative Names:
Beta-nerve growth factor; Ngfb; NGF;
Biosensis Brand:
Rapid
Detection Method:
Colorimetric
Shelf Life:
12 months from purchase.
Use:
For research use only.
Kit Components:
The ELISA kit box contains 96-well pre-coated strip plate(s), protein standards, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Luu BE et al. (2022) Modulation of diabetic kidney disease markers by an antagonist of p75NTR in streptozotocin-treated mice Gene. [Epub ahead of print]. Application: Mouse kidney RIPA homogenates. Xu J et al. (2022) NGF-p75 signaling coordinates skeletal cell migration during bone repair Sci Adv. 8(11):eabl5716. Application: Mouse cell lysates. Nomura S et al. (2021) Effects of a Tea Cultivar "MK5601" on Behaviors and Hippocampal Neurotrophin-3 Levels in Middle-Aged Mice. J Nutr Sci Vitaminol (Tokyo). 67(3):170-179. Application: Mouse hippocampal RIPA homogenates. Sugimoto J et al. (2021) Fabry disease-associated globotriaosylceramide induces mechanical allodynia via activation of signaling through proNGF p75NTR but not mature NGF TrkA. Eur. J. Pharmacol. 895. Application: Mouse tissue homogenate (RIPA). La Porta C and Tappe-Theodor A (2020) Differential impact of psychological and psychophysical stress on low back pain in mice. Pain. 161(7):1442-1458. Application: Mouse tissue homogenate. Mossa AH et al. (2020) Antagonism of proNGF or its receptor p75 NTR reverses remodelling and improves bladder function in a mouse model of diabetic voiding dysfunction. Diabetologia. [Epub ahead of print]. Application: Mouse bladder extracts (RIPA). Roy S et al. (2020) Neurogenic Tissue Nanotransfection in the Management of Cutaneous Diabetic Polyneuropathy. Nanomedicine. [Epub ahead of print]. Application: Mouse lysate. Vigli D et al. (2018) Chronic treatment with the phytocannabinoid Cannabidivarin (CBDV) rescues behavioural alterations and brain atrophy in a mouse model of Rett syndrome. Neuropharmacology. 2018 Jul 26; [Epub ahead of print]. Application: Mouse hippocampus homogenate. Ryu JC et al. (2018). Role of proNGF/p75 signaling in bladder dysfunction after spinal cord injury. J Clin Invest. [Epub ahead of print]. Application: Mouse urine.
Storage:
Store at 2-8°C
Range:
3.9 - 250 pg/mL
Sample Type:
Culture Supernatant,Tissue Homogenates
Sensitivity:
Typical limit of detection (LOD) for mouse NGF is 2 pg/mL determined as 150% of the blank value.
Cross Reactivity:
The antibodies used in this ELISA kit bind epitopes within the mature domain of the protein. No cross-reactivity was observed with brain derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3) and NT-4/5 tested at 25 ng/mL in assay buffer. Due to a high degree of NGF sequence homology, the antibodies used in this kit will also detect NGF from other species including human and rat! <br><br>Mature mouse NGF (27 kDa) and full-length mouse proNGF (50 kDa) were assayed in parallel at equimolar protein concentrations across the Mouse NGF ELISA calibration range (3.9-250 pg/mL; 0.14-9.2 pmol/L). OD readings for mouse proNGF were indistinguishable from the assay's blank OD readings.
The Biosensis NGF Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the quantification of rat NGF in less than 3 hours in cell culture supernatants, serum, and brain extracts only if used as directed. Please refer to the kit protocol for specific use instructions for each substrate application, in particular serum samples. This ELISA kit consists of a pre-coated mouse monoclonal anti-NGF capture antibody, a biotinylated anti-NGF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product which is directly proportional to the concentration of NGF present in samples and protein standards. This NGF ELISA kit is designed to measure rat NGF and thus employs a recombinant rat NGF protein. Due to a high degree of NGF sequence homology, the antibodies used in this kit will also detect NGF from other species including human and mouse! Guinea pig NGF has been quantified in serum using this ELISA kit using rat NGF protein as calibrator, as it shows largest sequence homology based on amino acid sequence among rodent and human NGF proteins. The assay antibodies preferentially detect the mature form of NGF, as shown by data comparing mature mouse NGF and mouse proNGF in the Mouse NGF ELISA kit (BEK-2213). Cross-reaction of full-length proNGF was This kit has not been tested for other applications. It has been configured for research use only and is not to be used in diagnostic or clinical procedures.
Background Info:
FUNCTION: Nerve growth factor is important for the development and maintenance of the sympathetic and sensory nervous systems. It stimulates division and differentiation of sympathetic and embryonic sensory neurons. SUBUNIT: Homodimer, associated by non-covalent forces. SUBCELLULAR LOCATION: Secreted protein. SIMILARITY: Belongs to the NGF-beta family.
Product Type:
ELISA Assay
Species Reactivity:
Guinea Pig,Rat
Immunogen:
Sf 21 (baculovirus)-derived rat beta-NGF protein
Applications:
ELISA
Application Details:
ELISA. For the quantification of Nerve growth factor (Beta-NGF) in Culture Supernatant, Serum, Tissue Homogenates. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
Alternative Names:
Beta-nerve growth factor; Ngfb; NGF;
Biosensis Brand:
Rapid
Detection Method:
Colorimetric
Shelf Life:
12 months from purchase.
Use:
For research use only.
Kit Components:
The ELISA kit box contains 96-well pre-coated strip plate(s), protein standards, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Mossa A et al. (2021) "Adaptation to partial urethral obstruction in healthy aging LOU rats and the role of nerve growth factor signaling pathway in the bladder." Exp Gerontol. [Epup ahead of print] Application: Rat urine. Itai S et al. (2020) "Cell-encapsulated chitosan-collagen hydrogel hybrid nerve guidance conduit for peripheral nerve regeneration." Biomed Microdevices. 22(4):81 Application: Rat cell culture supernatant. Cheppudira BP et al. (2016) "Anti-nerve growth factor antibody attenuates chronic morphine treatment-induced tolerance in the rat." BMC Anesthesiol. 16:73 Application: Acid-extracted rat spinal cord homogenate.
Storage:
Store at 2-8°C
Range:
3.9 - 250 pg/mL
Sample Type:
Culture Supernatant,Serum,Tissue Homogenates
Sensitivity:
Typical limit of detection (LOD) for rat NGF is 2 pg/mL determined as 150% of the blank value.
Cross Reactivity:
The antibodies used in this ELISA kit bind epitopes within the mature domain of the protein. No cross-reactivity was observed with brain derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3), NT-4/5 and proNGF protein tested at 25 ng/mL in assay buffer. Due to a high degree of NGF sequence homology, the antibodies used in this kit will also detect NGF from other species including human and mouse! <br><br>Mature NGF (27 kDa) and full-length proNGF (50 kDa) were assayed in parallel at equimolar protein concentrations across the NGF ELISA calibration range (3.9-250 pg/mL; 0.14-9.2 pmol/L). OD readings for proNGF were indistinguishable from the assay's blank OD readings. Data was obtained with the Mouse NGF ELISA kit (BEK-2213) which uses the same assay capture and detection antibodies.
The Biosensis NGF Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the quantification of rat NGF in less than 3 hours in cell culture supernatants, serum, and brain extracts only if used as directed. Please refer to the kit protocol for specific use instructions for each substrate application, in particular serum samples. This ELISA kit consists of a pre-coated mouse monoclonal anti-NGF capture antibody, a biotinylated anti-NGF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product which is directly proportional to the concentration of NGF present in samples and protein standards. This NGF ELISA kit is designed to measure rat NGF and thus employs a recombinant rat NGF protein. Due to a high degree of NGF sequence homology, the antibodies used in this kit will also detect NGF from other species including human and mouse! Guinea pig NGF has been quantified in serum using this ELISA kit using rat NGF protein as calibrator, as it shows largest sequence homology based on amino acid sequence among rodent and human NGF proteins. The assay antibodies preferentially detect the mature form of NGF, as shown by data comparing mature mouse NGF and mouse proNGF in the Mouse NGF ELISA kit (BEK-2213). Cross-reaction of full-length proNGF was This kit has not been tested for other applications. It has been configured for research use only and is not to be used in diagnostic or clinical procedures.
Background Info:
FUNCTION: Nerve growth factor is important for the development and maintenance of the sympathetic and sensory nervous systems. It stimulates division and differentiation of sympathetic and embryonic sensory neurons. SUBUNIT: Homodimer, associated by non-covalent forces. SUBCELLULAR LOCATION: Secreted protein. SIMILARITY: Belongs to the NGF-beta family.
Product Type:
ELISA Assay
Species Reactivity:
Guinea Pig,Rat
Immunogen:
Sf 21 (baculovirus)-derived rat beta-NGF protein
Applications:
ELISA
Application Details:
ELISA. For the quantification of Nerve growth factor (Beta-NGF) in Culture Supernatant, Serum, Tissue Homogenates. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
Alternative Names:
Beta-nerve growth factor; Ngfb; NGF;
Biosensis Brand:
Rapid
Detection Method:
Colorimetric
Shelf Life:
12 months from purchase.
Use:
For research use only.
Kit Components:
The ELISA kit box contains 96-well pre-coated strip plate(s), protein standards, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Mossa A et al. (2021) "Adaptation to partial urethral obstruction in healthy aging LOU rats and the role of nerve growth factor signaling pathway in the bladder." Exp Gerontol. [Epup ahead of print] Application: Rat urine. Itai S et al. (2020) "Cell-encapsulated chitosan-collagen hydrogel hybrid nerve guidance conduit for peripheral nerve regeneration." Biomed Microdevices. 22(4):81 Application: Rat cell culture supernatant. Cheppudira BP et al. (2016) "Anti-nerve growth factor antibody attenuates chronic morphine treatment-induced tolerance in the rat." BMC Anesthesiol. 16:73 Application: Acid-extracted rat spinal cord homogenate.
Storage:
Store at 2-8°C
Range:
3.9 - 250 pg/mL
Sample Type:
Culture Supernatant,Serum,Tissue Homogenates
Sensitivity:
Typical limit of detection (LOD) for rat NGF is 2 pg/mL determined as 150% of the blank value.
Cross Reactivity:
The antibodies used in this ELISA kit bind epitopes within the mature domain of the protein. No cross-reactivity was observed with brain derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3), NT-4/5 and proNGF protein tested at 25 ng/mL in assay buffer. Due to a high degree of NGF sequence homology, the antibodies used in this kit will also detect NGF from other species including human and mouse! <br><br>Mature NGF (27 kDa) and full-length proNGF (50 kDa) were assayed in parallel at equimolar protein concentrations across the NGF ELISA calibration range (3.9-250 pg/mL; 0.14-9.2 pmol/L). OD readings for proNGF were indistinguishable from the assay's blank OD readings. Data was obtained with the Mouse NGF ELISA kit (BEK-2213) which uses the same assay capture and detection antibodies
The oligomeric form of Amyloid Beta peptide (A?, 1-42) has been closely linked to Alzheimer's Disease. Several ELISAs targeting A? have been developed; however, these ELISAs are known to cross-react with Amyloid Beta precursor protein (APP) and are poorly characterized against monomeric and oligomeric forms of the peptide. The Biosensis MOAB-2 antibody, developed by LaDu and co-workers (Youmans K. et al. , 2012) , has been shown to specifically detect A?, but not the precursor molecule APP. When utilized in ELISAs, the oligomeric form of A? peptide (o-A?) can be assayed independently of the other forms of the molecule when assayed with the MOAB-2 monoclonal antibody. The Biosensis oligomeric A? ELISA kit is a sandwich ELISA that allows the preferential quantification of oligomeric A? peptides. This kit is exclusive to Biosensis and consists of a pre-coated mouse monoclonal anti-A? capture antibody (MOAB-2), a biotinylated MOAB-2 detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product which is directly proportional to the concentration of o-A? present in samples and protein standards. The purpose of this kit is the in vitro qualitative measurement of oligomeric A? peptide levels in brain extracts and CSF samples from both transgenic mice and humans relative to a known o-A? standard. The inclusion of a highly validated oligomeric standard results in a unique, ready-to-use ELISA kit. This kit has been configured for research use only and is not to be used in diagnostic or clinical procedures.
Product Type:
ELISA Assay
Species Reactivity:
Human,Rat
Immunogen:
The standard in this ELISA is synthetically manufactured beta-amyloid peptide, amino acids 1-42 of human, HFIP treated and dried.The stabilized oligomeric beta amyloid 1-42 control complex is also constructed from the same synthetic peptide standard material. No animal systems were used for their manufacture.
Applications:
ELISA
Application Details:
ELISA. For the quantification of Oligomeric Amyloid-beta in CSF, Tissue Homogenates. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
The ELISA kit box contains 96-well pre-coated strip plate(s), protein standards, QC sample, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Kasus-Jacobi A et al. (2022) "Selecting Multitarget Peptides for Alzheimers Disease" Biomolecules. 12, 1386 Application: Human, A?142 oligomers. Eid A et al. (2022) "Effects of DDT on Amyloid Precursor Protein Levels and Amyloid Beta Pathology: Mechanistic Links to Alzheimer's Disease Risk" Environ Health Perspect. [Epub ahead of print] Application: Mouse, brain tissue homogenate. Kasus-Jacobi A et al. (2021) "Neutrophil Granule Proteins Inhibit Amyloid Beta Aggregation and Neurotoxicity." Curr Alzheimer Res. 18(5):414-427 Application: Mouse in-vitro assay, cell culture supernatant. Hark TJ et al. (2020) "Pulse-Chase Proteomics of the App Knockin Mouse Models of Alzheimer s Disease Reveals that Synaptic Dysfunction Originates in Presynaptic Terminals." Cell Syst. [Epub ahead of print] Application: Mouse cortical homogenates. Xiao L et al. (2020) "Enzyme-digested Colla Corii Asini (E'jiao) prevents hydrogen peroxide-induced cell death and accelerates amyloid beta clearance in neuronal-like PC12 cells." Neural Regen Res. 15(12): 2270-2 Application: Rat PC12 RIPA cell extract. Hrynchak MV et al. (2020) "Chronic Presence of Oligomeric A? Differentially Modulates Spine Parameters in the Hippocampus and Cortex of Mice With Low APP Transgene Expression." Front Synaptic Neurosci. Apr 24;12:16 Application: Mouse lysate. El-Sayed NA et al. (2019) "Design, synthesis, in vitro and in vivo evaluation of novel pyrrolizine-based compounds with potential activity as cholinesterase inhibitors and anti-Alzheimer's agents." Bioorg Chem. [Epub ahead of print] Application: Human. In-vitro screening of drug candidates. Oh Joo Kweon, Young Chul Youn, Yong Kwan Lim, Mi-Kyung Lee, Hye Ryoun Kim (2019) "Clinical utility of serum hepcidin and iron profile measurements in Alzheimer's disease." J Neurol Sci. [In press] Application: Human serum. Pacheco-Quinto J, Clausen D, Perez-Gonzalez R, Peng H, Meszaros A, Eckman CB, Levy E, Eckman EA (2018) "Intracellular metalloprotease activity controls intraneuronal A? aggregation and limits secretion of A? via exosomes." FASEB J. [Epub ahead of print] Application: Human cell line, mouse brain and organotypic brain slice cultures. Oh SB, Kim MS, Park S, Son H, Kim SY, Kim MS, Jo DG, Tak E, Lee JY (2018) "Clusterin contributes to early stage of Alzheimer's disease pathogenesis." Brain Pathol. [Epub ahead of print] Application: Transgenic mouse brain homogenates. S Liu, S Park, G Allington, F Prelli, Y Sun, M Marta-Ariza, H Scholtzova, G Biswas, B Brown, PB Verghese, PD Mehta, Y-U Kwon and T Wisniewski (2017) "Targeting Apolipoprotein E/Amyloid _ Binding by Peptoid CPO_A?17-21 P Ameliorates Alzheimer's Disease Related Pathology and Cognitive Decline." Sci Rep. 7(1):8009 Application: Transgenic mouse brain homogenates. M Cacciottolo, X Wang, I Driscoll, N Woodward, A Saffari, J Reyes, M L Serre, W Vizuete, C Sioutas, T E Morgan, M Gatz, H C Chui, S A Shumaker, S M Resnick, M A Espeland, C E Finch and J C Chen (2017) "Particulate air pollutants, APOE alleles and their contributions to cognitive impairment in older women and to amyloidogenesis in experimental models." Transl Psychiatry. Jan 31;7(1):e1022. Application: Extracts of E3FAD and E4FAD transgenic mouse brains. Riya Thomas, Paulina Zuchowska, Alan W. J. Morris, Felecia M. Marottoli, Sangeeta Sunny, Ryan Deaton, Peter H. Gann, Leon M. Tai (2016) "Epidermal growth factor prevents APOE4 and amyloid-beta-induced cognitive and cerebrovascular deficits in female mice." Acta Neuropathol Commun. 4(1):111 Application: Tris-extracts of EFAD transgenic mouse brains. Nor Faeizah Ibrahim, Daijiro Yanagisawa, Lina Wati Durani, Hamizah Shahirah Hamezah, Hanafi Ahmad Damanhuri, Wan Zurinah Wan Ngah, Mayumi Tsuji, Yuji Kiuchi, Kenjiro Ono, Ikuo Tooyama (2016) "Tocotrienol-Rich Fraction Modulates Amyloid Pathology and Improves Cognitive Function in A?PP/PS1 Mice." J Alzheimers Dis. [Epub ahead of print]. Application: Tris-extracts of mouse brain homogenates. Jia Luo, Sue H. Lee, Lawren VandeVrede, Zhihui Qin, Manel Ben Aissa, John Larson, Andrew F. Teich, Ottavio Arancio, Yohan D'Souza, Ahmed Elharram, Kevin Koster, Leon M. Tai, Mary Jo LaDu, Brian M. Bennett and Gregory R. J. Thatcher (2016) "A multifunctional therapeutic approach to disease modification in multiple familial mouse models and a novel sporadic model of Alzheimer's disease." Molecular Neurodegeneration 2016 11:35. Application: Tris-extracts of EFAD transgenic mouse brains. Weiguo Peng, Thiyagarajan M. Achariyar, Baoman Li, Yonghong Liao, Humberto Mestre, Emi Hitomi, Sean Regan, Tristan Kasper, Sisi Peng, Fengfei Ding, Helene Benveniste, Maiken Nedergaard, Rashid Dean (2016) "Suppression of glymphatic fluid transport in a mouse model of Alzheimer's disease." Neurobiology of Disease. Vol. 93, Pages 215-225 Application: TBSX-extracts of mouse cerebral cortex. Mafalda Cacciottolo, Amy Christensen, Alexandra Moser, Jiahui Liu, Christian J. Pike, Conor Smith, Mary Jo LaDu, Patrick M. Sullivan, Todd E. Morgan, Egor Dolzhenko, Andreas Charidimou, Lars-Olof Wahlund, Maria Kristofferson Wiberg, Sara Shams, Gloria Chia-Yi Chiang (2016) "The APOE4 allele shows opposite sex bias in microbleeds and Alzheimer's disease of humans and mice." Neurobiology of Aging. Volume 37, January 2016, Pages 47-57 Application: Tris-extracts of E3FAD and E4FAD transgenic mouse brains. Combes M, Poindron P, Callizot N.(2015) "Glutamate protects neuromuscular junctions from deleterious effects of ?-amyloid peptide and conversely: An in vitro study in a nerve-muscle coculture." J Neurosci. Res. 93(4):633-43 Application: Native Rat neurites & human muscle cell co-culture supernatants. Seo, Dong Han, et al. (2015) "Plasma-enabled sustainable elemental lifecycles: honeycomb-derived graphenes for next-generation biosensors and supercapacitors." Green Chem. 17:2164-2171. Application: Synthetic constructs. Tai, LM (2014) "Amyloid-_ Pathology and APOE Genotype Modulate Retinoid X Receptor Agonist Activity in vivo." J Biol Chem. 289(44):30538-55 Application: EFAD-Tg mice. Liu Y, Liu X, Hao W, Decker Y, Schomburg R, Fulop L, Pasparakis M, Menger MD, Fassbender K. (2014) "IKKbeta Deficiency in Myeloid Cells Ameliorates Alzheimer's Disease-Related Symptoms and Pathology." (2014) J Neurosci. Sep 24;34(39):12982-99 Application: Transgenic Mouse brain lysates, supernatants.
Specificity:
Human. MOAB-2 (mouse IgG2b) is a pan-specific, high-titer antibody to A? residues 1-4 and is highly specific just to amyloid beta peptide.The Biosensis o-A? Elisa detects A? oligomers as validated and described by Youmans KL et al (2012) and Rat by Combes M et al (2015). Rat.
The oligomeric form of Amyloid Beta peptide (A?, 1-42) has been closely linked to Alzheimer's Disease. Several ELISAs targeting A? have been developed; however, these ELISAs are known to cross-react with Amyloid Beta precursor protein (APP) and are poorly characterized against monomeric and oligomeric forms of the peptide. The Biosensis MOAB-2 antibody, developed by LaDu and co-workers (Youmans K. et al. , 2012) , has been shown to specifically detect A?, but not the precursor molecule APP. When utilized in ELISAs, the oligomeric form of A? peptide (o-A?) can be assayed independently of the other forms of the molecule when assayed with the MOAB-2 monoclonal antibody. The Biosensis oligomeric A? ELISA kit is a sandwich ELISA that allows the preferential quantification of oligomeric A? peptides. This kit is exclusive to Biosensis and consists of a pre-coated mouse monoclonal anti-A? capture antibody (MOAB-2), a biotinylated MOAB-2 detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product which is directly proportional to the concentration of o-A? present in samples and protein standards. The purpose of this kit is the in vitro qualitative measurement of oligomeric A? peptide levels in brain extracts and CSF samples from both transgenic mice and humans relative to a known o-A? standard. The inclusion of a highly validated oligomeric standard results in a unique, ready-to-use ELISA kit. This kit has been configured for research use only and is not to be used in diagnostic or clinical procedures.
Product Type:
ELISA Assay
Species Reactivity:
Human,Rat
Immunogen:
The standard in this ELISA is synthetically manufactured beta-amyloid peptide, amino acids 1-42 of human, HFIP treated and dried.The stabilized oligomeric beta amyloid 1-42 control complex is also constructed from the same synthetic peptide standard material. No animal systems were used for their manufacture.
Applications:
ELISA
Application Details:
ELISA. For the quantification of Oligomeric Amyloid-beta in CSF, Tissue Homogenates. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
The ELISA kit box contains 96-well pre-coated strip plate(s), protein standards, QC sample, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Kasus-Jacobi A et al. (2022) "Selecting Multitarget Peptides for Alzheimers Disease" Biomolecules. 12, 1386 Application: Human, A?142 oligomers. Eid A et al. (2022) "Effects of DDT on Amyloid Precursor Protein Levels and Amyloid Beta Pathology: Mechanistic Links to Alzheimer's Disease Risk" Environ Health Perspect. [Epub ahead of print] Application: Mouse, brain tissue homogenate. Kasus-Jacobi A et al. (2021) "Neutrophil Granule Proteins Inhibit Amyloid Beta Aggregation and Neurotoxicity." Curr Alzheimer Res. 18(5):414-427 Application: Mouse in-vitro assay, cell culture supernatant. Hark TJ et al. (2020) "Pulse-Chase Proteomics of the App Knockin Mouse Models of Alzheimer s Disease Reveals that Synaptic Dysfunction Originates in Presynaptic Terminals." Cell Syst. [Epub ahead of print] Application: Mouse cortical homogenates. Xiao L et al. (2020) "Enzyme-digested Colla Corii Asini (E'jiao) prevents hydrogen peroxide-induced cell death and accelerates amyloid beta clearance in neuronal-like PC12 cells." Neural Regen Res. 15(12): 2270-2 Application: Rat PC12 RIPA cell extract. Hrynchak MV et al. (2020) "Chronic Presence of Oligomeric A? Differentially Modulates Spine Parameters in the Hippocampus and Cortex of Mice With Low APP Transgene Expression." Front Synaptic Neurosci. Apr 24;12:16 Application: Mouse lysate. El-Sayed NA et al. (2019) "Design, synthesis, in vitro and in vivo evaluation of novel pyrrolizine-based compounds with potential activity as cholinesterase inhibitors and anti-Alzheimer's agents." Bioorg Chem. [Epub ahead of print] Application: Human. In-vitro screening of drug candidates. Oh Joo Kweon, Young Chul Youn, Yong Kwan Lim, Mi-Kyung Lee, Hye Ryoun Kim (2019) "Clinical utility of serum hepcidin and iron profile measurements in Alzheimer's disease." J Neurol Sci. [In press] Application: Human serum. Pacheco-Quinto J, Clausen D, Perez-Gonzalez R, Peng H, Meszaros A, Eckman CB, Levy E, Eckman EA (2018) "Intracellular metalloprotease activity controls intraneuronal A? aggregation and limits secretion of A? via exosomes." FASEB J. [Epub ahead of print] Application: Human cell line, mouse brain and organotypic brain slice cultures. Oh SB, Kim MS, Park S, Son H, Kim SY, Kim MS, Jo DG, Tak E, Lee JY (2018) "Clusterin contributes to early stage of Alzheimer's disease pathogenesis." Brain Pathol. [Epub ahead of print] Application: Transgenic mouse brain homogenates. S Liu, S Park, G Allington, F Prelli, Y Sun, M Marta-Ariza, H Scholtzova, G Biswas, B Brown, PB Verghese, PD Mehta, Y-U Kwon and T Wisniewski (2017) "Targeting Apolipoprotein E/Amyloid _ Binding by Peptoid CPO_A?17-21 P Ameliorates Alzheimer's Disease Related Pathology and Cognitive Decline." Sci Rep. 7(1):8009 Application: Transgenic mouse brain homogenates. M Cacciottolo, X Wang, I Driscoll, N Woodward, A Saffari, J Reyes, M L Serre, W Vizuete, C Sioutas, T E Morgan, M Gatz, H C Chui, S A Shumaker, S M Resnick, M A Espeland, C E Finch and J C Chen (2017) "Particulate air pollutants, APOE alleles and their contributions to cognitive impairment in older women and to amyloidogenesis in experimental models." Transl Psychiatry. Jan 31;7(1):e1022. Application: Extracts of E3FAD and E4FAD transgenic mouse brains. Riya Thomas, Paulina Zuchowska, Alan W. J. Morris, Felecia M. Marottoli, Sangeeta Sunny, Ryan Deaton, Peter H. Gann, Leon M. Tai (2016) "Epidermal growth factor prevents APOE4 and amyloid-beta-induced cognitive and cerebrovascular deficits in female mice." Acta Neuropathol Commun. 4(1):111 Application: Tris-extracts of EFAD transgenic mouse brains. Nor Faeizah Ibrahim, Daijiro Yanagisawa, Lina Wati Durani, Hamizah Shahirah Hamezah, Hanafi Ahmad Damanhuri, Wan Zurinah Wan Ngah, Mayumi Tsuji, Yuji Kiuchi, Kenjiro Ono, Ikuo Tooyama (2016) "Tocotrienol-Rich Fraction Modulates Amyloid Pathology and Improves Cognitive Function in A?PP/PS1 Mice." J Alzheimers Dis. [Epub ahead of print]. Application: Tris-extracts of mouse brain homogenates. Jia Luo, Sue H. Lee, Lawren VandeVrede, Zhihui Qin, Manel Ben Aissa, John Larson, Andrew F. Teich, Ottavio Arancio, Yohan D'Souza, Ahmed Elharram, Kevin Koster, Leon M. Tai, Mary Jo LaDu, Brian M. Bennett and Gregory R. J. Thatcher (2016) "A multifunctional therapeutic approach to disease modification in multiple familial mouse models and a novel sporadic model of Alzheimer's disease." Molecular Neurodegeneration 2016 11:35. Application: Tris-extracts of EFAD transgenic mouse brains. Weiguo Peng, Thiyagarajan M. Achariyar, Baoman Li, Yonghong Liao, Humberto Mestre, Emi Hitomi, Sean Regan, Tristan Kasper, Sisi Peng, Fengfei Ding, Helene Benveniste, Maiken Nedergaard, Rashid Dean (2016) "Suppression of glymphatic fluid transport in a mouse model of Alzheimer's disease." Neurobiology of Disease. Vol. 93, Pages 215-225 Application: TBSX-extracts of mouse cerebral cortex. Mafalda Cacciottolo, Amy Christensen, Alexandra Moser, Jiahui Liu, Christian J. Pike, Conor Smith, Mary Jo LaDu, Patrick M. Sullivan, Todd E. Morgan, Egor Dolzhenko, Andreas Charidimou, Lars-Olof Wahlund, Maria Kristofferson Wiberg, Sara Shams, Gloria Chia-Yi Chiang (2016) "The APOE4 allele shows opposite sex bias in microbleeds and Alzheimer's disease of humans and mice." Neurobiology of Aging. Volume 37, January 2016, Pages 47-57 Application: Tris-extracts of E3FAD and E4FAD transgenic mouse brains. Combes M, Poindron P, Callizot N.(2015) "Glutamate protects neuromuscular junctions from deleterious effects of ?-amyloid peptide and conversely: An in vitro study in a nerve-muscle coculture." J Neurosci. Res. 93(4):633-43 Application: Native Rat neurites & human muscle cell co-culture supernatants. Seo, Dong Han, et al. (2015) "Plasma-enabled sustainable elemental lifecycles: honeycomb-derived graphenes for next-generation biosensors and supercapacitors." Green Chem. 17:2164-2171. Application: Synthetic constructs. Tai, LM (2014) "Amyloid-_ Pathology and APOE Genotype Modulate Retinoid X Receptor Agonist Activity in vivo." J Biol Chem. 289(44):30538-55 Application: EFAD-Tg mice. Liu Y, Liu X, Hao W, Decker Y, Schomburg R, Fulop L, Pasparakis M, Menger MD, Fassbender K. (2014) "IKKbeta Deficiency in Myeloid Cells Ameliorates Alzheimer's Disease-Related Symptoms and Pathology." (2014) J Neurosci. Sep 24;34(39):12982-99 Application: Transgenic Mouse brain lysates, supernatants.
Specificity:
Human. MOAB-2 (mouse IgG2b) is a pan-specific, high-titer antibody to A? residues 1-4 and is highly specific just to amyloid beta peptide. The Biosensis o-A? Elisa detects A? oligomers as validated and described by Youmans KL et al (2012) and Rat by Combes M et al (2015). Rat.
The Biosensis Alpha-Synuclein Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the quantification of alpha-synuclein in less than 4 hours in human citrate-plasma, serum, CSF, as well as mouse and rat brain homogenates only if used as directed. Please refer to the kit protocol for specific use instructions for blood and CSF application. This ELISA kit consists of a pre-coated sheep polyclonal anti-alpha-synuclein (aa: 116-131) capture antibody, a biotinylated mouse monoclonal anti-alpha-synuclein detection antibody (aa: 61-95) and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product which is directly proportional to the concentration of alpha-synuclein present in samples and protein standards. A human alpha-synuclein positive control (QC sample) is provided to assure consistent assay performance. This ELISA kit has not been tested for other substrate applications, only citrate plasma and CSF, other substrates have not been tested and performance may vary. It has been configured for research use only and is not to be used for diagnostic or clinical procedures.
Background Info:
Alpha synuclein is an abundant 140 amino acid neuronal protein, expressed primarily at presynaptic terminals in the central nervous system. Alpha synuclein has been associated with several neurodegenerative diseases. A point mutation in the gene coding for the alpha-synuclein protein was the first discovery linking this protein to a rare familial form of Parkinson's disease (PD). Subsequently, other mutations in the alpha-synuclein gene have been identified in familial PD. The aggregated proteinaceous inclusions called Lewy bodies found in PD and cortical Lewy body dementia (LBD) were discovered to be predominantly alpha-synuclein. Aberrant aggregation of alpha-synuclein has been detected in an increasing number of neurodegenerative diseases, collectively known as synucleopathies. Alpha-synuclein exists physiologically in both soluble and membrane-bound states, in unstructured and alpha-helical conformations, respectively. The physiological function of alpha-synuclein appears to require its translocation between these subcellular compartments and interconversion between the 2 conformations. Abnormal processing of alpha-synuclein is predicted to lead to pathological changes in its binding properties and function.
Product Type:
ELISA Assay
Species Reactivity:
Human,Mouse,Rat
Immunogen:
The alpha-synuclein ELISA kit employs a recombinant human standard expressed in E.coli.
Applications:
ELISA
Application Details:
ELISA. For the quantification of alpha-synuclein in human serum, plasma (citrate), CSF, and mouse/rat tissue homogenates. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
Alternative Names:
Non-A beta component of AD amyloid; Non-A4 component of amyloid precursor; NACP; SNCA; PARK1;
Biosensis Brand:
Rapid
Detection Method:
Colorimetric
Shelf Life:
12 months from purchase.
Use:
For research use only.
Kit Components:
The ELISA kit box contains 96-well pre-coated strip plate, protein standards, QC sample, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Specificity:
Human, mouse and rat alpha-synuclein.
Storage:
Store at 2-8°C
Range:
0.16 - 10 ng/mL
Sample Type:
CSF,Plasma (Citrate),Serum,Tissue Homogenates
Sensitivity:
Typical limit of detection (LOD) for alpha-synuclein is < 100 pg/mL, determined as alpha-synuclein concentration at blank OD plus 3x standard deviation of blank OD (n=10).
Cross Reactivity:
Interference and cross-reactivity of human beta- and gamma-synuclein was assessed by spiking each protein at excess concentration of 20 ng/mL into two human plasma samples, each diluted 1:10 and 1:20, in comparison to unspiked samples. Cross-reactivity was calculated based on increase or decrease of apparent ?-synuclein concentrations in spiked samples. At a 3-6 fold excess (w/v) of spiked protein over endogenous alpha-synuclein at both sample dilutions, this ELISA shows very little cross-reactivity of 2.3% or less.<br>Individual alpha-synuclein isoforms have not yet been tested, but it is expected that this ELISA kit detects monomeric, oligomeric and phosphorylated alpha-synuclein isoforms.
The Biosensis Alpha-Synuclein Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the quantification of alpha-synuclein in less than 4 hours in human citrate-plasma, serum, CSF, as well as mouse and rat brain homogenates only if used as directed. Please refer to the kit protocol for specific use instructions for blood and CSF application. This ELISA kit consists of a pre-coated sheep polyclonal anti-alpha-synuclein (aa: 116-131) capture antibody, a biotinylated mouse monoclonal anti-alpha-synuclein detection antibody (aa: 61-95) and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product which is directly proportional to the concentration of alpha-synuclein present in samples and protein standards. A human alpha-synuclein positive control (QC sample) is provided to assure consistent assay performance. This ELISA kit has not been tested for other substrate applications, only citrate plasma and CSF, other substrates have not been tested and performance may vary. It has been configured for research use only and is not to be used for diagnostic or clinical procedures.
Background Info:
Alpha synuclein is an abundant 140 amino acid neuronal protein, expressed primarily at presynaptic terminals in the central nervous system. Alpha synuclein has been associated with several neurodegenerative diseases. A point mutation in the gene coding for the alpha-synuclein protein was the first discovery linking this protein to a rare familial form of Parkinson's disease (PD). Subsequently, other mutations in the alpha-synuclein gene have been identified in familial PD. The aggregated proteinaceous inclusions called Lewy bodies found in PD and cortical Lewy body dementia (LBD) were discovered to be predominantly alpha-synuclein. Aberrant aggregation of alpha-synuclein has been detected in an increasing number of neurodegenerative diseases, collectively known as synucleopathies. Alpha-synuclein exists physiologically in both soluble and membrane-bound states, in unstructured and alpha-helical conformations, respectively. The physiological function of alpha-synuclein appears to require its translocation between these subcellular compartments and interconversion between the 2 conformations. Abnormal processing of alpha-synuclein is predicted to lead to pathological changes in its binding properties and function.
Product Type:
ELISA Assay
Species Reactivity:
Human,Mouse,Rat
Immunogen:
The alpha-synuclein ELISA kit employs a recombinant human standard expressed in E.coli.
Applications:
ELISA
Application Details:
ELISA. For the quantification of alpha-synuclein in human serum, plasma (citrate), CSF, and mouse/rat tissue homogenates. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
Alternative Names:
Non-A beta component of AD amyloid; Non-A4 component of amyloid precursor; NACP; SNCA; PARK1;
Biosensis Brand:
Rapid
Detection Method:
Colorimetric
Shelf Life:
12 months from purchase.
Use:
For research use only.
Kit Components:
The ELISA kit box contains 96-well pre-coated strip plate, protein standards, QC sample, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Specificity:
Human, mouse and rat alpha-synuclein.
Storage:
Store at 2-8°C
Range:
0.16 - 10 ng/mL
Sample Type:
CSF,Plasma (Citrate),Serum,Tissue Homogenates
Sensitivity:
Typical limit of detection (LOD) for alpha-synuclein is < 100 pg/mL, determined as alpha-synuclein concentration at blank OD plus 3x standard deviation of blank OD (n=10).
Cross Reactivity:
Interference and cross-reactivity of human beta- and gamma-synuclein was assessed by spiking each protein at excess concentration of 20 ng/mL into two human plasma samples, each diluted 1:10 and 1:20, in comparison to unspiked samples. Cross-reactivity was calculated based on increase or decrease of apparent ?-synuclein concentrations in spiked samples. At a 3-6 fold excess (w/v) of spiked protein over endogenous alpha-synuclein at both sample dilutions, this ELISA shows very little cross-reactivity of 2.3% or less.<br>Individual alpha-synuclein isoforms have not yet been tested, but it is expected that this ELISA kit detects monomeric, oligomeric and phosphorylated alpha-synuclein isoforms.
The Biosensis proBDNF Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the specific, fast and reliable quantification of proBDNF in less than 4 hours in cell culture supernatants, cell lysates, serum, citrate-plasma and tissue extracts only if used as directed. Please refer to the kit protocol for specific use instructions for each substrate application, in particular human blood samples. This ELISA kit consists of a pre-coated polyclonal anti-proBDNF capture antibody, a biotinylated anti-matureBDNF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product which is directly proportional to the concentration of proBDNF present in samples and protein standards. A proBDNF positive control (QC sample) is provided to assure consistent assay performance. This proBDNF ELISA kit employs a recombinant, cleavage-resistant human proBDNF standard produced by Biosensis and validated against externally available proBDNF proteins. Due to a high degree of amino acid sequence homology, mouse and rat proBDNF can be quantified and expressed as human proBDNF equivalents. Internal Biosensis validation suggests that the use of the human standard provided in this kit will provide estimates that are identical, or close, to the actual levels of rat and mouse proBDNF present in rodent samples. Note that accurate proBDNF quantification in human serum and citrate-plasma requires the addition of Heterophilic Antibody Blocker BL-004-500 provided in the kit, and available for purchase separately . This ELISA kit has not been tested for other applications. It has been configured for research use only and is not to be used for diagnostic or clinical procedures.
Background Info:
BDNF belongs to the neurotrophin family and regulates the survival and differentiation of neurons during development. The alterations in BDNF expression induced by various kinds of brain insult including stress, ischemia, seizure activity and hypoglycemia, may contribute to some pathologies such as depression, epilepsy, Alzheimer's, and Parkinson's disease. FUNCTION: Promotes the survival of neuronal populations that are all located either in the central nervous system or directly connected to it. Major regulator of synaptic transmission and plasticity at adult synapses in many regions of the CNS. The versatility of BDNF is emphasized by its contribution to a range of adaptive neuronal responses including long-term potentiation (LTP), long-term depression (LTD), certain forms of short-term synaptic plasticity, as well as homeostatic regulation of intrinsic neuronal excitability. SUBUNIT: Monomers and homodimers. Binds to NTRK2/TRKB. SUBCELLULAR LOCATION: Secreted protein. Post Translation Modification (PTM): The propeptide is N-glycosylated and glycosulfated. PTM: Converted into mature BDNF by plasmin (PLG) (By similarity). DISEASE: Defects in BDNF are a cause of congenital central hypoventilation syndrome (CCHS); also known as congenital failure of autonomic control or Ondine curse. CCHS is a rare disorder characterized by abnormal control of respiration in the absence of neuromuscular or lung disease, or an identifiable brain stem lesion. A deficiency in autonomic control of respiration results in inadequate or negligible ventilatory and arousal responses to hypercapnia and hypoxemia. CCHS is frequently complicated with neurocristopathies such as Hirschsprung disease that occurs in about 16% of CCHS cases. SIMILARITY: Belongs to the NGF-beta family.
Product Type:
ELISA Assay
Species Reactivity:
Human,Mouse,Rat
Immunogen:
Recombinant human proBDNF, mutated to be cleavage-resistant, made in 293F cells
Applications:
ELISA
Application Details:
ELISA. For the quantification of Brain-derived neurotrophic factor, pro- (proBDNF) in Culture Supernatant, Cell Lysates, Serum, Plasma (Citrate), Tissue Homogenates. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
The ELISA kit box contains 96-well pre-coated strip plate, protein standards, QC sample, detection reagents, heterophilic antibody blocker, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Aldhshan MS & Mizuno TM. (2022) "Effect of environmental enrichment on aggression and the expression of brain-derived neurotrophic factor transcript variants in group-housed male mice." Behav Brain Res. [Epub ahead of print]. Application: Brain tissue homogenate. Dorandish S et al. (2021) "Differences in the Relative Abundance of ProBDNF and Mature BDNF in A549 and H1299 Human Lung Cancer Cell Media." Int J Mol Sci. 22(13):7059. Application: Human culture supernatant. Payne AJ (2020) "The Effects of Alcohol on BDNF and CD5 Dependent Pathways." PhD Thesis. Application: Mouse RIPA tissue homogenates. Companys-Alemany J et al. (2020) "A Novel NMDA Receptor Antagonist Protects against Cognitive Decline Presented by Senescent Mice." Pharmaceutics. 12(3), 284. Application: Mouse hippocampal homogenates. Duart-Castells L et al. (2019) "7,8-dihydroxyflavone blocks the development of behavioral sensitization to MDPV, but not to cocaine: differential role of the BDNF-TrkB pathway." Biochem Pharmacol. [Epub ahead of print]. Application: Mouse RIPA tissue homogenates. Osborne A, Wang AX, Tassoni A, Widdowson PS, Martin KR (2018) "Design of a Novel Gene Therapy Construct to Achieve Sustained Brain-Derived Neurotrophic Factor Signalling in Neurons." Hum Gene Ther. [Epub ahead of print]. Application: Human cell line supernatant. Rahman MS, Millischer V, Zeebari Z, Forsell Y, Lavebratt C (2017) "BDNF Val66Met and childhood adversity on response to physical exercise and internet-based cognitive behavioural therapy in depressed Swedish adults." J Psychiatr Res. 93:50-58. Application: Human serum. Riffault B, Kourdougli N, Dumon C, Ferrand N, Buhler E, Schaller F, Chambon C, Rivera C, Gaiarsa JL, Porcher C (2016) "Pro-Brain-Derived Neurotrophic Factor (proBDNF)-Mediated p75NTR Activation Promotes Depolarizing Actions of GABA and Increases Susceptibility to Epileptic Seizures". Cereb. Cortex [Epub ahead of print]. Application: Rat cortex and hippocampus RIPA extracts. Hashimoto T, Shiina A, Hasegawa T, Kimura H, Oda Y, Niitsu T, Ishikawa M, Tachibana M, Muneoka K, Matsuki S, Nakazato M, Iyo M (2016) "Effect of mirtazapine versus selective serotonin reuptake inhibitors on benzodiazepine use in patients with major depressive disorder: a pragmatic, multicenter, open-label, randomized, active-controlled, 24-week trial." Ann Gen Psychiatry. 15(27). Application: Human serum. Niimi M, Hashimoto K, Kakuda W, Miyano S, Momosaki R, Ishima T, Abo M. (2016) "Role of Brain-Derived Neurotrophic Factor in Beneficial Effects of Repetitive Transcranial Magnetic Stimulation for Upper Limb Hemiparesis after Stroke." PLoS One. 11(3):e0152241. Application: Human serum. Stary CM, Sun X, Giffard RG (2015) "Astrocytes Protect against Isoflurane Neurotoxicity by Buffering pro-brain-derived Neurotrophic Factor." Anesthesiology. 123(4):810-9. Application: Rat neuron and astrocyte cell culture supernatant. Riffault B, Medina I, Dumon C, Thalman C, Ferrand N, Friedel P, Gaiarsa JL, Porcher C. (2014) "Pro-Brain-Derived Neurotrophic Factor Inhibits GABAergic Neurotransmission by Activating Endocytosis and Repression of GABAA Receptors." J. Neurosci. 34(40):13516-34. Application: Rat hippocampal culture supernatant.
Typical limit of detection (LOD) for proBDNF is 10 pg/mL determined as 150% of the blank value.
Cross Reactivity:
A cross-reactivity of 2% in weight concentration (0.9% in molar concentration) has been observed for mature BDNF assayed at 25 ng/mL (893 pmol/L) in Assay Diluent A.<br>Due to a high degree of sequence homology, this human proBDNF ELISA kit cross-reacts with the mouse and rat form of proBDNF. Other species have not yet been tested, but cross-reactivity with a wide range of mammalian forms of proBDNF is expected.<br> The antibodies do not cross-react with nerve growth factor (NGF), neurotrophin-3 (NT-3) or NT-4/5.
The Biosensis proBDNF Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the specific, fast and reliable quantification of proBDNF in less than 4 hours in cell culture supernatants, cell lysates, serum, citrate-plasma and tissue extracts only if used as directed. Please refer to the kit protocol for specific use instructions for each substrate application, in particular human blood samples. This ELISA kit consists of a pre-coated polyclonal anti-proBDNF capture antibody, a biotinylated anti-matureBDNF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product which is directly proportional to the concentration of proBDNF present in samples and protein standards. A proBDNF positive control (QC sample) is provided to assure consistent assay performance. This proBDNF ELISA kit employs a recombinant, cleavage-resistant human proBDNF standard produced by Biosensis and validated against externally available proBDNF proteins. Due to a high degree of amino acid sequence homology, mouse and rat proBDNF can be quantified and expressed as human proBDNF equivalents. Internal Biosensis validation suggests that the use of the human standard provided in this kit will provide estimates that are identical, or close, to the actual levels of rat and mouse proBDNF present in rodent samples. Note that accurate proBDNF quantification in human serum and citrate-plasma requires the addition of Heterophilic Antibody Blocker BL-004-500 provided in the kit, and available for purchase separately . This ELISA kit has not been tested for other applications. It has been configured for research use only and is not to be used for diagnostic or clinical procedures.
Background Info:
BDNF belongs to the neurotrophin family and regulates the survival and differentiation of neurons during development. The alterations in BDNF expression induced by various kinds of brain insult including stress, ischemia, seizure activity and hypoglycemia, may contribute to some pathologies such as depression, epilepsy, Alzheimer's, and Parkinson's disease. FUNCTION: Promotes the survival of neuronal populations that are all located either in the central nervous system or directly connected to it. Major regulator of synaptic transmission and plasticity at adult synapses in many regions of the CNS. The versatility of BDNF is emphasized by its contribution to a range of adaptive neuronal responses including long-term potentiation (LTP), long-term depression (LTD), certain forms of short-term synaptic plasticity, as well as homeostatic regulation of intrinsic neuronal excitability. SUBUNIT: Monomers and homodimers. Binds to NTRK2/TRKB. SUBCELLULAR LOCATION: Secreted protein. Post Translation Modification (PTM): The propeptide is N-glycosylated and glycosulfated. PTM: Converted into mature BDNF by plasmin (PLG) (By similarity). DISEASE: Defects in BDNF are a cause of congenital central hypoventilation syndrome (CCHS); also known as congenital failure of autonomic control or Ondine curse. CCHS is a rare disorder characterized by abnormal control of respiration in the absence of neuromuscular or lung disease, or an identifiable brain stem lesion. A deficiency in autonomic control of respiration results in inadequate or negligible ventilatory and arousal responses to hypercapnia and hypoxemia. CCHS is frequently complicated with neurocristopathies such as Hirschsprung disease that occurs in about 16% of CCHS cases. SIMILARITY: Belongs to the NGF-beta family.
Product Type:
ELISA Assay
Species Reactivity:
Human,Mouse,Rat
Immunogen:
Recombinant human proBDNF, mutated to be cleavage-resistant, made in 293F cells
Applications:
ELISA
Application Details:
ELISA. For the quantification of Brain-derived neurotrophic factor, pro- (proBDNF) in Culture Supernatant, Cell Lysates, Serum, Plasma (Citrate), Tissue Homogenates. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
The ELISA kit box contains 96-well pre-coated strip plates, protein standards, QC sample, detection reagents, heterophilic antibody blocker, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Aldhshan MS & Mizuno TM. (2022) "Effect of environmental enrichment on aggression and the expression of brain-derived neurotrophic factor transcript variants in group-housed male mice." Behav Brain Res. [Epub ahead of print]. Application: Brain tissue homogenate. Dorandish S et al. (2021) "Differences in the Relative Abundance of ProBDNF and Mature BDNF in A549 and H1299 Human Lung Cancer Cell Media." Int J Mol Sci. 22(13):7059. Application: Human culture supernatant. Payne AJ (2020) "The Effects of Alcohol on BDNF and CD5 Dependent Pathways." PhD Thesis. Application: Mouse RIPA tissue homogenates. Companys-Alemany J et al. (2020) "A Novel NMDA Receptor Antagonist Protects against Cognitive Decline Presented by Senescent Mice." Pharmaceutics. 12(3), 284. Application: Mouse hippocampal homogenates. Duart-Castells L et al. (2019) "7,8-dihydroxyflavone blocks the development of behavioral sensitization to MDPV, but not to cocaine: differential role of the BDNF-TrkB pathway." Biochem Pharmacol. [Epub ahead of print]. Application: Mouse RIPA tissue homogenates. Osborne A, Wang AX, Tassoni A, Widdowson PS, Martin KR (2018) "Design of a Novel Gene Therapy Construct to Achieve Sustained Brain-Derived Neurotrophic Factor Signalling in Neurons." Hum Gene Ther. [Epub ahead of print]. Application: Human cell line supernatant. Rahman MS, Millischer V, Zeebari Z, Forsell Y, Lavebratt C (2017) "BDNF Val66Met and childhood adversity on response to physical exercise and internet-based cognitive behavioural therapy in depressed Swedish adults." J Psychiatr Res. 93:50-58. Application: Human serum. Riffault B, Kourdougli N, Dumon C, Ferrand N, Buhler E, Schaller F, Chambon C, Rivera C, Gaiarsa JL, Porcher C (2016) "Pro-Brain-Derived Neurotrophic Factor (proBDNF)-Mediated p75NTR Activation Promotes Depolarizing Actions of GABA and Increases Susceptibility to Epileptic Seizures". Cereb. Cortex [Epub ahead of print]. Application: Rat cortex and hippocampus RIPA extracts. Hashimoto T, Shiina A, Hasegawa T, Kimura H, Oda Y, Niitsu T, Ishikawa M, Tachibana M, Muneoka K, Matsuki S, Nakazato M, Iyo M (2016) "Effect of mirtazapine versus selective serotonin reuptake inhibitors on benzodiazepine use in patients with major depressive disorder: a pragmatic, multicenter, open-label, randomized, active-controlled, 24-week trial." Ann Gen Psychiatry. 15(27). Application: Human serum. Niimi M, Hashimoto K, Kakuda W, Miyano S, Momosaki R, Ishima T, Abo M. (2016) "Role of Brain-Derived Neurotrophic Factor in Beneficial Effects of Repetitive Transcranial Magnetic Stimulation for Upper Limb Hemiparesis after Stroke." PLoS One. 11(3):e0152241. Application: Human serum. Stary CM, Sun X, Giffard RG (2015) "Astrocytes Protect against Isoflurane Neurotoxicity by Buffering pro-brain-derived Neurotrophic Factor." Anesthesiology. 123(4):810-9. Application: Rat neuron and astrocyte cell culture supernatant. Riffault B, Medina I, Dumon C, Thalman C, Ferrand N, Friedel P, Gaiarsa JL, Porcher C. (2014) "Pro-Brain-Derived Neurotrophic Factor Inhibits GABAergic Neurotransmission by Activating Endocytosis and Repression of GABAA Receptors." J. Neurosci. 34(40):13516-34. Application: Rat hippocampal culture supernatant.
Typical limit of detection (LOD) for proBDNF is 10 pg/mL determined as 150% of the blank value.
Cross Reactivity:
A cross-reactivity of 2% in weight concentration (0.9% in molar concentration) has been observed for mature BDNF assayed at 25 ng/mL (893 pmol/L) in Assay Diluent A.<br>Due to a high degree of sequence homology, this human proBDNF ELISA kit cross-reacts with the mouse and rat form of proBDNF. Other species have not yet been tested, but cross-reactivity with a wide range of mammalian forms of proBDNF is expected.<br> The antibodies do not cross-react with nerve growth factor (NGF), neurotrophin-3 (NT-3) or NT-4/5.
The Biosensis Neurotrophin 4/5 Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the specific, fast and reliable quantification of NT4/5 in less than 4 hours in cell culture supernatants, human citrate-plasma and brain extracts only if used as directed. Please refer to the kit protocol for specific use instructions for each substrate application, in particular blood samples. Accurate quantification of NT4/5 in human citrate-plasma requires a heterophilic antibody (HA) blocker which can be purchased separately ( BL-003-1000 ). This ELISA kit consists of a pre-coated polyclonal anti-NT4/5 capture antibody, a biotinylated anti-NT4/5 detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product, which is directly proportional to the concentration of NT4/5 present in samples and protein standards. This NT4/5 ELISA kit employs a recombinant human NT4/5 standard. The capture and detection antibodies will also detect NT4/5 from other species due to a high degree of NT4/5 amino acid sequence homology. Therefore, this ELISA kit can be used to quantify NT4/5 in many species including mouse, rat and monkey. The antibodies used in this kit bind to epitopes within the mature domain of NT4/5. Thus, this ELISA kit will quantify the mature form of NT4/5, and may also detect the full-length pro-form of NT4/5. This ELISA kit has not been tested for other applications. It has been configured for research use only and is not to be used for diagnostic or clinical procedures.
Background Info:
FUNCTION: Target-derived survival factor for peripheral sensory sympathetic neurons. SUBCELLULAR LOCATION: Secreted protein. TISSUE SPECIFICITY: Highest levels in prostate, lower levels in thymus, placenta, and skeletal muscle. Expressed in embryonic and adult tissues. SIMILARITY: Belongs to the NGF-beta family.
Product Type:
ELISA Assay
Species Reactivity:
Human,Mouse,Primate,Rat
Immunogen:
Recombinant human NT4/5, made in E.coli
Applications:
ELISA
Application Details:
ELISA. For the quantification of Neurotrophin-4/5 (NT-4/5) in Culture Supernatant, Plasma (Citrate), Tissue Homogenates. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
The ELISA kit box contains 96-well pre-coated strip plate, protein standards, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
March B et al. (2021) ELISA-based quantification of neurotrophic growth factors in urine from prostate cancer patients. FASEB Bioadv. [Epub ahead of print]. Application: Human urine. Ishimoto T et al. (2018) Ergothioneine-induced neuronal differentiation is mediated through activation of S6K1 and neurotrophin 4/5-TrkB signaling in murine neural stem cells. Cell Signal. [Epub ahead of print]. Application: Mouse cell lysate and brain homogenate. Allen RS et al. (2018) TrkB signaling pathway mediates the protective effects of exercise in the diabetic rat retina. Eur J Neurosci. doi: 10.1111/ejn.13909. [Epub ahead of print]. Application: Rat retina homogenates. Maejima H et al. (2017) Exercise enhances cognitive function and neurotrophin expression in the hippocampus accompanied by changes in epigenetic programming in senescence-accelerated mice. Neurosci Lett. doi: 10.1016/j.neulet.2017.11.023. [Epub ahead of print]. Application: Mouse hippocampus homogenates. Takahashi K et al. (2016) Exercise combined with low-level GABAA receptor inhibition up-regulates the expression of neurotrophins in the motor cortex. Neurosci Lett. doi: 10.1016/j.neulet.2016.10.052. [Epub ahead of print]. Application: Mouse cortex homogenates, in native cell lysis buffer.
Specificity:
Human. The capture and detection antibodies will also detect NT4/5 from other species due to a high degree of NT4/5 amino acid sequence homology. Therefore, this ELISA kit can be used to quantify NT4/5 in many species including mouse, rat and monkey.
The Biosensis Neurotrophin 4/5 Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the specific, fast and reliable quantification of NT4/5 in less than 4 hours in cell culture supernatants, human citrate-plasma and brain extracts only if used as directed. Please refer to the kit protocol for specific use instructions for each substrate application, in particular blood samples. Accurate quantification of NT4/5 in human citrate-plasma requires a heterophilic antibody (HA) blocker which can be purchased separately ( BL-003-1000 ). This ELISA kit consists of a pre-coated polyclonal anti-NT4/5 capture antibody, a biotinylated anti-NT4/5 detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product, which is directly proportional to the concentration of NT4/5 present in samples and protein standards. This NT4/5 ELISA kit employs a recombinant human NT4/5 standard. The capture and detection antibodies will also detect NT4/5 from other species due to a high degree of NT4/5 amino acid sequence homology. Therefore, this ELISA kit can be used to quantify NT4/5 in many species including mouse, rat and monkey. The antibodies used in this kit bind to epitopes within the mature domain of NT4/5. Thus, this ELISA kit will quantify the mature form of NT4/5, and may also detect the full-length pro-form of NT4/5. This ELISA kit has not been tested for other applications. It has been configured for research use only and is not to be used for diagnostic or clinical procedures.
Background Info:
FUNCTION: Target-derived survival factor for peripheral sensory sympathetic neurons. SUBCELLULAR LOCATION: Secreted protein. TISSUE SPECIFICITY: Highest levels in prostate, lower levels in thymus, placenta, and skeletal muscle. Expressed in embryonic and adult tissues. SIMILARITY: Belongs to the NGF-beta family.
Product Type:
ELISA Assay
Species Reactivity:
Human,Mouse,Primate,Rat
Immunogen:
Recombinant human NT4/5, made in E.coli
Applications:
ELISA
Application Details:
ELISA. For the quantification of Neurotrophin-4/5 (NT-4/5) in Culture Supernatant, Plasma (Citrate), Tissue Homogenates. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
The ELISA kit box contains 96-well pre-coated strip plates, protein standards, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
March B et al. (2021) ELISA-based quantification of neurotrophic growth factors in urine from prostate cancer patients. FASEB Bioadv. [Epub ahead of print]. Application: Human urine. Ishimoto T et al. (2018) Ergothioneine-induced neuronal differentiation is mediated through activation of S6K1 and neurotrophin 4/5-TrkB signaling in murine neural stem cells. Cell Signal. [Epub ahead of print]. Application: Mouse cell lysate and brain homogenate. Allen RS et al. (2018) TrkB signaling pathway mediates the protective effects of exercise in the diabetic rat retina. Eur J Neurosci. doi: 10.1111/ejn.13909. [Epub ahead of print]. Application: Rat retina homogenates. Maejima H et al. (2017) Exercise enhances cognitive function and neurotrophin expression in the hippocampus accompanied by changes in epigenetic programming in senescence-accelerated mice. Neurosci Lett. doi: 10.1016/j.neulet.2017.11.023. [Epub ahead of print]. Application: Mouse hippocampus homogenates. Takahashi K et al. (2016) Exercise combined with low-level GABAA receptor inhibition up-regulates the expression of neurotrophins in the motor cortex. Neurosci Lett. doi: 10.1016/j.neulet.2016.10.052. [Epub ahead of print]. Application: Mouse cortex homogenates, in native cell lysis buffer.
Specificity:
Human. The capture and detection antibodies will also detect NT4/5 from other species due to a high degree of NT4/5 amino acid sequence homology. Therefore, this ELISA kit can be used to quantify NT4/5 in many species including mouse, rat and monkey.
The Biosensis NGFR/p75 ECD Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the quantification of mouse p75 ECD in less than 4 hours in cell culture supernatants and urine only if used as directed. Please refer to the kit protocol for specific use instructions for each substrate application. This ELISA kit consists of a pre-coated mouse monoclonal anti-p75 ECD capture antibody, a goat anti- p75 ECD detection antibody and a horseradish peroxidase (HRP)-conjugated anti-goat antibody. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product which is directly proportional to the concentration of p75 ECD present in samples and protein standards. This NGFR/p75 ECD ELISA kit employs a recombinant mouse p75 ECD -Fc chimera protein as standard. While there is a current lack of a true mouse p75 ECD standard, this ELISA kit allows quantification of mouse p75 ECD as p75 ECD -Fc mouse equivalents. Please note that the antibodies used in this ELISA cross-react with human NGFR/p75 ECD . This kit has not been tested for other applications. It has been configured for research use only and is not to be used in diagnostic or clinical procedures.
Background Info:
The nerve growth factor (NGF) receptor (NGFR), also known as p75 neurotrophin receptor (p75NTR; TNFRS16; CD271) is a common receptor for the neurotrophins NGF, BDNF, NT-3 and NT-4/5. In neurons, p75NTR mediates a variety of physiological functions including survival, apoptosis, neurite outgrowth and synaptic plasticity. A potential pathological role for p75NTR has become evident in recent years. Altered p75NTR expression levels are implicated in degeneration of spinal motor neurons in human and mouse models of amyotrophic lateral sclerosis (ALS). Importantly, the extracellular domain of p75NTR (p75ECD) is shed from the cell membrane and excreted in urine. Recent findings further suggest that p75ECD could be an early biomarker for ALS in humans, as significantly elevated p75ECD levels are found in urine of ALS patients as compared to healthy controls.
ELISA. For the quantification of Nerve growth factor receptor, extracellular domain (NGFR/p75ECD) in Culture Supernatant, Urine, Tissue Homogenates. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
The ELISA kit box contains 96-well pre-coated strip plate, protein standards, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Luu BE et al. (2022) Modulation of diabetic kidney disease markers by an antagonist of p75NTR in streptozotocin-treated mice Gene. [Epub ahead of print]. Application: Mouse plasma. Zabbarova IV et al. (2018) Targeting p75 neurotrophin receptors ameliorates spinal cord injury-induced detrusor sphincter dyssynergia in mice. Neurourol Urodyn. 2018 May 28 [Epub ahead of print]. Application: Mouse urine. Maejima H et al. (2017) Exercise enhances cognitive function and neurotrophin expression in the hippocampus accompanied by changes in epigenetic programming in senescence-accelerated mice. Neurosci Lett. doi: 10.1016/j.neulet.2017.11.023. [Epub ahead of print]. Application: Mouse hippocampus homogenates.
Specificity:
Mouse. The antibodies used in this ELISA kit are known to cross-react with human p75ECD protein.
Storage:
Store at 2-8°C.
Range:
62.5 - 4,000 pg/mL
Sample Type:
Culture Supernatant,Tissue Homogenates,Urine
Sensitivity:
This ELISA kit typically detects 20-40 pg/mL of mouse p75ECD (defined as blank OD plus 3x the standard deviation of the blank OD, n=10).
The Biosensis NGFR/p75 ECD Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the quantification of mouse p75 ECD in less than 4 hours in cell culture supernatants and urine only if used as directed. Please refer to the kit protocol for specific use instructions for each substrate application. This ELISA kit consists of a pre-coated mouse monoclonal anti-p75 ECD capture antibody, a goat anti- p75 ECD detection antibody and a horseradish peroxidase (HRP)-conjugated anti-goat antibody. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product which is directly proportional to the concentration of p75ECD present in samples and protein standards. This NGFR/p75 ECD ELISA kit employs a recombinant mouse p75 ECD -Fc chimera protein as standard. While there is a current lack of a true mouse p75 ECD standard, this ELISA kit allows quantification of mouse p75 ECD as p75 ECD -Fc mouse equivalents. Please note that the antibodies used in this ELISA cross-react with human NGFR/p75 ECD . This kit has not been tested for other applications. It has been configured for research use only and is not to be used in diagnostic or clinical procedures.
Background Info:
The nerve growth factor (NGF) receptor (NGFR), also known as p75 neurotrophin receptor (p75NTR; TNFRS16; CD271) is a common receptor for the neurotrophins NGF, BDNF, NT-3 and NT-4/5. In neurons, p75NTR mediates a variety of physiological functions including survival, apoptosis, neurite outgrowth and synaptic plasticity. A potential pathological role for p75NTR has become evident in recent years. Altered p75NTR expression levels are implicated in degeneration of spinal motor neurons in human and mouse models of amyotrophic lateral sclerosis (ALS). Importantly, the extracellular domain of p75NTR (p75ECD) is shed from the cell membrane and excreted in urine. Recent findings further suggest that p75ECD could be an early biomarker for ALS in humans, as significantly elevated p75ECD levels are found in urine of ALS patients as compared to healthy controls.
ELISA. For the quantification of Nerve growth factor receptor, extracellular domain (NGFR/p75ECD) in Culture Supernatant, Urine, Tissue Homogenates. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
The ELISA kit box contains 96-well pre-coated strip plates, protein standards, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Luu BE et al. (2022) Modulation of diabetic kidney disease markers by an antagonist of p75NTR in streptozotocin-treated mice Gene. [Epub ahead of print]. Application: Mouse plasma. Zabbarova IV et al. (2018) Targeting p75 neurotrophin receptors ameliorates spinal cord injury-induced detrusor sphincter dyssynergia in mice. Neurourol Urodyn. 2018 May 28 [Epub ahead of print]. Application: Mouse urine. Maejima H et al. (2017) Exercise enhances cognitive function and neurotrophin expression in the hippocampus accompanied by changes in epigenetic programming in senescence-accelerated mice. Neurosci Lett. doi: 10.1016/j.neulet.2017.11.023. [Epub ahead of print]. Application: Mouse hippocampus homogenates.
Specificity:
Mouse. The antibodies used in this ELISA kit are known to cross-react with human p75ECD protein.
Storage:
Store at 2-8°C.
Range:
62.5 - 4,000 pg/mL
Sample Type:
Culture Supernatant,Tissue Homogenates,Urine
Sensitivity:
This ELISA kit typically detects 20-40 pg/mL of mouse p75ECD (defined as blank OD plus 3x the standard deviation of the blank OD, n=10).
The Biosensis NT3 Rapid TM enzyme-linked immune-sorbent assay (ELISA) Kit is a sandwich ELISA that allows the specific, fast and reliable quantification of NT3 in less than 4 hours in cell culture supernatants and human plasma (EDTA and citrate) only if used as directed. Please refer to the kit protocol for specific use instructions for each substrate application, in particular human plasma. Accurate quantification of NT3 in human plasma requires a heterophilic antibody (HA) blocker which can be purchased separately ( BL-004-500 ). This ELISA kit consists of a pre-coated polyclonal anti-NT3 capture antibody, a biotinylated monoclonal anti-NT3 detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product, which is directly proportional to the concentration of NT3 present in samples and protein standards. This NT3 Rapid TM ELISA kit employs a recombinant human NT3 standard. NT3 is highly conserved and nearly identical in many species. The assay's capture and detection antibodies detect NT3 from other species including mouse, rat and monkey, thus it is expected that this NT3 Rapid TM ELISA will also react with those species and possibly more because of the conversation of the immunogen used. The antibodies used in this kit bind to epitopes within the mature domain of NT3. Thus, this ELISA kit may detect the full-length pro-form of NT3. This kit has not been tested for other applications. Sufficient amount of NT3 standard is supplied to allow for spike- and recovery experiments in order to validate this ELISA assay for other sample matrices if required. This kit has been configured for research use only and is not to be used in diagnostic or clinical procedures.
Background Info:
NT3 is understood to be important in promote the survival of visceral and proprioceptive sensory neurons. It is a secreted protein that belongs to the NGF-beta family and is found in brain and peripheral tissues.
Product Type:
ELISA Assay
Species Reactivity:
Human,Mouse,Rat
Immunogen:
Human recombinant NT3, made in E.coli
Applications:
ELISA
Application Details:
ELISA. For the quantification of Neurotrophin-3 (NT-3) in Culture Supernatant, Plasma (Citrate), Plasma (EDTA). Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
The ELISA kit box contains 96-well pre-coated strip plate, protein standards, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Possamai-Della T et al. (2022) Imipramine Can Be Effective on Depressive-Like Behaviors, but Not on Neurotrophic Factor Levels in an Animal Model for Bipolar Disorder Induced by Ouabain Mol Neurobiol. [Epub ahead of print] Application: Rat, brain tissue homogenate. March B et al. (2021) ELISA-based quantification of neurotrophic growth factors in urine from prostate cancer patients. FASEB Bioadv. [Epub ahead of print]. Application: Human urine. Bavaresco DV et al. (2018) Depressive symptoms and neurotrophin levels in ostomy patients. J Bras Psiquiatr. 67(3). Application: Human serum. Shen W et al. (2017) Effects of Ranibizumab and Aflibercept on Human Mueller Cells and Photoreceptors under Stress Conditions. Int J Mol Sci. 2017 Mar 1;18(3). pii: E533. doi: 10.3390/ijms18030533. Application: Human cell line supernatants.
Specificity:
Human. The capture and detection antibodies used detect NT3 from other species including mouse, rat and monkey, thus it is expected that this NT3 Rapid ELISA will also react with those species.
The Biosensis NT3 Rapid TM enzyme-linked immune-sorbent assay (ELISA) Kit is a sandwich ELISA that allows the specific, fast and reliable quantification of NT3 in less than 4 hours in cell culture supernatants and human plasma (EDTA and citrate) only if used as directed. Please refer to the kit protocol for specific use instructions for each substrate application, in particular human plasma. Accurate quantification of NT3 in human plasma requires a heterophilic antibody (HA) blocker which can be purchased separately ( BL-004-500 ). This ELISA kit consists of a pre-coated polyclonal anti-NT3 capture antibody, a biotinylated monoclonal anti-NT3 detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product, which is directly proportional to the concentration of NT3 present in samples and protein standards. This NT3 Rapid TM ELISA kit employs a recombinant human NT3 standard. NT3 is highly conserved and nearly identical in many species. The assay's capture and detection antibodies detect NT3 from other species including mouse, rat and monkey, thus it is expected that this NT3 Rapid TM ELISA will also react with those species and possibly more because of the conversation of the immunogen used. The antibodies used in this kit bind to epitopes within the mature domain of NT3. Thus, this ELISA kit may detect the full-length pro-form of NT3. This kit has not been tested for other applications. Sufficient amount of NT3 standard is supplied to allow for spike- and recovery experiments in order to validate this ELISA assay for other sample matrices if required. This kit has been configured for research use only and is not to be used in diagnostic or clinical procedures.
Background Info:
NT3 is understood to be important in promote the survival of visceral and proprioceptive sensory neurons. It is a secreted protein that belongs to the NGF-beta family and is found in brain and peripheral tissues.
Product Type:
ELISA Assay
Species Reactivity:
Human,Mouse,Rat
Immunogen:
Human recombinant NT3, made in E.coli
Applications:
ELISA
Application Details:
ELISA. For the quantification of Neurotrophin-3 (NT-3) in Culture Supernatant, Plasma (Citrate), Plasma (EDTA). Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
The ELISA kit box contains 96-well pre-coated strip plates, protein standards, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Possamai-Della T et al. (2022) Imipramine Can Be Effective on Depressive-Like Behaviors, but Not on Neurotrophic Factor Levels in an Animal Model for Bipolar Disorder Induced by Ouabain Mol Neurobiol. [Epub ahead of print] Application: Rat, brain tissue homogenate. March B et al. (2021) ELISA-based quantification of neurotrophic growth factors in urine from prostate cancer patients. FASEB Bioadv. [Epub ahead of print]. Application: Human urine. Bavaresco DV et al. (2018) Depressive symptoms and neurotrophin levels in ostomy patients. J Bras Psiquiatr. 67(3). Application: Human serum. Shen W et al. (2017) Effects of Ranibizumab and Aflibercept on Human Mueller Cells and Photoreceptors under Stress Conditions. Int J Mol Sci. 2017 Mar 1;18(3). pii: E533. doi: 10.3390/ijms18030533. Application: Human cell line supernatants.
Specificity:
Human. The capture and detection antibodies used detect NT3 from other species including mouse, rat and monkey, thus it is expected that this NT3 ELISA will also react with those species.
The Biosensis GDNF Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the quantification of GDNF in less than 4 hours in cell culture supernatants, cell lysates, and guinea pig serum only if used as directed. Please refer to the kit protocol for specific use instructions for each substrate application. This ELISA kit consists of a pre-coated anti-GDNF capture antibody, a biotinylated anti-GDNF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product which is directly proportional to the concentration of GDNF present in samples and protein standards. This GDNF ELISA kit employs a recombinant human GDNF standard obtained from the National Institute for Biological Standards and Control (NIBSC) and is therefore designed to accurately measure the human form of GDNF. Note that the antibodies used in this kit cross-react with guinea pig, rat and mouse GDNF. Guinea pig GDNF has been quantified in serum using the Human GDNF Rapid TM ELISA kit, since guinea pig GDNF protein shares closest amino acid sequence homology with human GDNF. Protein levels can be expressed as human GDNF equivalents. This kit has not been tested for other applications. It has been configured for research use only and is not to be used in diagnostic or clinical procedures.
Background Info:
GDNF is a glycosylated, disulfide-bonded homodimer molecule. It was first discovered as a potent survival factor for midbrain dopaminergic neurons and was then shown to rescue these neurons in animal models of Parkinson's disease. GDNF is about 100 times more efficient survival factor for spinal motor neurons than the neurotrophins. FUNCTION: Neurotrophic factor that enhances survival and morphological differentiation of dopaminergic neurons and increases their high-affinity dopamine uptake. SUBUNIT: Homodimer; disulfide-linked. SUBCELLULAR LOCATION: Secreted protein. ALTERNATIVE PRODUCTS: 2 named isoforms produced by alternative splicing. DISEASE: Defects in GDNF may be a cause of Hirschsprung disease (HSCR). In association with mutations of RET gene, defects in GDNF may be involved in Hirschsprung disease. This genetic disorder of neural crest development is characterized by the absence of intramural ganglion cells in the hindgut, often resulting in intestinal obstruction. DISEASE: Defects in GDNF are a cause of congenital central hypoventilation syndrome (CCHS); also known as congenital failure of autonomic control or Ondine curse. CCHS is a rare disorder characterized by abnormal control of respiration in the absence of neuromuscular or lung disease, or an identifiable brain stem lesion. A deficiency in autonomic control of respiration results in inadequate or negligible ventilatory and arousal responses to hypercapnia and hypoxemia. SIMILARITY: Belongs to the TGF-beta family. GDNF subfamily.
Product Type:
ELISA Assay
Species Reactivity:
Human
Immunogen:
Human recombinant GDNF with N-terminal methionine residue.
Applications:
ELISA
Application Details:
ELISA. For the quantification of Glial cell line-derived neurotrophic factor (GDNF) in Culture Supernatant, Cell Lysates, Serum. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
The ELISA kit box contains 96-well pre-coated strip plate, protein standards, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Chen S et al. (2022) Newly Generated 3D Schwann-Like Cell Spheroids From Human Adipose-Derived Stem Cells Using a Modified Protocol. Cell Transplant. 31:9636897221093312. Application: Human cell culture supernatant. March B et al. (2021) ELISA-based quantification of neurotrophic growth factors in urine from prostate cancer patients. FASEB Bioadv. [Epub ahead of print]. Application: Human urine. Widbiller M et al. (2019) Neurotrophic Proteins in Dentin and Their Effect on Trigeminal Sensory Neurons. J Endod. [Epub ahead of print]. Application: Human tooth homogenate.
Specificity:
Human. The antibodies used in this kit detect guinea pig, mouse and rat GDNF. No cross-reactivity was observed for the following proteins tested at 25 ng/mL in assay buffer: brain-derived neurotrophic factor (rhBDNF), nerve growth factor (rhNGF), neurotrophin-3 (rhNT-3), rhNT-4/5, vascular endothelial growth factor (rhVEGF), recombinant human Neurturin, Artemin and Persephin.
Storage:
Store at 2-8°C.
Range:
7.8 - 500 pg/mL
Sample Type:
Cell Lysates,Culture Supernatant,Serum
Sensitivity:
Typical limit of detection (LOD) for rhGDNF is <5 pg/mL determined as blank value plus 3x standard deviation of blank OD (n=10).
Cross Reactivity:
No cross-reactivity was observed for the following proteins tested at 25 ng/mL in assay buffer: brain-derived neurotrophic factor (rhBDNF), nerve growth factor (rhNGF), neurotrophin-3 (rhNT-3), rhNT-4/5, vascular endothelial growth factor (rhVEGF), recombinant human Neurturin, Artemin and Persephin.
The Biosensis GDNF Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the quantification of GDNF in less than 4 hours in cell culture supernatants, cell lysates, and guinea pig serum only if used as directed. Please refer to the kit protocol for specific use instructions for each substrate application. This ELISA kit consists of a pre-coated anti-GDNF capture antibody, a biotinylated anti-GDNF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product which is directly proportional to the concentration of GDNF present in samples and protein standards. This GDNF ELISA kit employs a recombinant human GDNF standard obtained from the National Institute for Biological Standards and Control (NIBSC) and is therefore designed to accurately measure the human form of GDNF. Note that the antibodies used in this kit cross-react with guinea pig, rat and mouse GDNF. Guinea pig GDNF has been quantified in serum using the Human GDNF Rapid TM ELISA kit, since guinea pig GDNF protein shares closest amino acid sequence homology with human GDNF. Protein levels can be expressed as human GDNF equivalents. This kit has not been tested for other applications. It has been configured for research use only and is not to be used in diagnostic or clinical procedures.
Background Info:
GDNF is a glycosylated, disulfide-bonded homodimer molecule. It was first discovered as a potent survival factor for midbrain dopaminergic neurons and was then shown to rescue these neurons in animal models of Parkinson's disease. GDNF is about 100 times more efficient survival factor for spinal motor neurons than the neurotrophins. FUNCTION: Neurotrophic factor that enhances survival and morphological differentiation of dopaminergic neurons and increases their high-affinity dopamine uptake. SUBUNIT: Homodimer; disulfide-linked. SUBCELLULAR LOCATION: Secreted protein. ALTERNATIVE PRODUCTS: 2 named isoforms produced by alternative splicing. DISEASE: Defects in GDNF may be a cause of Hirschsprung disease (HSCR). In association with mutations of RET gene, defects in GDNF may be involved in Hirschsprung disease. This genetic disorder of neural crest development is characterized by the absence of intramural ganglion cells in the hindgut, often resulting in intestinal obstruction. DISEASE: Defects in GDNF are a cause of congenital central hypoventilation syndrome (CCHS); also known as congenital failure of autonomic control or Ondine curse. CCHS is a rare disorder characterized by abnormal control of respiration in the absence of neuromuscular or lung disease, or an identifiable brain stem lesion. A deficiency in autonomic control of respiration results in inadequate or negligible ventilatory and arousal responses to hypercapnia and hypoxemia. SIMILARITY: Belongs to the TGF-beta family. GDNF subfamily.
Product Type:
ELISA Assay
Species Reactivity:
Human
Immunogen:
Human recombinant GDNF with N-terminal methionine residue.
Applications:
ELISA
Application Details:
ELISA. For the quantification of Glial cell line-derived neurotrophic factor (GDNF) in Culture Supernatant, Cell Lysates, Serum. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
The ELISA kit box contains 96-well pre-coated strip plates, protein standards, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Chen S et al. (2022) Newly Generated 3D Schwann-Like Cell Spheroids From Human Adipose-Derived Stem Cells Using a Modified Protocol. Cell Transplant. 31:9636897221093312. Application: Human cell culture supernatant. March B et al. (2021) ELISA-based quantification of neurotrophic growth factors in urine from prostate cancer patients. FASEB Bioadv. [Epub ahead of print]. Application: Human urine. Widbiller M et al. (2019) Neurotrophic Proteins in Dentin and Their Effect on Trigeminal Sensory Neurons. J Endod. [Epub ahead of print]. Application: Human tooth homogenate.
Specificity:
Human. The antibodies used in this kit detect guinea pig, mouse and rat GDNF. No cross-reactivity was observed for the following proteins tested at 25 ng/mL in assay buffer: brain-derived neurotrophic factor (rhBDNF), nerve growth factor (rhNGF), neurotrophin-3 (rhNT-3), rhNT-4/5, vascular endothelial growth factor (rhVEGF), recombinant human Neurturin, Artemin and Persephin.
Storage:
Store at 2-8°C.
Range:
7.8 - 500 pg/mL
Sample Type:
Cell Lysates,Culture Supernatant,Serum
Sensitivity:
Typical limit of detection (LOD) for rhGDNF is <5 pg/mL determined as blank value plus 3x standard deviation of blank OD (n=10).
Cross Reactivity:
No cross-reactivity was observed for the following proteins tested at 25 ng/mL in assay buffer: brain-derived neurotrophic factor (rhBDNF), nerve growth factor (rhNGF), neurotrophin-3 (rhNT-3), rhNT-4/5, vascular endothelial growth factor (rhVEGF), recombinant human Neurturin, Artemin and Persephin.
The Biosensis Human Mature NGF/proNGF Combo Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit combines individual, but complementary ELISA kits for the two most important NGF isoforms: Mature NGF (BEK-2212) and full-length proNGF (BEK-2226). Both kits are sandwich ELISAs, useful for the quantification of mature NGF and proNGF in less than 4 hours in cell culture supernatants, serum, and plasma (citrate) only if used as directed, with a simplified protocol and no loss of sensitivity or specificity. Researchers have used both kits for NGF/proNGF measurement in human urine, however, Biosensis has not yet internally validated the use of urine in both ELISA kits. End-users are strongly advised to perform essential validation experiments to assure accurate NGF/proNGF quantification in human urine. Please refer to the most current kit protocols for BEK-2212 (Mature BDNF Rapid TM ELISA) and BEK-2226 (proNGF Rapid TM ELISA), for specific use instructions for each substrate application, in particular blood samples. The Mature NGF ELISA kit consists of a pre-coated mouse monoclonal anti-NGF capture antibody, a biotinylated anti-NGF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The proNGF ELISA kit consists of a pre-coated anti-proNGF capture antibody, a biotinylated anti-proNGF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a coloured reaction product which is directly proportional to the concentration of mature NGF or proNGF present in samples and protein standards. A NGF and proNGF positive control (QC sample) is provided to assure consistent assay performance. The Mature NGF ELISA kit employs a high-quality recombinant human NGF standard approved by the World Health Organization (WHO). The proNGF ELISA kit contains a recombinant human proNGF standard expressed in E.coli. Note that this Mature NGF/proNGF Combo kit is designed to measure the human protein forms, although due to sequence homology the Mature NGF ELISA kit will detect mouse and rat mature NGF. The proNGF ELISA kit does not cross-react with rodent forms of proNGF. This Combo kit is capable of distinguishing and independently quantifying the mature NGF and full-length NGF isoforms. Internal validation data demonstrates Mossa AH et al. (2020) . The antibodies used in the proNGF ELISA kit bind epitopes within the pro-domain of the protein and therefore recognize proNGF and the pro-domain peptide, but do not cross-react with mature NGF! Important: Accurate NGF quantification in human citrate-plasma requires the addition of Heterophilic Antibody Blocker BL-005-500 . Accurate proNGF quantification in human serum requires the addition of Heterophilic Antibody Blocker BL-003-1000 . Both Heterophilic Antibody Blockers are provided in the kit. This ELISA kit has not been tested for other applications. It has been configured for research use only and is not to be used for diagnostic or clinical procedures.
Background Info:
Nerve growth factor (NGF) is synthesized as a precursor (proNGF) which may be released and have physiological functions to cause cell death. It binds neurotrophin receptor p75 and sortilin and may also be important for the development of nervous system. proNGF is synthesized in target tissues and glia, transported retrogradely and may be released.
Product Type:
ELISA Assay
Species Reactivity:
Human
Immunogen:
See BEK-2212 & BEK-2226 for specific details
Applications:
ELISA
Application Details:
ELISA. For the quantification of Mature NGF and proNGF in Culture Supernatant, Serum, Plasma (Citrate). Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
The ELISA kit box contains 2 x 96-well pre-coated strip plates per kit (1 x NGF antibody, 1 x proNGF antibody coated plate), protein standards, QC sample, detection reagents, heterophilic antibody blocker, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Please refer to BEK-2212 (Human Mature NGF Rapid TM ELISA Kit) and BEK-2226 (Human proNGF Rapid TM ELISA Kit) .
Specificity:
Mature NGF ELISA: Detects human NGF, and cross-reacts with mouse and rat mature NGF. This mature NGF ELISA preferentially detects mature NGF over full-length proNGF. proNGF ELISA: Detects human proNGF only, does not cross-react with mouse and rat proNGF. Both capture and detection antibodies used in the proNGF ELISA kit binds to epitopes within the pro-domain of proNGF. Thus, the proNGF ELISA detects the full-length form of proNGF, and does not quantify mature NGF.
Typical limit of detection (LOD) for human mature NGF is 2 pg/mL determined as 150% of the blank value. Typical limit of detection (LOD) for human proNGF is < 60 pg/mL, determined as blank value plus 3x standard deviation of blank OD (n=10).
Cross Reactivity:
<b>Cross-reactivity of NGF isoforms:</b><br><br><b>Mature NGF ELISA:</b><br>The antibodies used in the Mature NGF ELISA kit bind epitopes within the mature domain of the protein. However, human proNGF protein shows <0.1% cross-reactivity (determined at 25 ng/mL, diluted in assay buffer), demonstrating the preferential quantification of mature NGF over full-length human proNGF. The absence of proNGF cross-reactivity in the mature NGF ELISA kit has been independently confirmed by <a class="newA" target="_blank" href="https://pubmed.ncbi.nlm.nih.gov/32870355/">Mossa AH <i>et al.</I> (2020)</a>. The Mature NGF ELISA does not cross-react with brain derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3), NT-4/5, glial cell line-derived neurotrophic factor (GDNF) and vascular endothelial growth factor (VEGF165) tested at 25 ng/mL. Due to a high degree of NGF sequence homology, the antibodies used in this kit will also detect mature NGF from numerous other species including mouse and rat!<br><br><b>proNGF ELISA:</b><br>Does not cross-react with recombinant human mature NGF and proBDNF tested at 25 ng/mL. Does not react with rodent proNGF.
Biosensis is proud to offer the first commercially available ApoE/?-amyloid (ApoE/A?) complex ELISA kit. As a result of extensive collaboration with Dr. LaDu's laboratory at UIC and validation by Biosensis, this ELISA can be used to accurately and consistently measure the extent of ApoE/A? complex in tissue extracts and other samples. The Biosensis ApoE/A? Complex ELISA kit is a sandwich ELISA and consists of a pre-coated mouse monoclonal anti-A? capture antibody, a highly validated ApoE/A? complex standard that is pre-formed, lyophilized and ready for reconstitution, a biotinylated ApoE detection antibody, and horseradish peroxidase (HRP)-conjugated streptavidin and detection reagent. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product which is directly proportional to the level of ApoE/A? complex present in samples and protein standards. Importantly, a well-characterized and unique ApoE/A? complex is included as a standard. This complex is pre-formed and lyophilized, requiring only reconstitution with assay diluent prior to use. In order to assess non-specific ApoE protein binding, each kit includes additional plates pre-coated with control antibody. The purpose of this kit is the in vitro qualitative measurement of ApoE/A? complexes in brain extracts and CSF samples from both transgenic mice and humans or primates, relative to a known ApoE/A? complex standard, only if used as directed. This kit has not been tested for other sample applications. This kit has been configured for research use only and is not to be used in diagnostic or clinical procedures.
Product Type:
ELISA Assay
Species Reactivity:
Human
Immunogen:
Complex of E.coli-derived recombinant human ApoE protein and synthetic, monomerized Abeta (1-42) peptide
Applications:
ELISA
Application Details:
ELISA. For the quantification of Apolipoprotein E/beta-Amyloid Complex (ApoE/A beta) in CSF, Tissue Homogenates. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
The ELISA kit box contains 2 x 96-well pre-coated strip plates per 1 Plate Kit (1 plate MOAB-2 antibody coated, 1 plate control antibody coated), protein standards, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Tai LM et al. (2013) J Biol Chem. 288(8): 5914-26 Tai LM et al. (2014) Mol Neurodegen. 9:2
Specificity:
Human Apolipoprotein E/beta-Amyloid (ApoE/A beta) Complex. The kit has been assayed on human samples only but the capture antibody, MOAB-2, is know to react with rodent amyloid beta though weaker (20% less reactivity on dot blots). The polyclonal APOE used for detection should detect ApoE from a variety of species but so far has only been tested on human
Biosensis is proud to offer the first commercially available ApoE/?-amyloid (ApoE/A?) complex ELISA kit. As a result of extensive collaboration with Dr. LaDu's laboratory at UIC and validation by Biosensis, this ELISA can be used to accurately and consistently measure the extent of ApoE/A? complex in tissue extracts and other samples. The Biosensis ApoE/A? Complex ELISA kit is a sandwich ELISA and consists of a pre-coated mouse monoclonal anti-A? capture antibody, a highly validated ApoE/A? complex standard that is pre-formed, lyophilized and ready for reconstitution, a biotinylated ApoE detection antibody, and horseradish peroxidase (HRP)-conjugated streptavidin and detection reagent. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product which is directly proportional to the level of ApoE/A? complex present in samples and protein standards. Importantly, a well-characterized and unique ApoE/A? complex is included as a standard. This complex is pre-formed and lyophilized, requiring only reconstitution with assay diluent prior to use. In order to assess non-specific ApoE protein binding, each kit includes additional plates pre-coated with control antibody. The purpose of this kit is the in vitro qualitative measurement of ApoE/A? complexes in brain extracts and CSF samples from both transgenic mice and humans or primates, relative to a known ApoE/A? complex standard, only if used as directed. This kit has not been tested for other sample applications. This kit has been configured for research use only and is not to be used in diagnostic or clinical procedures.
Product Type:
ELISA Assay
Species Reactivity:
Human
Immunogen:
Complex of E.coli-derived recombinant human ApoE protein and synthetic, monomerized Abeta (1-42) peptide
Applications:
ELISA
Application Details:
ELISA. For the quantification of Apolipoprotein E/beta-Amyloid Complex (ApoE/A beta) in CSF, Tissue Homogenates. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
The ELISA kit box contains 2 x 96-well pre-coated strip plates per 1 Plate Kit (1 plate MOAB-2 antibody coated, 1 plate control antibody coated), protein standards, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Tai LM et al. (2013) J Biol Chem. 288(8): 5914-26 Tai LM et al. (2014) Mol Neurodegen. 9:2
Specificity:
Human Apolipoprotein E/beta-Amyloid (ApoE/A beta) Complex. The kit has been assayed on human samples only but the capture antibody, MOAB-2, is know to react with rodent amyloid beta though weaker (20% less reactivity on dot blots). The polyclonal APOE used for detection should detect ApoE from a variety of species but so far has only been tested on human
The Biosensis Mouse Mature NGF/proNGF Combo Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit combines individual, but complementary ELISA kits for the two most important NGF isoforms: Mature NGF (BEK-2213) and full-length proNGF (BEK-2236). Both kits are sandwich ELISAs, useful for the quantification of mature NGF and proNGF in less than 4 hours in cell culture supernatants and tissue homogenates only if used as directed, with a simplified protocol and no loss of sensitivity or specificity. Researchers have used both kits for NGF/proNGF measurement in mouse urine, however, Biosensis has not yet internally validated the use of urine in both ELISA kits. End-users are strongly advised to perform essential validation experiments to assure accurate NGF/proNGF quantification in mouse urine. Please refer to the most current kit protocols for BEK-2213 (Mature BDNF Rapid TM ELISA) and BEK-2236 (proNGF Rapid TM ELISA), for specific use instructions for each substrate application. The Mature NGF ELISA kit consists of a pre-coated mouse monoclonal anti-NGF capture antibody, a biotinylated anti-NGF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The proNGF ELISA kit consists of a pre-coated anti-proNGF capture antibody, a biotinylated anti-NGF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a coloured reaction product which is directly proportional to the concentration of mature NGF or proNGF present in samples and protein standards. A NGF and proNGF positive control (QC sample) is provided to assure consistent assay performance. The Mature NGF ELISA kit employs a native mouse NGF protein as standard, purified from mouse submaxillary glands according to published procedures. The calibrator standard reflects the native state of mouse NGF protein and has been chosen to give most accurate quantification of natural NGF protein levels in mouse samples. The proNGF ELISA kit contains a recombinant mouse proNGF standard expressed in E.coli. Note that this Mature NGF/proNGF Combo kit is designed to measure the mouse protein forms, although due to sequence homology the Mature NGF ELISA kit will detect human and rat mature NGF. The proNGF ELISA kit cross-reacts with rat proNGF due to high degree of homology (96%) with mouse proNGF based on amino acid sequence, and the ability of this kit in detecting proNGF in rat PC12 cell lysates and rat brain tissue homogenate. However, the proNGF ELISA shows only little cross-reactivity (20%) with human proNGF. This Combo kit is capable of distinguishing and independently quantifying the mature NGF and full-length NGF isoforms. Internal validation data demonstrates This ELISA kit has not been tested for other applications. It has been configured for research use only and is not to be used for diagnostic or clinical procedures.
Background Info:
Nerve growth factor (NGF) is synthesized as a precursor (proNGF) which may be released and have physiological functions to cause cell death. It binds neurotrophin receptor p75 and sortilin and may also be important for the development of nervous system. proNGF is synthesized in target tissues and glia, transported retrogradely and may be released.
Product Type:
ELISA Assay
Species Reactivity:
Mouse
Immunogen:
See BEK-2213 & BEK-2236 for specific details
Applications:
ELISA
Application Details:
ELISA. For the quantification of Mature NGF and proNGF in Culture Supernatant, Tissue Homogenates. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
The ELISA kit box contains 2 x 96-well pre-coated strip plates per kit (1 x NGF antibody, 1 x proNGF antibody coated plate), protein standards, QC sample, detection reagents, heterophilic antibody blocker, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Please refer to BEK-2213 (Mouse Mature NGF Rapid TM ELISA Kit) and BEK-2236 (Mouse/Rat proNGF Rapid TM ELISA Kit) .
Specificity:
Mature NGF ELISA: Detects mouse NGF, and cross-reacts with human and rat mature NGF. This mature NGF ELISA preferentially detects mature NGF over full-length proNGF. proNGF ELISA: Detects mouse and rat proNGF only, and shows only little reactivity (20%) with human proNGF. The proNGF ELISA detects the full-length form of proNGF only, and does not quantify mature NGF or the pro-domain peptide.
Typical limit of detection (LOD) for mouse mature NGF is 2 pg/mL determined as 150% of the blank value. Typical limit of detection (LOD) for mouse proNGF is less than 50 pg/mL, determined as blank value plus 3x standard deviation of blank OD (n=10).
Cross Reactivity:
<b>Cross-reactivity of NGF isoforms:</b><br><br><b>Mature NGF ELISA:</b><br>The antibodies used in this ELISA kit bind epitopes within the mature domain of the protein. No cross-reactivity was observed with brain derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3) and NT-4/5 tested at 25 ng/mL in assay buffer. Mature mouse NGF (27 kDa) and full-length mouse proNGF (50 kDa) were assayed in parallel at equimolar protein concentrations across the Mouse NGF ELISA calibration range (3.9-250 pg/mL; 0.14-9.2 pmol/L). OD readings for mouse proNGF were indistinguishable from the assay's blank OD readings.<br><br><b>proNGF ELISA:</b><br>Does not cross-react with proBDNF and mature NGF. Mature NGF spiked into brain homogenate does not interfere with proNGF quantification.
The Biosensis proNGF Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the quantification of full-length proNGF protein in less than 4 hours in human serum, heparin-plasma, cell supernatants and cell lysates only if used as directed. Please refer to the kit protocol for specific use instructions for each substrate application. This ELISA kit consists of a pre-coated anti-proNGF capture antibody, a biotinylated anti-proNGF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product which is directly proportional to the concentration of proNGF present in samples and protein standards. A human proNGF positive control (QC sample) is provided to assure consistent assay performance. This proNGF ELISA kit contains a recombinant human proNGF standard expressed in E.coli. This ELISA kit does not cross-react with the mouse form of proNGF, and due to sequence homology of mouse and rat proNGF is not expected to detect rat proNGF. The antibodies used in this ELISA kit bind epitopes within the pro-domain of the protein and therefore recognize proNGF and the pro-domain peptide, but do not cross-react with mature NGF! Note that accurate proNGF quantification in human serum requires the addition of Heterophilic Antibody Blocker BL-003-1000 provided in the kit, and available for purchase separately . This kit has not been tested for other applications. Sufficient amount of proNGF standard is supplied to allow for spike- and recovery experiments in order to validate this ELISA assay for other sample matrices if required. This kit has been configured for research use only and is not to be used in diagnostic or clinical procedures.
Background Info:
Nerve growth factor (NGF) is synthesized as a precursor (proNGF) which may be released and have physiological functions to cause cell death. It binds neurotrophin receptor p75 and sortilin and may also be important for the development of nervous system. proNGF is synthesized in target tissues and glia, transported retrogradely and may be released.
Product Type:
ELISA Assay
Species Reactivity:
Human
Immunogen:
Recombinant human, wild-type proNGF protein, made in E.coli
Applications:
ELISA
Application Details:
ELISA. For the quantification of Nerve growth factor, pro- (proNGF) in Serum, Plasma (Heparin), Culture Supernatant, Cell Lysates. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
Alternative Names:
pro-beta nerve growth factor; proNGF; NGF
Biosensis Brand:
Rapid
Detection Method:
Colorimetric
Shelf Life:
12 months from purchase.
Use:
For research use only.
Kit Components:
The ELISA kit box contains 96-well pre-coated strip plate(s), protein standards, QC sample, detection reagents, heterophilic antibody blocker, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
March B et al. (2021). ELISA-based quantification of neurotrophic growth factors in urine from prostate cancer patients. FASEB Bioadv. [Epub ahead of print]. Application: Human urine. Mossa AH et al. (2020). Imbalance of nerve growth factor metabolism in aging women with overactive bladder syndrome. World J Urol. [Epub ahead of print]. Application: Human urine. Rowe CW et al. (2019). The precursor for nerve growth factor (proNGF) is not a serum or biopsy-rinse biomarker for thyroid cancer diagnosis. BMC Endocr Disord. 19(1):128. Application: Human serum. Stapledon CJM et al. (2019). Human osteocyte expression of Nerve Growth Factor: The effect of Pentosan Polysulphate Sodium (PPS) and implications for pain associated with knee osteoarthritis. PLoS One. 14(9):e0222602. Application: Human primary culture supernatant. Ryu JC et al. (2018). Role of proNGF/p75 signaling in bladder dysfunction after spinal cord injury. J Clin Invest. [Epub ahead of print]. Application: Human urine. Sherif IO & Al-Gayyar MMH (2018). Oleuropein potentiates anti-tumor activity of cisplatin against HepG2 through affecting proNGF/NGF balance. Life Sci. [Epub ahead of print]. Application: Human cell culture.
Specificity:
Human. Does not react with mouse proNGF, and is not expected to detect rat proNGF. Does not cross-react with recombinant human NGF and proBDNF tested at 25 ng/mL.
The Biosensis proNGF Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the quantification of full-length proNGF protein in less than 4 hours in human serum, heparin-plasma, cell supernatants and cell lysates only if used as directed. Please refer to the kit protocol for specific use instructions for each substrate application. This ELISA kit consists of a pre-coated anti-proNGF capture antibody, a biotinylated anti-proNGF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product which is directly proportional to the concentration of proNGF present in samples and protein standards. A human proNGF positive control (QC sample) is provided to assure consistent assay performance. This proNGF ELISA kit contains a recombinant human proNGF standard expressed in E.coli. This ELISA kit does not cross-react with the mouse form of proNGF, and due to sequence homology of mouse and rat proNGF is not expected to detect rat proNGF. The antibodies used in this ELISA kit bind epitopes within the pro-domain of the protein and therefore recognize proNGF and the pro-domain peptide, but do not cross-react with mature NGF! Note that accurate proNGF quantification in human serum requires the addition of Heterophilic Antibody Blocker BL-003-1000 provided in the kit, and available for purchase separately . This kit has not been tested for other applications. Sufficient amount of proNGF standard is supplied to allow for spike- and recovery experiments in order to validate this ELISA assay for other sample matrices if required. This kit has been configured for research use only and is not to be used in diagnostic or clinical procedures.
Background Info:
Nerve growth factor (NGF) is synthesized as a precursor (proNGF) which may be released and have physiological functions to cause cell death. It binds neurotrophin receptor p75 and sortilin and may also be important for the development of nervous system. proNGF is synthesized in target tissues and glia, transported retrogradely and may be released.
Product Type:
ELISA Assay
Species Reactivity:
Human
Immunogen:
Recombinant human, wild-type proNGF protein, made in E.coli
Applications:
ELISA
Application Details:
ELISA. For the quantification of Nerve growth factor, pro- (proNGF) in Serum, Plasma (Heparin), Culture Supernatant, Cell Lysates. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
Alternative Names:
pro-beta nerve growth factor; proNGF; NGF
Biosensis Brand:
Rapid
Detection Method:
Colorimetric
Shelf Life:
12 months from purchase.
Use:
For research use only.
Kit Components:
The ELISA kit box contains 96-well pre-coated strip plate(s), protein standards, QC sample, detection reagents, heterophilic antibody blocker, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
March B et al. (2021). ELISA-based quantification of neurotrophic growth factors in urine from prostate cancer patients. FASEB Bioadv. [Epub ahead of print]. Application: Human urine. Mossa AH et al. (2020). Imbalance of nerve growth factor metabolism in aging women with overactive bladder syndrome. World J Urol. [Epub ahead of print]. Application: Human urine. Rowe CW et al. (2019). The precursor for nerve growth factor (proNGF) is not a serum or biopsy-rinse biomarker for thyroid cancer diagnosis. BMC Endocr Disord. 19(1):128. Application: Human serum. Stapledon CJM et al. (2019). Human osteocyte expression of Nerve Growth Factor: The effect of Pentosan Polysulphate Sodium (PPS) and implications for pain associated with knee osteoarthritis. PLoS One. 14(9):e0222602. Application: Human primary culture supernatant. Ryu JC et al. (2018). Role of proNGF/p75 signaling in bladder dysfunction after spinal cord injury. J Clin Invest. [Epub ahead of print]. Application: Human urine. Sherif IO & Al-Gayyar MMH (2018). Oleuropein potentiates anti-tumor activity of cisplatin against HepG2 through affecting proNGF/NGF balance. Life Sci. [Epub ahead of print]. Application: Human cell culture.
Specificity:
Human. Does not react with mouse proNGF, and is not expected to detect rat proNGF. Does not cross-react with recombinant human NGF and proBDNF tested at 25 ng/mL.
The biosensis Multi-Neurotrophin Rapid TM Screening ELISA kit has been designed to allow rapid screening and quantification of human NGF, BDNF, NT3 and NT4/5 in cell culture supernatants, lysates, serum, plasma (EDTA and citrate) and brain extracts only if used as directed. Please refer to the kit protocol for specific use instructions for each substrate application, in particular human serum and plasma samples. This two-plate kit consists of four sets of 6 strips for each Neurotrophin, allowing for the assay of 16 samples per Neurotrophin tested and a full range of standards, all run in duplicate. It provides the identical sensitivities and ranges that are achieved in the complete, individual ELISA kits, thus allowing easy progression into the larger individual assay sizes when needed. The Multi-Neurotrophin Rapid TM Screening ELISA kit therefore presents a cost effective way to quickly screen multiple samples, which can then be published or used prior to a more extensive analysis with the individual kits. The kit comes complete with all detection reagents and is ready to use. Individual coated strips are provided and each set of standards and detection antibodies are color-coded. NOTE: For research use only. Not for diagnostic and clinical purposes.
Background Info:
The Neurotrophin family of growth factors in all mammals including human has four members including Nerve Growth Factor (NGF), Brain-Derived Neurotrophic Factor (BDNF), Neurotrophin 3 (NT3) and Neurotrophin 4/5 (NT4/5). These are all essential to brain development, maturation and adult function, particularly for cell differentiation, survival, death and synaptic regulation.
Product Type:
ELISA Assay
Species Reactivity:
Human
Immunogen:
As for individual ELISA kits
Applications:
ELISA
Application Details:
ELISA. For the quantification of Multi-Neurotrophin Screening in Culture Supernatant, Cell Lysates, Tissue Homogenates. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
Alternative Names:
NGF; BDNF; NT3; NT4/5;
Biosensis Brand:
Rapid
Detection Method:
Colorimetric
Shelf Life:
12 months from purchase.
Use:
For research use only.
Kit Components:
The ELISA kit box contains 96-well pre-coated strip plate(s) (6 strips/48 wells per neurotrophin target), protein standards, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Lamb WDB (2021) "Potential of Muller glia-derived extracellular vesicles for retinal neuroprotection." PhD Thesis Application: Human cell culture supernatant. Elisa A et al. (2021) "Aging is associated with cardiac autonomic nerve fiber depletion and reduced cardiac and circulating BDNF levels." J Geriatr Cardiol. 18(7): 549559 Application: Rat serum. Woo JH et al. (2019) "Effect of Dehydrocostus Lactone Isolated from the Roots of Aucklandia lappa on the Apoptosis of Endometriotic Cells and the Alternative Activation of Endometriosis-Associated Macrophages." Am J Chin Med. [Epub ahead of print] Application: Human cell culture supernatants. Kalinowska-Lyszczarz A et al. (2018) "Immune-cell BDNF expression in treatment-naive relapsing-remitting multiple sclerosis patients and following one year of immunomodulation therapy." Neurol Neurochir Pol. [In Press] Application: Human PBMC cell lysates. Lindsay SL et al. (2016) "Comparative miRNA-Based Fingerprinting Reveals Biological Differences in Human Olfactory Mucosa- and Bone-Marrow-Derived Mesenchymal Stromal Cells." Stem Cell Reports. 6(5):729-42 Application: MSC-conditioned medium/cell supernatant. Carnevale G et al. (2016) "Human dental pulp stem cells expressing STRO-1, c-kit and CD34 markers in peripheral nerve regeneration." J Tissue Eng Regen Med. [Epub ahead of print] Application: Supernatant of human dental pulp stem cells (hDPSCs).
Specificity:
This Multi-Neurotrophin Screening kit uses the same antibodies as in the individual Rapid ELISA kits. Each kit has been tested for cross-reactivity with other closely related neurotrophins and no cross-reactivity has been observed at 25 ng/mL of each neurotrophin tested. The antibodies used in this kit detect the mouse and rat form of each neurotrophin, but with varying efficiency depending on the target protein.
The Biosensis Rat Mature NGF/proNGF Combo Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit combines individual, but complementary ELISA kits for the two most important NGF isoforms: Mature NGF (BEK-2214) and full-length proNGF (BEK-2236). Both kits are sandwich ELISAs, useful for the quantification of mature NGF and proNGF in less than 4 hours in cell culture supernatants and tissue homogenates only if used as directed, with a simplified protocol and no loss of sensitivity or specificity. Please refer to the most current kit protocols for BEK-2214 (Mature BDNF Rapid TM ELISA) and BEK-2236 (proNGF Rapid TM ELISA), for specific use instructions for each substrate application. The Mature NGF ELISA kit consists of a pre-coated mouse monoclonal anti-NGF capture antibody, a biotinylated anti-NGF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The proNGF ELISA kit consists of a pre-coated anti-proNGF capture antibody, a biotinylated anti-NGF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a coloured reaction product which is directly proportional to the concentration of mature NGF or proNGF present in samples and protein standards. A NGF and proNGF positive control (QC sample) is provided to assure consistent assay performance. The Mature NGF ELISA kit employs a high-quality recombinant rat NGF protein as standard, and thus the Mature NGF/proNGF Combo kit is designed to measure the rat NGF isoforms. However, the rat mature NGF ELISA kit will cross-react with mouse and human mature NGF protein. The proNGF ELISA kit contains a recombinant mouse proNGF standard expressed in E.coli. Mouse proNGF and rat proNGF share 96% sequence homology, and internal validation data has demonstrated the ability of the proNGF ELISA to detect proNGF in rat PC12 cell lysates and rat brain tissue homogenate. However, the proNGF ELISA shows only little cross-reactivity (20%) with human proNGF. This Combo kit is capable of distinguishing and independently quantifying the mature NGF and full-length NGF isoforms. Internal validation data demonstrates that the mature NGF ELISA assay antibodies preferentially detect the mature form of NGF. Cross-reaction of full-length proNGF was This ELISA kit has not been tested for other applications. It has been configured for research use only and is not to be used for diagnostic or clinical procedures.
Background Info:
Nerve growth factor (NGF) is synthesized as a precursor (proNGF) which may be released and have physiological functions to cause cell death. It binds neurotrophin receptor p75 and sortilin and may also be important for the development of nervous system. proNGF is synthesized in target tissues and glia, transported retrogradely and may be released.
Product Type:
ELISA Assay
Species Reactivity:
Rat
Immunogen:
See BEK-2214 & BEK-2236 for specific details
Applications:
ELISA
Application Details:
ELISA. For the quantification of Mature NGF and proNGF in Culture Supernatant, Tissue Homogenates. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
The ELISA kit box contains 2 x 96-well pre-coated strip plates per kit (1 x NGF antibody, 1 x proNGF antibody coated plate), protein standards, QC sample, detection reagents, heterophilic antibody blocker, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Please refer to BEK-2214 (Rat Mature NGF Rapid TM ELISA Kit) and BEK-2236 (Mouse/Rat proNGF Rapid TM ELISA Kit) .
Specificity:
Mature NGF ELISA: Detects rat NGF, and cross-reacts with human and mouse mature NGF. This mature NGF ELISA preferentially detects mature NGF over full-length proNGF. proNGF ELISA: Detects mouse and rat proNGF only, and shows only little reactivity (20%) with human proNGF. The proNGF ELISA detects the full-length form of proNGF only, and does not quantify mature NGF or the pro-domain peptide.
Typical limit of detection (LOD) for rat mature NGF is 2 pg/mL determined as 150% of the blank value. Typical limit of detection (LOD) for rat proNGF is less than 50 pg/mL, determined as blank value plus 3x standard deviation of blank OD (n=10).
Cross Reactivity:
<b>Cross-reactivity of NGF isoforms:</b><br><br><b>Mature NGF ELISA:</b><br>The antibodies used in this ELISA kit bind epitopes within the mature domain of the protein. No cross-reactivity was observed with brain derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3) and NT-4/5 tested at 25 ng/mL in assay buffer. Mature NGF (27 kDa) and full-length proNGF (50 kDa) were assayed in parallel at equimolar protein concentrations across the mature NGF ELISA calibration range (3.9-250 pg/mL; 0.14-9.2 pmol/L). OD readings for proNGF were indistinguishable from the assay's blank OD readings.<br><br><b>proNGF ELISA:</b><br>Does not cross-react with proBDNF and mature NGF. Mature NGF spiked into brain homogenate does not interfere with proNGF quantification.
The Biosensis GDNF Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the quantification of GDNF in less than 4 hours in cell culture supernatants and cell lysates only if used as directed. Please refer to the kit protocol for specific use instructions for each substrate application. This ELISA kit consists of a pre-coated anti-GDNF capture antibody, a biotinylated anti-GDNF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product which is directly proportional to the concentration of GDNF present in samples and protein standards. This GDNF ELISA kit employs a recombinant mouse GDNF standard and is therefore designed to measure the murine form of GDNF. Note that the antibodies used in this kit cross-react with rat, human and guinea pig GDNF. This kit has not been tested for other applications. It has been configured for research use only and is not to be used in diagnostic or clinical procedures.
Background Info:
GDNF is a glycosylated, disulfide-bonded homodimer molecule. It was first discovered as a potent survival factor for midbrain dopaminergic neurons and was then shown to rescue these neurons in animal models of Parkinson's disease. GDNF is about 100 times more efficient survival factor for spinal motor neurons than the neurotrophins. FUNCTION: Neurotrophic factor that enhances survival and morphological differentiation of dopaminergic neurons and increases their high-affinity dopamine uptake. SUBUNIT: Homodimer; disulfide-linked. SUBCELLULAR LOCATION: Secreted protein. ALTERNATIVE PRODUCTS: 2 named isoforms produced by alternative splicing. DISEASE: Defects in GDNF may be a cause of Hirschsprung disease (HSCR). In association with mutations of RET gene, defects in GDNF may be involved in Hirschsprung disease. This genetic disorder of neural crest development is characterized by the absence of intramural ganglion cells in the hindgut, often resulting in intestinal obstruction. DISEASE: Defects in GDNF are a cause of congenital central hypoventilation syndrome (CCHS); also known as congenital failure of autonomic control or Ondine curse. CCHS is a rare disorder characterized by abnormal control of respiration in the absence of neuromuscular or lung disease, or an identifiable brain stem lesion. A deficiency in autonomic control of respiration results in inadequate or negligible ventilatory and arousal responses to hypercapnia and hypoxemia. SIMILARITY: Belongs to the TGF-beta family. GDNF subfamily.
Product Type:
ELISA Assay
Species Reactivity:
Mouse
Immunogen:
Recombinant mouse GDNF protein, made in E.coli
Applications:
ELISA
Application Details:
ELISA. For the quantification of Glial cell line-derived neurotrophic factor (GDNF) in Culture Supernatant and Cell Lysates. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
The ELISA kit box contains 96-well pre-coated strip plate(s), protein standards, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Specificity:
Mouse. The antibodies used in this kit detect human and rat GDNF. The assay antibodies cross-react with guinea pig GDNF as evidenced by measuring GDNF in guinea pig serum with the Human GDNF Rapid TM ELISA kit . All Biosensis GDNF Rapid TM ELISA kits use the same capture and detection antibodies, and thus this Mouse GDNF Rapid TM ELISA kit can be used to assay guinea pig GDNF in serum. However, in absence of a true guinea pig GDNF protein standard, the Human GDNF Rapid TM ELISA kit may give the most accurate estimations of guinea pig GDNF levels based on amino acid sequence homology. No cross-reactivity was observed for the following proteins tested at 25 ng/mL in assay buffer: brain-derived neurotrophic factor (rhBDNF), nerve growth factor (rhNGF), neurotrophin-3 (rhNT-3), rhNT-4/5, vascular endothelial growth factor (rhVEGF), recombinant human Neurturin, Artemin and Persephin.
Storage:
Store at 2-8°C.
Range:
7.8 - 500 pg/mL
Sample Type:
Cell Lysates,Culture Supernatant
Sensitivity:
Typical limit of detection (LOD) for rmGDNF is less than 5 pg/mL determined as blank value plus 3x standard deviation of blank OD (n=10).
Cross Reactivity:
No cross-reactivity was observed for the following proteins tested at 25 ng/mL in assay buffer: brain-derived neurotrophic factor (rhBDNF), nerve growth factor (rhNGF), neurotrophin-3 (rhNT-3), rhNT-4/5, vascular endothelial growth factor (rhVEGF), recombinant human Neurturin, Artemin and Persephin.
The Biosensis GDNF Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the quantification of GDNF in less than 4 hours in cell culture supernatants and cell lysates only if used as directed. Please refer to the kit protocol for specific use instructions for each substrate application. This ELISA kit consists of a pre-coated anti-GDNF capture antibody, a biotinylated anti-GDNF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product which is directly proportional to the concentration of GDNF present in samples and protein standards. This GDNF ELISA kit employs a recombinant mouse GDNF standard and is therefore designed to measure the murine form of GDNF. Note that the antibodies used in this kit cross-react with rat, human and guinea pig GDNF. This kit has not been tested for other applications. It has been configured for research use only and is not to be used in diagnostic or clinical procedures.
Background Info:
GDNF is a glycosylated, disulfide-bonded homodimer molecule. It was first discovered as a potent survival factor for midbrain dopaminergic neurons and was then shown to rescue these neurons in animal models of Parkinson's disease. GDNF is about 100 times more efficient survival factor for spinal motor neurons than the neurotrophins. FUNCTION: Neurotrophic factor that enhances survival and morphological differentiation of dopaminergic neurons and increases their high-affinity dopamine uptake. SUBUNIT: Homodimer; disulfide-linked. SUBCELLULAR LOCATION: Secreted protein. ALTERNATIVE PRODUCTS: 2 named isoforms produced by alternative splicing. DISEASE: Defects in GDNF may be a cause of Hirschsprung disease (HSCR). In association with mutations of RET gene, defects in GDNF may be involved in Hirschsprung disease. This genetic disorder of neural crest development is characterized by the absence of intramural ganglion cells in the hindgut, often resulting in intestinal obstruction. DISEASE: Defects in GDNF are a cause of congenital central hypoventilation syndrome (CCHS); also known as congenital failure of autonomic control or Ondine curse. CCHS is a rare disorder characterized by abnormal control of respiration in the absence of neuromuscular or lung disease, or an identifiable brain stem lesion. A deficiency in autonomic control of respiration results in inadequate or negligible ventilatory and arousal responses to hypercapnia and hypoxemia. SIMILARITY: Belongs to the TGF-beta family. GDNF subfamily.
Product Type:
ELISA Assay
Species Reactivity:
Mouse
Immunogen:
Recombinant mouse GDNF protein, made in E.coli
Applications:
ELISA
Application Details:
ELISA. For the quantification of Glial cell line-derived neurotrophic factor (GDNF) in Culture Supernatant and Cell Lysates. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
The ELISA kit box contains 96-well pre-coated strip plate(s), protein standards, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Specificity:
Mouse. The antibodies used in this kit detect human and rat GDNF. The assay antibodies cross-react with guinea pig GDNF as evidenced by measuring GDNF in guinea pig serum with the Human GDNF Rapid TM ELISA kit . All Biosensis GDNF Rapid TM ELISA kits use the same capture and detection antibodies, and thus this Mouse GDNF Rapid TM ELISA kit can be used to assay guinea pig GDNF in serum. However, in absence of a true guinea pig GDNF protein standard, the Human GDNF Rapid TM ELISA kit may give the most accurate estimations of guinea pig GDNF levels based on amino acid sequence homology. No cross-reactivity was observed for the following proteins tested at 25 ng/mL in assay buffer: brain-derived neurotrophic factor (rhBDNF), nerve growth factor (rhNGF), neurotrophin-3 (rhNT-3), rhNT-4/5, vascular endothelial growth factor (rhVEGF), recombinant human Neurturin, Artemin and Persephin.
Storage:
Store at 2-8°C.
Range:
7.8 - 500 pg/mL
Sample Type:
Cell Lysates,Culture Supernatant
Sensitivity:
Typical limit of detection (LOD) for rmGDNF is less than 5 pg/mL determined as blank value plus 3x standard deviation of blank OD (n=10).
Cross Reactivity:
No cross-reactivity was observed for the following proteins tested at 25 ng/mL in assay buffer: brain-derived neurotrophic factor (rhBDNF), nerve growth factor (rhNGF), neurotrophin-3 (rhNT-3), rhNT-4/5, vascular endothelial growth factor (rhVEGF), recombinant Human Neurturin, Artemin and Persephin.
The Biosensis GDNF Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the quantification of GDNF in less than 4 hours in cell culture supernatants, cell lysates, and serum only if used as directed. Please refer to the kit protocol for specific use instructions for each substrate application, in particular rat serum samples. This ELISA kit consists of a pre-coated anti-GDNF capture antibody, a biotinylated anti-GDNF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product which is directly proportional to the concentration of GDNF present in samples and protein standards. This GDNF ELISA kit employs a recombinant rat GDNF standard and is therefore designed to measure the rat form of GDNF. Note that the antibodies used in this kit cross-react with mouse, human and guinea pig GDNF. This kit has not been tested for other applications. It has been configured for research use only and is not to be used in diagnostic or clinical procedures.
Background Info:
GDNF is a glycosylated, disulfide-bonded homodimer molecule. It was first discovered as a potent survival factor for midbrain dopaminergic neurons and was then shown to rescue these neurons in animal models of Parkinson's disease. GDNF is about 100 times more efficient survival factor for spinal motor neurons than the neurotrophins. FUNCTION: Neurotrophic factor that enhances survival and morphological differentiation of dopaminergic neurons and increases their high-affinity dopamine uptake. SUBUNIT: Homodimer; disulfide-linked. SUBCELLULAR LOCATION: Secreted protein. ALTERNATIVE PRODUCTS: 2 named isoforms produced by alternative splicing. DISEASE: Defects in GDNF may be a cause of Hirschsprung disease (HSCR). In association with mutations of RET gene, defects in GDNF may be involved in Hirschsprung disease. This genetic disorder of neural crest development is characterized by the absence of intramural ganglion cells in the hindgut, often resulting in intestinal obstruction. DISEASE: Defects in GDNF are a cause of congenital central hypoventilation syndrome (CCHS); also known as congenital failure of autonomic control or Ondine curse. CCHS is a rare disorder characterized by abnormal control of respiration in the absence of neuromuscular or lung disease, or an identifiable brain stem lesion. A deficiency in autonomic control of respiration results in inadequate or negligible ventilatory and arousal responses to hypercapnia and hypoxemia. SIMILARITY: Belongs to the TGF-beta family. GDNF subfamily.
Product Type:
ELISA Assay
Species Reactivity:
Rat
Immunogen:
Recombinant rat GDNF protein, made in E.coli
Applications:
ELISA
Application Details:
ELISA. For the quantification of Glial cell line-derived neurotrophic factor (GDNF) in Culture Supernatant, Cell Lysates, Serum. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
The ELISA kit box contains 96-well pre-coated strip plate(s), protein standards, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Possamai-Della T et al. (2022) Imipramine Can Be Effective on Depressive-Like Behaviors, but Not on Neurotrophic Factor Levels in an Animal Model for Bipolar Disorder Induced by Ouabain Mol Neurobiol. [Epub ahead of print] Application: Rat, brain tissue homogenate. Castro SL et al. (2022) Blueberry Juice Augments Exercise-Induced Neuroprotection in a Parkinsons Disease Model Through Modulation of GDNF Levels. IBRO Neurosci Rep. [Epub ahead of print] Application: Rat, brain tissue homogenate.
Specificity:
Rat. The antibodies used in this kit detect human and mouse GDNF. The assay antibodies cross-react with guinea pig GDNF as evidenced by measuring GDNF in guinea pig serum with the Human GDNF Rapid TM ELISA kit . All Biosensis GDNF Rapid TM ELISA kits use the same capture and detection antibodies, and thus this Rat GDNF Rapid TM ELISA kit can be used to assay guinea pig GDNF in serum. However, in absence of a true guinea pig GDNF protein standard, the Human GDNF Rapid TM ELISA kit may give the most accurate estimations of guinea pig GDNF levels based on amino acid sequence homology. No cross-reactivity was observed for the following proteins tested at 25 ng/mL in assay buffer: brain-derived neurotrophic factor (rhBDNF), nerve growth factor (rhNGF), neurotrophin-3 (rhNT-3), rhNT-4/5, vascular endothelial growth factor (rhVEGF), recombinant human Neurturin, Artemin and Persephin.
Storage:
Store at 2-8°C.
Range:
7.8 - 500 pg/mL
Sample Type:
Cell Lysates,Culture Supernatant,Serum
Sensitivity:
Typical limit of detection (LOD) for rrGDNF is <5 pg/mL determined as blank value plus 3x standard deviation of blank OD (n=10).
Cross Reactivity:
No cross-reactivity was observed for the following proteins tested at 25 ng/mL in assay buffer: brain-derived neurotrophic factor (rhBDNF), nerve growth factor (rhNGF), neurotrophin-3 (rhNT-3), rhNT-4/5, vascular endothelial growth factor (rhVEGF), recombinant Human Neurturin, Artemin and Persephin.
The Biosensis GDNF Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the quantification of GDNF in less than 4 hours in cell culture supernatants, cell lysates, and serum only if used as directed. Please refer to the kit protocol for specific use instructions for each substrate application, in particular rat serum samples. This ELISA kit consists of a pre-coated anti-GDNF capture antibody, a biotinylated anti-GDNF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product which is directly proportional to the concentration of GDNF present in samples and protein standards. This GDNF ELISA kit employs a recombinant rat GDNF standard and is therefore designed to measure the rat form of GDNF. Note that the antibodies used in this kit cross-react with mouse, human and guinea pig GDNF. This kit has not been tested for other applications. It has been configured for research use only and is not to be used in diagnostic or clinical procedures.
Background Info:
GDNF is a glycosylated, disulfide-bonded homodimer molecule. It was first discovered as a potent survival factor for midbrain dopaminergic neurons and was then shown to rescue these neurons in animal models of Parkinson's disease. GDNF is about 100 times more efficient survival factor for spinal motor neurons than the neurotrophins. FUNCTION: Neurotrophic factor that enhances survival and morphological differentiation of dopaminergic neurons and increases their high-affinity dopamine uptake. SUBUNIT: Homodimer; disulfide-linked. SUBCELLULAR LOCATION: Secreted protein. ALTERNATIVE PRODUCTS: 2 named isoforms produced by alternative splicing. DISEASE: Defects in GDNF may be a cause of Hirschsprung disease (HSCR). In association with mutations of RET gene, defects in GDNF may be involved in Hirschsprung disease. This genetic disorder of neural crest development is characterized by the absence of intramural ganglion cells in the hindgut, often resulting in intestinal obstruction. DISEASE: Defects in GDNF are a cause of congenital central hypoventilation syndrome (CCHS); also known as congenital failure of autonomic control or Ondine curse. CCHS is a rare disorder characterized by abnormal control of respiration in the absence of neuromuscular or lung disease, or an identifiable brain stem lesion. A deficiency in autonomic control of respiration results in inadequate or negligible ventilatory and arousal responses to hypercapnia and hypoxemia. SIMILARITY: Belongs to the TGF-beta family. GDNF subfamily.
Product Type:
ELISA Assay
Species Reactivity:
Rat
Immunogen:
Recombinant rat GDNF protein, made in E.coli
Applications:
ELISA
Application Details:
ELISA. For the quantification of Glial cell line-derived neurotrophic factor (GDNF) in Culture Supernatant, Cell Lysates, Serum. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
The ELISA kit box contains 96-well pre-coated strip plate(s), protein standards, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Possamai-Della T et al. (2022) Imipramine Can Be Effective on Depressive-Like Behaviors, but Not on Neurotrophic Factor Levels in an Animal Model for Bipolar Disorder Induced by Ouabain Mol Neurobiol. [Epub ahead of print] Application: Rat, brain tissue homogenate. Castro SL et al. (2022) Blueberry Juice Augments Exercise-Induced Neuroprotection in a Parkinsons Disease Model Through Modulation of GDNF Levels. IBRO Neurosci Rep. [Epub ahead of print] Application: Rat, brain tissue homogenate.
Specificity:
Rat. The antibodies used in this kit detect human and mouse GDNF. The assay antibodies cross-react with guinea pig GDNF as evidenced by measuring GDNF in guinea pig serum with the Human GDNF Rapid TM ELISA kit . All Biosensis GDNF Rapid TM ELISA kits use the same capture and detection antibodies, and thus this Rat GDNF Rapid TM ELISA kit can be used to assay guinea pig GDNF in serum. However, in absence of a true guinea pig GDNF protein standard, the Human GDNF Rapid TM ELISA kit may give the most accurate estimations of guinea pig GDNF levels based on amino acid sequence homology. No cross-reactivity was observed for the following proteins tested at 25 ng/mL in assay buffer: brain-derived neurotrophic factor (rhBDNF), nerve growth factor (rhNGF), neurotrophin-3 (rhNT-3), rhNT-4/5, vascular endothelial growth factor (rhVEGF), recombinant human Neurturin, Artemin and Persephin.
Storage:
Store at 2-8°C.
Range:
7.8 - 500 pg/mL
Sample Type:
Cell Lysates,Culture Supernatant,Serum
Sensitivity:
Typical limit of detection (LOD) for rrGDNF is <5 pg/mL determined as blank value plus 3x standard deviation of blank OD (n=10).
Cross Reactivity:
No cross-reactivity was observed for the following proteins tested at 25 ng/mL in assay buffer: brain-derived neurotrophic factor (rhBDNF), nerve growth factor (rhNGF), neurotrophin-3 (rhNT-3), rhNT-4/5, vascular endothelial growth factor (rhVEGF), recombinant Human Neurturin, Artemin and Persephin.
The biosensis Multi-Neurotrophin Rapid TM Screening ELISA kit has been designed to allow rapid screening and quantification of mouse NGF, BDNF, NT3 and NT4/5 in cell culture supernatants, lysates and brain extracts only if used as directed. Please refer to the kit protocol for specific use instructions for each substrate application. This two-plate kit consists of four sets of 6 strips for each Neurotrophin, allowing for the assay of 16 samples per Neurotrophin tested and a full range of standards, all run in duplicate. It provides the identical sensitivities and ranges that are achieved in the complete, individual ELISA kits, thus allowing easy progression into the larger individual assay sizes when needed. The Multi-Neurotrophin Rapid TM Screening ELISA kit therefore presents a cost effective way to quickly screen multiple samples, which can then be published or used prior to a more extensive analysis with the individual kits. The kit comes complete with all detection reagents and is ready to use. Individual coated strips are provided and each set of standards and detection antibodies are color-coded. NOTE: For research use only. Not for diagnostic and clinical purposes.
Background Info:
The Neurotrophin family of growth factors in all mammals including human has four members including Nerve Growth Factor (NGF), Brain-Derived Neurotrophic Factor (BDNF), Neurotrophin 3 (NT3) and Neurotrophin 4/5 (NT4/5). These are all essential to brain development, maturation and adult function, particularly for cell differentiation, survival, death and synaptic regulation.
Product Type:
ELISA Assay
Species Reactivity:
Mouse
Immunogen:
As for individual ELISA kits
Applications:
ELISA
Application Details:
ELISA. For the quantification of Multi-Neurotrophin Screening in Culture Supernatant, Cell Lysates, Tissue Homogenates. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
Alternative Names:
NGF; BDNF; NT3; NT4/5;
Biosensis Brand:
Rapid
Detection Method:
Colorimetric
Shelf Life:
12 months from purchase.
Use:
For research use only.
Kit Components:
The ELISA kit box contains 96-well pre-coated strip plate(s) (6 strips/48 wells per neurotrophin target), protein standards, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Kawanokuchi J et al. (2021) Acupuncture Treatment for Social Defeat Stress. Front Behav Neurosci. 15:685433. Application: Brain homogenate. Takagishi S et al. (2021) Protein nanoparticles modified with PDGF-B as a novel therapy after acute cerebral infarction. eNeuro. [Epub ahead of print]. Application: Brain homogenate. Leitao L et al. (2020) Osteoblasts are inherently programmed to repel sensory innervation. Bone Res. 8:20. Application: Culture supernatant. Yamada K et al. (2020) The impact of ovariectomy on olfactory neuron regeneration in mice. Chem Senses. [Epub ahead of print]. Application: Mouse olfactory bulb homogenate. Hutson TH et al. (2019) Cbp-dependent histone acetylation mediates axon regeneration induced by environmental enrichment in rodent spinal cord injury models. Sci Transl Med. 11(487). Application: Rodent DRG lysates. Miura-Yura E et al. (2019) Secreted factors from cultured dental pulp stem cells promoted neurite outgrowth of dorsal root ganglion neurons and ameliorated neural functions in streptozotocin-induced diabetic mice. J Diabetes Investig. [Epub ahead of print]. Application: Conditioned medium of stem cells from human exfoliated deciduous teeth. Noda T et al. (2019) Effects of Tokishakuyakusan on regeneration of murine olfactory neurons in vivo and in vitro. Chem Senses. [Epub ahead of print]. Application: Mouse olfactory bulb homogenate.
Specificity:
This Multi-Neurotrophin Screening kit uses the same antibodies as in the individual Rapid ELISA kits. Each kit has been tested for cross-reactivity with other closely related neurotrophins and no cross-reactivity has been observed at 25 ng/mL of each neurotrophin tested. The antibodies used in this kit detect the human and rat form of each neurotrophin, but with varying efficiency depending on the target protein.
The biosensis Multi-Neurotrophin Rapid TM Screening ELISA kit has been designed to allow rapid screening and quantification of rat NGF, BDNF, NT3 and NT4/5 in cell culture supernatants, lysates, serum and brain extracts only if used as directed. Please refer to the kit protocol for specific use instructions for each substrate application, in particular rat serum. This two-plate kit consists of four sets of 6 strips for each Neurotrophin, allowing for the assay of 16 samples per Neurotrophin tested and a full range of standards, all run in duplicate. It provides the identical sensitivities and ranges that are achieved in the complete, individual ELISA kits, thus allowing easy progression into the larger individual assay sizes when needed. The Multi-Neurotrophin Rapid TM Screening ELISA kit therefore presents a cost effective way to quickly screen multiple samples, which can then be published or used prior to a more extensive analysis with the individual kits. The kit comes complete with all detection reagents and is ready to use. Individual coated strips are provided and each set of standards and detection antibodies are color-coded. NOTE: For research use only. Not for diagnostic and clinical purposes.
Background Info:
The Neurotrophin family of growth factors in all mammals including human has four members including Nerve Growth Factor (NGF), Brain-Derived Neurotrophic Factor (BDNF), Neurotrophin 3 (NT3) and Neurotrophin 4/5 (NT4/5). These are all essential to brain development, maturation and adult function, particularly for cell differentiation, survival, death and synaptic regulation.
Product Type:
ELISA Assay
Species Reactivity:
Rat
Immunogen:
As for individual ELISA kits
Applications:
ELISA
Application Details:
ELISA. For the quantification of Multi-Neurotrophin Screening in Culture Supernatant, Cell Lysates, Serum, Tissue Homogenates. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
Alternative Names:
NGF; BDNF; NT3; NT4/5;
Biosensis Brand:
Rapid
Detection Method:
Colorimetric
Shelf Life:
12 months from purchase.
Use:
For research use only.
Kit Components:
The ELISA kit box contains 96-well pre-coated strip plate(s) (6 strips/48 wells per neurotrophin target), protein standards, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Kim GB et al. (2018) "The critical chemical and mechanical regulation of folic acid on neural engineering." Biomaterials. [Epub ahead of print] Application: Rat Schwann cell culture supernatants.
Specificity:
This Multi-Neurotrophin Screening kit uses the same antibodies as in the individual Rapid ELISA kits. Each kit has been tested for cross-reactivity with other closely related neurotrophins and no cross-reactivity has been observed at 25 ng/mL of each neurotrophin tested. The antibodies used in this kit detect the human and rat form of each neurotrophin, but with varying efficiency depending on the target protein.
Human LR3 insulin-like Growth Factor-I (LR3IGF-I) was developed by GroPep Bioreagents ( www.gropep.com ) specifically for supplementation of mammalian cell culture to support the survival and proliferation of cells. It is engineered to have a higher biological potency than native IGF-I or IGF-II and has several advantages over recombinant insulin. Supplementation of cell cultures with LR3IGF-I at a much lower concentration results in equivalent or better productivity than supplementation with standard concentrations of insulin. LR3IGF-I is better able to stimulate the type I IGF receptor and thus induce a higher level of activation of intracellular signalling molecules, which are responsible for promoting cell survival by inhibition of apoptosis. This LR3IGF-I Rapid ELISA kit combines GroPep's many years of expertise in the field of IGF research and Biosensis' newly established Rapid ELISA platform. This collaboration has resulted in the new LR3IGF-I Rapid ELISA kit, which provides for the sensitive, specific and reliable quantification of LR3IGF-I protein in less than 3 hours! The ELISA kit consists of a complete set of reagents and pre-coated plate to allow immediate assay of LR3IGF-I in culture media. Included in the kit are mouse monoclonal anti- LR3IGF-I capture antibody pre-coated onto an ELISA plate, standard LR3IGF-I protein, a biotinylated anti- LR3IGF-I detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product which is directly proportional to the concentration of LR3IGF-I present in samples and the supplied protein standard. This LR3IGF-I Rapid ELISA kit has been developed, optimized and validated to quantify LR3IGF-I protein in cell culture medium. It is likely to be used to measure LR3IGF-I in media and during downstream processing of media following a production cycle and is not intended for other use. This kit has been configured for research use only and is not to be used in diagnostic or clinical procedures.
Background Info:
LR3IGF-I is an 83 amino acid analogue of IGF-I comprising the complete human IGF-I sequence with the substitution of an Arginine for the Glutamine at position 3, plus a 13 amino acid extension peptide at the N-terminus.
Product Type:
ELISA Assay
Species Reactivity:
Human
Immunogen:
Recombinant LR3-IGF1 protein, made in E.coli
Applications:
ELISA
Application Details:
ELISA. For the quantification of LR3IGF-I in Culture Supernatant. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
Alternative Names:
Human LR3 insulin-like Growth Factor-I.
Biosensis Brand:
Rapid
Detection Method:
Colorimetric
Shelf Life:
12 months from purchase.
Use:
For research use only.
Kit Components:
The ELISA kit box contains 96-well pre-coated strip plate(s), protein standards, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Specificity:
Human The assay is intended for quantification of LR3IGF-I. Cross-reaction with human IGF-I is 32%. Cross-reaction with human IGF-II is less than 0.01%.
Storage:
Store at 2-8°C
Range:
3.9 ng/mL - 200 ng/mL
Sample Type:
Culture Supernatant
Sensitivity:
Typical limit of detection (LOD) for LR3GF-I is 1 ng/mL determined as 150% of the blank value.
Cross Reactivity:
Cross-reaction with human IGF-I is 32%. Cross-reaction with human IGF-II is less than 0.01%.
Human LR3 insulin-like Growth Factor-I (LR3IGF-I) was developed by GroPep Bioreagents ( www.gropep.com ) specifically for supplementation of mammalian cell culture to support the survival and proliferation of cells. It is engineered to have a higher biological potency than native IGF-I or IGF-II and has several advantages over recombinant insulin. Supplementation of cell cultures with LR3IGF-I at a much lower concentration results in equivalent or better productivity than supplementation with standard concentrations of insulin. LR3IGF-I is better able to stimulate the type I IGF receptor and thus induce a higher level of activation of intracellular signalling molecules, which are responsible for promoting cell survival by inhibition of apoptosis. This LR3IGF-I Rapid ELISA kit combines GroPep's many years of expertise in the field of IGF research and Biosensis' newly established Rapid ELISA platform. This collaboration has resulted in the new LR3IGF-I Rapid ELISA kit, which provides for the sensitive, specific and reliable quantification of LR3IGF-I protein in less than 3 hours! The ELISA kit consists of a complete set of reagents and pre-coated plate to allow immediate assay of LR3IGF-I in culture media. Included in the kit are mouse monoclonal anti- LR3IGF-I capture antibody pre-coated onto an ELISA plate, standard LR3IGF-I protein, a biotinylated anti- LR3IGF-I detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product which is directly proportional to the concentration of LR3IGF-I present in samples and the supplied protein standard. This LR3IGF-I Rapid ELISA kit has been developed, optimized and validated to quantify LR3IGF-I protein in cell culture medium. It is likely to be used to measure LR3IGF-I in media and during downstream processing of media following a production cycle and is not intended for other use. This kit has been configured for research use only and is not to be used in diagnostic or clinical procedures.
Background Info:
LR3IGF-I is an 83 amino acid analogue of IGF-I comprising the complete human IGF-I sequence with the substitution of an Arginine for the Glutamine at position 3, plus a 13 amino acid extension peptide at the N-terminus.
Product Type:
ELISA Assay
Species Reactivity:
Human
Immunogen:
Recombinant LR3-IGF1 protein, made in E.coli
Applications:
ELISA
Application Details:
ELISA. For the quantification of LR3IGF-I in Culture Supernatant. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
Alternative Names:
Human LR3 insulin-like Growth Factor-I.
Biosensis Brand:
Rapid
Detection Method:
Colorimetric
Shelf Life:
12 months from purchase.
Use:
For research use only.
Kit Components:
The ELISA kit box contains 96-well pre-coated strip plate(s), protein standards, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Specificity:
Human The assay is intended for quantification of LR3IGF-I. Cross-reaction with human IGF-I is 32%. Cross-reaction with human IGF-II is less than 0.01%.
Storage:
Store at 2-8°C
Range:
3.9 ng/mL - 200 ng/mL
Sample Type:
Culture Supernatant
Sensitivity:
Typical limit of detection (LOD) for LR3IGF-I is 1 ng/mL determined as 150% of the blank value.
Cross Reactivity:
Cross-reaction with human IGF-I is 32%. Cross-reaction with human IGF-II is less than 0.01%.
The Biosensis Mouse and Rat proNGF Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the quantification of rodent full-length proNGF protein in less than 4 hours in cell culture supernatants and cell lysates only if used as directed. Please refer to the kit protocol for specific use instructions for each substrate application. This ELISA kit contains a recombinant mouse proNGF standard expressed in E.coli and consists of a pre-coated anti-proNGF capture antibody, a biotinylated anti-NGF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product which is directly proportional to the concentration of proNGF present in samples and protein standards. This ELISA kit is expected to detect rat proNGF due to high degree of homology (96%) with mouse proNGF based on amino acid sequence, and the ability of this kit in detecting proNGF in rat PC12 cell lysates. In the absence of a true rat proNGF standard, results may be expressed as 'mouse proNGF equivalents'. This ELISA kit shows only 20% reactivity with the human form of proNGF and is therefore not suitable to quantify human proNGF. No cross-reactivity was observed with mature mouse NGF and full-length proBDNF when tested in assay buffer. The antibodies used in this ELISA kit bind epitopes within the pro-domain (capture) and mature domain (detection) of the protein, thus this ELISA assay does not detect the pro-domain peptide. This kit has not been tested for other applications. Sufficient amount of proNGF standard is supplied to allow for spike- and recovery experiments in order to validate this ELISA assay for other sample matrices if required. This kit has been configured for research use only and is not to be used in diagnostic or clinical procedures.
Background Info:
Nerve growth factor (NGF) is synthesized as a precursor (proNGF) which may be released and have physiological functions to cause cell death. It binds neurotrophin receptor p75 and sortilin and may also be important for the development of nervous system. proNGF is synthesized in target tissues and glia, transported retrogradely and may be released.
Product Type:
ELISA Assay
Species Reactivity:
Mouse,Rat
Immunogen:
Recombinant mouse, wild-type proNGF protein, made in E.coli
Applications:
ELISA
Application Details:
ELISA. For the quantification of Nerve growth factor, pro- (proNGF) in Culture Supernatant, Cell Lysates, Tissue Homogenates. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
Alternative Names:
pro-beta nerve growth factor; proNGF; NGF
Biosensis Brand:
Rapid
Detection Method:
Colorimetric
Shelf Life:
12 months from purchase.
Use:
For research use only.
Kit Components:
The ELISA kit box contains 96-well pre-coated strip plate(s), protein standards, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Luu BE et al. (2022) Modulation of diabetic kidney disease markers by an antagonist of p75NTR in streptozotocin-treated mice Gene. [Epub ahead of print]. Application: Mouse kidney RIPA homogenates. Mossa A et al. (2021). Adaptation to partial urethral obstruction in healthy aging LOU rats and the role of nerve growth factor signaling pathway in the bladder. Exp Gerontol. [Epub ahead of print]. Application: Rat urine. Sugimoto J et al. (2021). Fabry disease-associated globotriaosylceramide induces mechanical allodynia via activation of signaling through proNGF p75NTR but not mature NGF TrkA. Eur. J. Pharmacol. 895. Application: Mouse tissue homogenate (RIPA). Mossa AH et al. (2020). Antagonism of proNGF or its receptor p75NTR reverses remodelling and improves bladder function in a mouse model of diabetic voiding dysfunction. Diabetologia. [Epub ahead of print]. Application: Mouse bladder extracts (RIPA). Ryu JC et al. (2018). Role of proNGF/p75 signaling in bladder dysfunction after spinal cord injury. J Clin Invest. [Epub ahead of print]. Application: Mouse urine.
Specificity:
Mouse proNGF. Expected to detect rat proNGF due to high degree of sequence homology. Detects human proNGF (about 20% reactivity). Does not cross-react with proBDNF and mature NGF.
The Biosensis Mouse and Rat proNGF Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the quantification of rodent full-length proNGF protein in less than 4 hours in cell culture supernatants and cell lysates only if used as directed. Please refer to the kit protocol for specific use instructions for each substrate application. This ELISA kit contains a recombinant mouse proNGF standard expressed in E.coli and consists of a pre-coated anti-proNGF capture antibody, a biotinylated anti-NGF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product which is directly proportional to the concentration of proNGF present in samples and protein standards. This ELISA kit is expected to detect rat proNGF due to high degree of homology (96%) with mouse proNGF based on amino acid sequence, and the ability of this kit in detecting proNGF in rat PC12 cell lysates. In the absence of a true rat proNGF standard, results may be expressed as 'mouse proNGF equivalents'. This ELISA kit shows only 20% reactivity with the human form of proNGF and is therefore not suitable to quantify human proNGF. No cross-reactivity was observed with mature mouse NGF and full-length proBDNF when tested in assay buffer. The antibodies used in this ELISA kit bind epitopes within the pro-domain (capture) and mature domain (detection) of the protein, thus this ELISA assay does not detect the pro-domain peptide. This kit has not been tested for other applications. Sufficient amount of proNGF standard is supplied to allow for spike- and recovery experiments in order to validate this ELISA assay for other sample matrices if required. This kit has been configured for research use only and is not to be used in diagnostic or clinical procedures.
Background Info:
Nerve growth factor (NGF) is synthesized as a precursor (proNGF) which may be released and have physiological functions to cause cell death. It binds neurotrophin receptor p75 and sortilin and may also be important for the development of nervous system. proNGF is synthesized in target tissues and glia, transported retrogradely and may be released.
Product Type:
ELISA Assay
Species Reactivity:
Mouse,Rat
Immunogen:
Recombinant mouse, wild-type proNGF protein, made in E.coli
Applications:
ELISA
Application Details:
ELISA. For the quantification of Nerve growth factor, pro- (proNGF) in Culture Supernatant, Cell Lysates, Tissue Homogenates. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
Alternative Names:
pro-beta nerve growth factor; proNGF; NGF
Biosensis Brand:
Rapid
Detection Method:
Colorimetric
Shelf Life:
12 months from purchase.
Use:
For research use only.
Kit Components:
The ELISA kit box contains 96-well pre-coated strip plate(s), protein standards, detection reagents, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Luu BE et al. (2022) Modulation of diabetic kidney disease markers by an antagonist of p75NTR in streptozotocin-treated mice Gene. [Epub ahead of print]. Application: Mouse kidney RIPA homogenates. Mossa A et al. (2021). Adaptation to partial urethral obstruction in healthy aging LOU rats and the role of nerve growth factor signaling pathway in the bladder. Exp Gerontol. [Epub ahead of print]. Application: Rat urine. Sugimoto J et al. (2021). Fabry disease-associated globotriaosylceramide induces mechanical allodynia via activation of signaling through proNGF p75NTR but not mature NGF TrkA. Eur. J. Pharmacol. 895. Application: Mouse tissue homogenate (RIPA). Mossa AH et al. (2020). Antagonism of proNGF or its receptor p75NTR reverses remodelling and improves bladder function in a mouse model of diabetic voiding dysfunction. Diabetologia. [Epub ahead of print]. Application: Mouse bladder extracts (RIPA). Ryu JC et al. (2018). Role of proNGF/p75 signaling in bladder dysfunction after spinal cord injury. J Clin Invest. [Epub ahead of print]. Application: Mouse urine.
Specificity:
Mouse proNGF. Expected to detect rat proNGF due to high degree of sequence homology. Detects human proNGF (about 20% reactivity). Does not cross-react with proBDNF and mature NGF.
Typical limit of detection (LOD) for mouse proNGF is less than 50 pg/mL determined as blank value plus 3x standard deviation of blank OD (n=10).
Cross Reactivity:
Reacts with human proNGF (about 20% reactivity). Does not cross-react with proBDNF and mature NGF. Mature NGF spiked into brain homogenate does not interfere with proNGF quantification.
The Biosensis proBDNF Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the specific, fast and reliable quantification of proBDNF in less than 4 hours in cell culture supernatants, human serum and EDTA-plasma only if used as directed. Please refer to the kit protocol for specific use instructions for each substrate application, in particular human blood samples. This ELISA kit consists of a pre-coated monoclonal anti-proBDNF capture antibody, a biotinylated anti-matureBDNF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product which is directly proportional to the concentration of proBDNF present in samples and protein standards. A proBDNF positive control (QC sample) is provided to assure consistent assay performance. This proBDNF ELISA kit employs a recombinant, cleavage-resistant human proBDNF standard produced in mammalian cells by Biosensis and validated against externally available proBDNF proteins. Note that accurate proBDNF quantification in human serum and EDTA-plasma requires the addition of Heterophilic Antibody Blocker BL-004-500 provided in the kit, and available for purchase separately . This ELISA kit has not been tested for other applications. It has been configured for research use only and is not to be used for diagnostic or clinical procedures.
Background Info:
BDNF belongs to the neurotrophin family and regulates the survival and differentiation of neurons during development. The alterations in BDNF expression induced by various kinds of brain insult including stress, ischemia, seizure activity and hypoglycemia, may contribute to some pathologies such as depression, epilepsy, Alzheimer's, and Parkinson's disease. FUNCTION: Promotes the survival of neuronal populations that are all located either in the central nervous system or directly connected to it. Major regulator of synaptic transmission and plasticity at adult synapses in many regions of the CNS. The versatility of BDNF is emphasized by its contribution to a range of adaptive neuronal responses including long-term potentiation (LTP), long-term depression (LTD), certain forms of short-term synaptic plasticity, as well as homeostatic regulation of intrinsic neuronal excitability. SUBUNIT: Monomers and homodimers. Binds to NTRK2/TRKB. SUBCELLULAR LOCATION: Secreted protein. Post Translation Modification (PTM): The propeptide is N-glycosylated and glycosulfated. PTM: Converted into mature BDNF by plasmin (PLG) (By similarity). DISEASE: Defects in BDNF are a cause of congenital central hypoventilation syndrome (CCHS); also known as congenital failure of autonomic control or Ondine curse. CCHS is a rare disorder characterized by abnormal control of respiration in the absence of neuromuscular or lung disease, or an identifiable brain stem lesion. A deficiency in autonomic control of respiration results in inadequate or negligible ventilatory and arousal responses to hypercapnia and hypoxemia. CCHS is frequently complicated with neurocristopathies such as Hirschsprung disease that occurs in about 16% of CCHS cases. SIMILARITY: Belongs to the NGF-beta family.
Product Type:
ELISA Assay
Species Reactivity:
Human,Mouse,Rat
Immunogen:
Human recombinant proBDNF, mutated to be cleavage-resistant, made in 293F cells
Applications:
ELISA
Application Details:
ELISA. For the quantification of Brain-derived neurotrophic factor, pro- (proBDNF) in Culture Supernatant, Serum, Plasma (Citrate), Plasma (EDTA), Cell Lysates, Tissue Homogenates. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
The ELISA kit box contains 96-well pre-coated strip plate(s), protein standards, QC sample, detection reagents, heterophilic antibody blocker, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Tsotsoros CE et al. (2022) Pilot Associations between Adverse Childhood Experiences, Executive Function, and Brain-Derived Neurotrophic Factor (BDNF) among Adults with Excess Adiposity Obesities. 2, 276-284. Application: Human, serum. Freidle M et al. (2022) Behavioural and neuroplastic effects of a double-blind randomised controlled balance exercise trial in people with Parkinson's disease. NPJ Parkinsons Dis. 8(1):12. Application: Human, serum. March B et al. (2021) ELISA-based quantification of neurotrophic growth factors in urine from prostate cancer patients. FASEB Bioadv. [Epub ahead of print]. Application: Human, urine. Yi X et al. (2021) Serum mBDNF and ProBDNF Expression Levels as Diagnosis Clue for Early Stage Parkinson's Disease. Front Neurol. 12:680765. Application: Human, serum. Nomura S et al. (2021) Effects of a Tea Cultivar "MK5601" on Behaviors and Hippocampal Neurotrophin-3 Levels in Middle-Aged Mice. J Nutr Sci Vitaminol (Tokyo). 67(3):170-179. Application: Mouse, hippocampal RIPA homogenates. Li P et al. (2021) Intermediation of perceived stress between early trauma and plasma M/P ratio levels in obsessive-compulsive disorder patients. J Affect Disord. 285:105-111 Application: Human, plasma. Lai NS et al. (2021) Increased Serum Levels of Brain-Derived Neurotrophic Factor Contribute to Inflammatory Responses in Patients with Rheumatoid Arthritis. Int. J. Mol. Sci. 22(4):1841 Application: Human, serum and culture supernatants. Fukumoto M et al. (2019) Induction of brain-derived neurotrophic factor in enteric glial cells stimulated by interleukin-1? via a c-Jun N-terminal kinase pathway. J. Clin. Biochem. Nutr. [Epub ahead of print]. Application: Human, culture supernatant.
Specificity:
Human proBDNF. The capture antibody used in this ELISA kit binds to an epitope within the pro-domain of proBDNF. Thus, this ELISA detects the full length form of proBDNF and does not quantify mature BDNF. Whether this ELISA kit can detect truncated BDNF is unknown at present. Mature BDNF cross-reactivity was assessed by spiking 28 kDa mature BDNF protein obtained from WHO (www.nibsc.org) into a 1/5 diluted human serum sample at 5 ng/mL, which represents a BDNF concentration level of 25 ng/mL in undiluted, normal human serum. Cross-reactivity of mature BDNF was The assay antibodies do not cross-react with nerve growth factor (NGF), neurotrophin-3 (NT-3) or NT-4/5.
Typical limit of detection (LOD) for proBDNF is 6 pg/mL determined as 150% of the blank value.
Cross Reactivity:
Mature BDNF cross-reactivity was assessed by spiking 28 kDa mature BDNF protein obtained from WHO (www.nibsc.org) into a 1/5 diluted human serum sample at 5 ng/mL, which represents a BDNF concentration level of 25 ng/mL in undiluted, normal human serum. Cross-reactivity of mature BDNF was < 0.3% (w/v), or < 0.1% in molar concentration.<br><br>The assay antibodies do not cross-react with nerve growth factor (NGF), neurotrophin-3 (NT-3) or NT-4/5.
The Biosensis proBDNF Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the specific, fast and reliable quantification of proBDNF in less than 4 hours in cell culture supernatants, human serum and EDTA-plasma only if used as directed. Please refer to the kit protocol for specific use instructions for each substrate application, in particular human blood samples. This ELISA kit consists of a pre-coated monoclonal anti-proBDNF capture antibody, a biotinylated anti-matureBDNF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product which is directly proportional to the concentration of proBDNF present in samples and protein standards. A proBDNF positive control (QC sample) is provided to assure consistent assay performance. This proBDNF ELISA kit employs a recombinant, cleavage-resistant human proBDNF standard produced in mammalian cells by Biosensis and validated against externally available proBDNF proteins. Note that accurate proBDNF quantification in human serum and EDTA-plasma requires the addition of Heterophilic Antibody Blocker BL-004-500 provided in the kit, and available for purchase separately . This ELISA kit has not been tested for other applications. It has been configured for research use only and is not to be used for diagnostic or clinical procedures.
Background Info:
BDNF belongs to the neurotrophin family and regulates the survival and differentiation of neurons during development. The alterations in BDNF expression induced by various kinds of brain insult including stress, ischemia, seizure activity and hypoglycemia, may contribute to some pathologies such as depression, epilepsy, Alzheimer's, and Parkinson's disease. FUNCTION: Promotes the survival of neuronal populations that are all located either in the central nervous system or directly connected to it. Major regulator of synaptic transmission and plasticity at adult synapses in many regions of the CNS. The versatility of BDNF is emphasized by its contribution to a range of adaptive neuronal responses including long-term potentiation (LTP), long-term depression (LTD), certain forms of short-term synaptic plasticity, as well as homeostatic regulation of intrinsic neuronal excitability. SUBUNIT: Monomers and homodimers. Binds to NTRK2/TRKB. SUBCELLULAR LOCATION: Secreted protein. Post Translation Modification (PTM): The propeptide is N-glycosylated and glycosulfated. PTM: Converted into mature BDNF by plasmin (PLG) (By similarity). DISEASE: Defects in BDNF are a cause of congenital central hypoventilation syndrome (CCHS); also known as congenital failure of autonomic control or Ondine curse. CCHS is a rare disorder characterized by abnormal control of respiration in the absence of neuromuscular or lung disease, or an identifiable brain stem lesion. A deficiency in autonomic control of respiration results in inadequate or negligible ventilatory and arousal responses to hypercapnia and hypoxemia. CCHS is frequently complicated with neurocristopathies such as Hirschsprung disease that occurs in about 16% of CCHS cases. SIMILARITY: Belongs to the NGF-beta family.
Product Type:
ELISA Assay
Species Reactivity:
Human,Mouse,Rat
Immunogen:
Human recombinant proBDNF, mutated to be cleavage-resistant, made in 293F cells
Applications:
ELISA
Application Details:
ELISA. For the quantification of Brain-derived neurotrophic factor, pro- (proBDNF) in Culture Supernatant, Serum, Plasma (Citrate), Plasma (EDTA), Cell Lysates, Tissue Homogenates. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
The ELISA kit box contains 96-well pre-coated strip plate(s), protein standards, QC sample, detection reagents, heterophilic antibody blocker, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Tsotsoros CE et al. (2022) Pilot Associations between Adverse Childhood Experiences, Executive Function, and Brain-Derived Neurotrophic Factor (BDNF) among Adults with Excess Adiposity Obesities. 2, 276-284. Application: Human, serum. Freidle M et al. (2022) Behavioural and neuroplastic effects of a double-blind randomised controlled balance exercise trial in people with Parkinson's disease. NPJ Parkinsons Dis. 8(1):12. Application: Human, serum. March B et al. (2021) ELISA-based quantification of neurotrophic growth factors in urine from prostate cancer patients. FASEB Bioadv. [Epub ahead of print]. Application: Human, urine. Yi X et al. (2021) Serum mBDNF and ProBDNF Expression Levels as Diagnosis Clue for Early Stage Parkinson's Disease. Front Neurol. 12:680765. Application: Human, serum. Nomura S et al. (2021) Effects of a Tea Cultivar "MK5601" on Behaviors and Hippocampal Neurotrophin-3 Levels in Middle-Aged Mice. J Nutr Sci Vitaminol (Tokyo). 67(3):170-179. Application: Mouse, hippocampal RIPA homogenates. Li P et al. (2021) Intermediation of perceived stress between early trauma and plasma M/P ratio levels in obsessive-compulsive disorder patients. J Affect Disord. 285:105-111 Application: Human, plasma. Lai NS et al. (2021) Increased Serum Levels of Brain-Derived Neurotrophic Factor Contribute to Inflammatory Responses in Patients with Rheumatoid Arthritis. Int. J. Mol. Sci. 22(4):1841 Application: Human, serum and culture supernatants. Fukumoto M et al. (2019) Induction of brain-derived neurotrophic factor in enteric glial cells stimulated by interleukin-1? via a c-Jun N-terminal kinase pathway. J. Clin. Biochem. Nutr. [Epub ahead of print]. Application: Human, culture supernatant.
Specificity:
Human proBDNF. The capture antibody used in this ELISA kit binds to an epitope within the pro-domain of proBDNF. Thus, this ELISA detects the full length form of proBDNF and does not quantify mature BDNF. Whether this ELISA kit can detect truncated BDNF is unknown at present. Mature BDNF cross-reactivity was assessed by spiking 28 kDa mature BDNF protein obtained from WHO (www.nibsc.org) into a 1/5 diluted human serum sample at 5 ng/mL, which represents a BDNF concentration level of 25 ng/mL in undiluted, normal human serum. Cross-reactivity of mature BDNF was The assay antibodies do not cross-react with nerve growth factor (NGF), neurotrophin-3 (NT-3) or NT-4/5.
Typical limit of detection (LOD) for proBDNF is 6 pg/mL determined as 150% of the blank value.
Cross Reactivity:
Mature BDNF cross-reactivity was assessed by spiking 28 kDa mature BDNF protein obtained from WHO (www.nibsc.org) into a 1/5 diluted human serum sample at 5 ng/mL, which represents a BDNF concentration level of 25 ng/mL in undiluted, normal human serum. Cross-reactivity of mature BDNF was < 0.3% (w/v), or < 0.1% in molar concentration.<br><br>The assay antibodies do not cross-react with nerve growth factor (NGF), neurotrophin-3 (NT-3) or NT-4/5.
The Biosensis NGFR/p75 ECD Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit s a sandwich ELISA that allows the quantification of the extracellular domain (ECD) of human p75 neurotrophin receptor in less than 4 hours in urine only if used as directed. Please refer to the kit protocol for specific use instructions for urine application. This ELISA kit consists of a pre-coated mouse monoclonal anti-p75 ECD capture antibody, a biotinylated mouse monoclonal anti-p75 ECD detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product which is directly proportional to the concentration of p75 ECD present in samples and protein standards. A human p75 ECD positive control (QC sample) is provided to assure consistent assay performance. This NGFR/p75 ECD ELISA kit employs a recombinant human p75 ECD -Fc chimera. While there is a current lack of a commercially available, true human p75 ECD standard, this ELISA kit allows quantification of human p75 ECD as p75 ECD -Fc human equivalents. Please note that the antibodies used in this ELISA do not cross-react with mouse p75 ECD . Note: For research use only. Not for diagnostic and clinical purposes. Receive a 20% discount on the Biosensis Creatinine (Urinary) Colorimetric Assay Kit (CRE-001) if purchased together with this ELISA kit in one transaction. To receive a quote, contact us at sales@biosensis.com .
Background Info:
The nerve growth factor (NGF) receptor (NGFR), also known as p75 neurotrophin receptor (p75NTR; TNFRS16; CD271) is a common receptor for the neurotrophins NGF, BDNF, NT-3 and NT-4/5. In neurons, p75NTR mediates a variety of physiological functions including survival, apoptosis, neurite outgrowth and synaptic plasticity. A potential pathological role for p75NTR has become evident in recent years. Altered p75NTR expression levels are implicated in degeneration of spinal motor neurons in human and mouse models of amyotrophic lateral sclerosis (ALS). Importantly, the extracellular domain of p75NTR (p75ECD) is shed from the cell membrane and excreted in urine. Recent findings further suggest that p75ECD could be an early biomarker for ALS in humans, as significantly elevated p75ECD levels are found in urine of ALS patients as compared to healthy controls.
Product Type:
ELISA Assay
Species Reactivity:
Human
Immunogen:
Recombinant human p75 (AA 1-250) -Fc chimera, made in 293 cells
Applications:
ELISA
Application Details:
ELISA. For the quantification of Nerve growth factor receptor, extracellular domain (NGFR/p75ECD) in Urine. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
The Biosensis NGFR/p75 ECD Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit s a sandwich ELISA that allows the quantification of the extracellular domain (ECD) of human p75 neurotrophin receptor in less than 4 hours in urine only if used as directed. Please refer to the kit protocol for specific use instructions for urine application. This ELISA kit consists of a pre-coated mouse monoclonal anti-p75 ECD capture antibody, a biotinylated mouse monoclonal anti-p75 ECD detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a colored reaction product which is directly proportional to the concentration of p75 ECD present in samples and protein standards. A human p75 ECD positive control (QC sample) is provided to assure consistent assay performance. This NGFR/p75 ECD ELISA kit employs a recombinant human p75 ECD -Fc chimera. While there is a current lack of a commercially available, true human p75 ECD standard, this ELISA kit allows quantification of human p75 ECD as p75 ECD -Fc human equivalents. Please note that the antibodies used in this ELISA do not cross-react with mouse p75 ECD . Note: For research use only. Not for diagnostic and clinical purposes. Receive a 20% discount on the Biosensis Creatinine (Urinary) Colorimetric Assay Kit (CRE-001) if purchased together with this ELISA kit in one transaction. To receive a quote, contact us at sales@biosensis.com .
Background Info:
The nerve growth factor (NGF) receptor (NGFR), also known as p75 neurotrophin receptor (p75NTR; TNFRS16; CD271) is a common receptor for the neurotrophins NGF, BDNF, NT-3 and NT-4/5. In neurons, p75NTR mediates a variety of physiological functions including survival, apoptosis, neurite outgrowth and synaptic plasticity. A potential pathological role for p75NTR has become evident in recent years. Altered p75NTR expression levels are implicated in degeneration of spinal motor neurons in human and mouse models of amyotrophic lateral sclerosis (ALS). Importantly, the extracellular domain of p75NTR (p75ECD) is shed from the cell membrane and excreted in urine. Recent findings further suggest that p75ECD could be an early biomarker for ALS in humans, as significantly elevated p75ECD levels are found in urine of ALS patients as compared to healthy controls.
Product Type:
ELISA Assay
Species Reactivity:
Human
Immunogen:
Recombinant human p75 (AA 1-250) -Fc chimera, made in 293 cells
Applications:
ELISA
Application Details:
ELISA. For the quantification of Nerve growth factor receptor, extracellular domain (NGFR/p75ECD) in Urine. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
The Biosensis Mature BDNF/proBDNF Combo Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit combines individual, but complementary ELISA kits for the two most important BDNF isoforms: Mature BDNF ( BEK-2211 ) and full-length proBDNF ( BEK-2217 ). Both kits are sandwich ELISAs, useful for the quantification of mature BDNF and proBDNF in less than 4 hours in cell culture supernatants, serum, plasma (citrate), cell lysates and brain extracts only if used as directed, with a simplified protocol and no loss of sensitivity or specificity. Please refer to the most current kit protocols for BEK-2211 (Mature BDNF Rapid TM ELISA) and BEK-2217 (proBDNF Rapid TM ELISA), for specific use instructions for each substrate application, in particular blood samples. For human blood samples, we suggest the use of BEK-2241 (Mature BDNF/proBDNF Combo kit) . The Mature BDNF ELISA kit consists of a pre-coated mouse monoclonal anti-mature BDNF capture antibody, a biotinylated anti-mature BDNF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The proBDNF ELISA kit consists of a pre-coated polyclonal anti-proBDNF capture antibody, a biotinylated anti-mature BDNF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a coloured reaction product which is directly proportional to the concentration of mature BDNF or proBDNF present in samples and protein standards. A BDNF and proBDNF positive control (QC sample) is provided to assure consistent assay performance. Both ELISA kits contain high quality protein calibrators. The Mature BDNF ELISA kit employs a recombinant E.coli-derived human mature BDNF standard approved by the World Health Organization (WHO, www.nibsc.org). The amino acid sequence of mature BDNF is identical for human, mouse, rat and a number of other species. This kit therefore is suitable to measure mature BDNF in all these species and uses the same antibodies and antigen. The proBDNF ELISA kit employs a recombinant mammalian, cleavage-resistant human proBDNF standard produced by Biosensis and validated against externally available proBDNF proteins. Due to a high degree of amino acid sequence homology, mouse and rat proBDNF can be quantified and expressed as human proBDNF equivalents. Internal Biosensis validation suggests that the use of the human standard provided in this kit will provide estimates that are identical, or close, to the actual levels of rat and mouse proBDNF present in rodent samples. Note that accurate proBDNF quantification in human serum and citrate-plasma requires the addition of Heterophilic Antibody Blocker BL-004-500 provided in the kit, and available for purchase separately. This ELISA kit has not been tested for other applications. It has been configured for research use only and is not to be used for diagnostic or clinical procedures.
Background Info:
BDNF belongs to the neurotrophin family and regulates the survival and differentiation of neurons during development. The alterations in BDNF expression induced by various kinds of brain insult including stress, ischemia, seizure activity and hypoglycemia, may contribute to some pathologies such as depression, epilepsy, Alzheimer's, and Parkinson's disease. FUNCTION: Promotes the survival of neuronal populations that are all located either in the central nervous system or directly connected to it. Major regulator of synaptic transmission and plasticity at adult synapses in many regions of the CNS. The versatility of BDNF is emphasized by its contribution to a range of adaptive neuronal responses including long-term potentiation (LTP), long-term depression (LTD), certain forms of short-term synaptic plasticity, as well as homeostatic regulation of intrinsic neuronal excitability. SUBUNIT: Monomers and homodimers. Binds to NTRK2/TRKB. SUBCELLULAR LOCATION: Secreted protein. Post Translation Modification (PTM): The propeptide is N-glycosylated and glycosulfated. PTM: Converted into mature BDNF by plasmin (PLG) (By similarity). DISEASE: Defects in BDNF are a cause of congenital central hypoventilation syndrome (CCHS); also known as congenital failure of autonomic control or Ondine curse. CCHS is a rare disorder characterized by abnormal control of respiration in the absence of neuromuscular or lung disease, or an identifiable brain stem lesion. A deficiency in autonomic control of respiration results in inadequate or negligible ventilatory and arousal responses to hypercapnia and hypoxemia. CCHS is frequently complicated with neurocristopathies such as Hirschsprung disease that occurs in about 16% of CCHS cases. SIMILARITY: Belongs to the NGF-beta family.
Product Type:
ELISA Assay
Species Reactivity:
Human,Mouse,Rat
Immunogen:
See BEK-2211 & BEK-2217 for specific details
Applications:
ELISA
Application Details:
ELISA. For the quantification of Mature BDNF and proBDNF in Culture Supernatant, Serum, Plasma (Citrate), Cell Lysates, Tissue Homogenates. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
The ELISA kit box contains 2 x 96-well pre-coated strip plates per kit (1 x BDNF antibody, 1 x proBDNF antibody coated plate), protein standards, QC sample, detection reagents, heterophilic antibody blocker, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Sharma GP et al. (2021) Brain-derived neurotrophic factor promotes immune reconstitution following radiation injury via activation of bone marrow mesenchymal stem cells. PLoS One. 16(10):e0259042 Application: Mouse, culture supernatant. Weaver KR et al. (2021) Neuronal-enriched extracellular vesicles in individuals with IBS: A pilot study of COMT and BDNF. Neurogastroenterol Motil. [Epub ahead of print] Application: Human, plasma, extracellular vesicles.
Specificity:
Mature BDNF ELISA: Human, mouse, rat BDNF and numerous other species. Although the BDNF assay antibodies are raised against the mature domain, the mature BDNF ELISA preferentially detects mature BDNF over full-length proBDNF. proBDNF ELISA: Human, mouse and rat proBDNF. The capture antibody used in the proBDNF ELISA kit binds to epitopes within the pro-domain of proBDNF. Thus, this ELISA detects the full length and potentially truncated form of proBDNF, and does not quantify mature BDNF.
Typical limit of detection (LOD) for mature BDNF is less than 2 pg/mL, and 10 pg/mL for proBDNF determined as 150% of the blank value.
Cross Reactivity:
<b>Cross-reactivity of BDNF isoforms:</b><br><br><b>Mature BDNF ELISA:</b><br>No cross-reactivity is observed for nerve growth factor (NGF), neurotrophin-3 (NT-3), NT-4/5, glial cell line-derived neurotrophic factor (GDNF) and vascular endothelial growth factor (VEGF165) tested at 25 ng/mL in assay buffer. The reactivity of full-length proBDNF (0.125 ng/mL - 5 ng/mL) was determined in six independent assays using proBDNF proteins from four different sources (mammalian and bacterial, wild-type and mutated). The average cross-reactivity of proBDNF was found to be 5.3% +/- 0.5% in weight (w/v) concentration, or 12.1% +/- 1.2% in molar concentration (mean +/- SEM).<br><br><b>proBDNF ELISA:</b><br>A cross-reactivity of 2% in weight concentration (0.9% in molar concentration) has been observed for mature BDNF assayed at 25 ng/mL (893 pmol/L) in Assay Diluent A.Due to a high degree of sequence homology, this human proBDNF ELISA kit cross-reacts with the mouse and rat form of proBDNF. Other species have not yet been tested, but cross-reactivity with a wide range of mammalian forms of proBDNF is expected.The antibodies do not cross-react with nerve growth factor (NGF), neurotrophin-3 (NT-3) or NT-4/5.
The Biosensis Mature BDNF/proBDNF Combo Rapid TM enzyme-linked immunosorbent assay (ELISA) Kit combines individual, but complementary ELISA kits for the two most important BDNF isoforms: Mature BDNF ( BEK-2211 ) and full-length proBDNF ( BEK-2237 ). Both kits are sandwich ELISAs, useful for the quantification of mature BDNF and proBDNF in less than 4 hours in cell culture supernatants, serum, plasma (citrate and EDTA), mouse and rat cell lysates and rat brain extracts only if used as directed, with a simplified protocol and no loss of sensitivity or specificity. Please refer to the most current kit protocols for BEK-2211 (Mature BDNF Rapid TM ELISA) and BEK-2237 (proBDNF Rapid TM ELISA), for specific use instructions for each substrate application, in particular blood samples. BEK-2241 is the preferred Combo kit for human blood samples. The Mature BDNF ELISA kit consists of a pre-coated mouse monoclonal anti-mature BDNF capture antibody, a biotinylated anti-mature BDNF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The proBDNF ELISA kit consists of a pre-coated monoclonal anti-proBDNF capture antibody, a biotinylated anti-mature BDNF detection antibody and horseradish peroxidase (HRP)-conjugated streptavidin. The addition of a substrate (3,3',5,5'-tetramethylbenzidine, TMB) yields a coloured reaction product which is directly proportional to the concentration of mature BDNF or proBDNF present in samples and protein standards. A BDNF and proBDNF positive control (QC sample) is provided to assure consistent assay performance. Both ELISA kits contain high quality protein calibrators. The Mature BDNF ELISA kit employs a recombinant E.coli-derived human mature BDNF standard approved by the World Health Organization (WHO, www.nibsc.org). The amino acid sequence of mature BDNF is identical for human, mouse, rat and a number of other species. This kit therefore is suitable to measure mature BDNF in all these species and uses the same antibodies and antigen. The proBDNF ELISA kit employs a recombinant mammalian, cleavage-resistant human proBDNF standard produced by Biosensis and validated against externally available proBDNF proteins. Due to a high degree of amino acid sequence homology, mouse and rat proBDNF can be quantified and expressed as human proBDNF equivalents. Internal Biosensis validation suggests that the use of the human standard provided in this kit will provide estimates that are identical, or close, to the actual levels of rat and mouse proBDNF present in rodent samples. Note that accurate proBDNF quantification in human serum and citrate-plasma requires the addition of Heterophilic Antibody Blocker BL-004-500 provided in the kit, and available for purchase separately. This ELISA kit has not been tested for other applications. It has been configured for research use only and is not to be used for diagnostic or clinical procedures.
Background Info:
BDNF belongs to the neurotrophin family and regulates the survival and differentiation of neurons during development. The alterations in BDNF expression induced by various kinds of brain insult including stress, ischemia, seizure activity and hypoglycemia, may contribute to some pathologies such as depression, epilepsy, Alzheimer's, and Parkinson's disease. FUNCTION: Promotes the survival of neuronal populations that are all located either in the central nervous system or directly connected to it. Major regulator of synaptic transmission and plasticity at adult synapses in many regions of the CNS. The versatility of BDNF is emphasized by its contribution to a range of adaptive neuronal responses including long-term potentiation (LTP), long-term depression (LTD), certain forms of short-term synaptic plasticity, as well as homeostatic regulation of intrinsic neuronal excitability. SUBUNIT: Monomers and homodimers. Binds to NTRK2/TRKB. SUBCELLULAR LOCATION: Secreted protein. Post Translation Modification (PTM): The propeptide is N-glycosylated and glycosulfated. PTM: Converted into mature BDNF by plasmin (PLG) (By similarity). DISEASE: Defects in BDNF are a cause of congenital central hypoventilation syndrome (CCHS); also known as congenital failure of autonomic control or Ondine curse. CCHS is a rare disorder characterized by abnormal control of respiration in the absence of neuromuscular or lung disease, or an identifiable brain stem lesion. A deficiency in autonomic control of respiration results in inadequate or negligible ventilatory and arousal responses to hypercapnia and hypoxemia. CCHS is frequently complicated with neurocristopathies such as Hirschsprung disease that occurs in about 16% of CCHS cases. SIMILARITY: Belongs to the NGF-beta family.
Product Type:
ELISA Assay
Species Reactivity:
Human,Mouse,Rat
Immunogen:
See BEK-2211 & BEK-2237 for specific details
Applications:
ELISA
Application Details:
ELISA. For the quantification of Mature BDNF and proBDNF in Culture Supernatant, Serum, Plasma (Citrate), Plasma (EDTA), Cell Lysates, Tissue Homogenates. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
Alternative Names:
Brain-derived neurotrophic factor; Abrineurin
Biosensis Brand:
Rapid
Detection Method:
Colorimetric
Shelf Life:
12 months after date of receipt unopened.
Use:
For research use only.
Kit Components:
The ELISA kit box contains 2 x 96-well pre-coated strip plates per kit (1 x BDNF antibody, 1 x proBDNF antibody coated plate), protein standards, QC sample, detection reagents, heterophilic antibody blocker, wash and sample buffers, substrate buffer and detailed protocols.
Product references:
Please refer to BEK-2211 (Mature BDNF Rapid TM ELISA Kit) and BEK-2237 (proBDNF Rapid TM ELISA Kit) .
Specificity:
Mature BDNF ELISA: Human, mouse, rat BDNF and numerous other species. Although the BDNF assay antibodies are raised against the mature domain, the mature BDNF ELISA preferentially detects mature BDNF over full-length proBDNF.
proBDNF ELISA: Human, mouse and rat proBDNF. The capture antibody used in the proBDNF ELISA kit binds to epitopes within the pro-domain of proBDNF. Thus, this ELISA detects the full length and potentially truncated form of proBDNF, and does not quantify mature BDNF.
Typical limit of detection (LOD) for mature BDNF is less than 2 pg/mL, and 6 pg/mL for proBDNF determined as 150% of the blank value.
Cross Reactivity:
<b>Cross-reactivity of BDNF isoforms:</b><br><br><b>Mature BDNF ELISA:</b><br>No cross-reactivity is observed for nerve growth factor (NGF), neurotrophin-3 (NT-3), NT-4/5, glial cell line-derived neurotrophic factor (GDNF) and vascular endothelial growth factor (VEGF165) tested at 25 ng/mL in assay buffer. The reactivity of full-length proBDNF (0.125 ng/mL - 5 ng/mL) was determined in six independent assays using proBDNF proteins from four different sources (mammalian and bacterial, wild-type and mutated). The average cross-reactivity of proBDNF was found to be 5.3% +/- 0.5% in weight (w/v) concentration, or 12.1% +/- 1.2% in molar concentration (mean +/- SEM).<br><br><b>proBDNF ELISA:</b><br>Mature BDNF cross-reactivity was assessed by spiking 28 kDa mature BDNF protein obtained from WHO (www.nibsc.org) into a 1/5 diluted human serum sample at 5 ng/mL, which represents a BDNF concentration level of 25 ng/mL in undiluted, normal human serum. Cross-reactivity of mature BDNF was < 0.3% (w/v), or < 0.1% in molar concentration. The assay antibodies do not cross-react with nerve growth factor (NGF), neurotrophin-3 (NT-3) or NT-4/5.
?-Casein is expressed as 13 genetic variants resulting from single nucleotide polymorphisms (SNP) in the CSN2 gene. The most frequent genetic variants in western dairy breeds are ?-Casein A1 and ?-Casein A2. The two types of ?-Casein protein, A1 and A2, differ by a single-point mutation at amino acid position 82 (P82/H82). The Biosensis Bovine A1 ?-Casein enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the quantification of the bovine A1 ?-Casein isoform in 5 hours. This kit consists of a pre-coated rabbit anti-Bovine ?-Casein polyclonal capture antibody, a chicken anti-bovine A1 ?-Casein detection antibody and a horseradish peroxidase (HRP)-conjugated donkey anti-chicken IgY antibody. The addition of a substrate (3,3',5,5' -tetramethylbenzidine, TMB) yields a coloured reaction product which is directly proportional to the concentration of Bovine A1 ?-Casein present in samples and protein standards. Extensive validation has shown accurate quantification of A1 ?-Casein in UHT (Ultra High Temperature) treated milk or long life milk, organic pasteurized and homogenized full cream milk, fresh pasteurized and homogenized milk, cold-pressed raw milk (non-pasteurized, non-homogenized), and biodynamic full-cream whole milk. Please refer to the kit protocol for specific use instructions. The A2 isoform is not detected in this ELISA assay.
Product Type:
ELISA Assay
Species Reactivity:
Bovine
Immunogen:
Purified bovine beta Casein and peptide specific peptides for A1
Applications:
ELISA
Application Details:
ELISA. For the quantification of A1 Beta casein (A1) in Bovine Milk. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
Alternative Names:
CSN2; Bovine A1 Beta Casein; A1;
Biosensis Brand:
Biosensis®
Detection Method:
Colorimetric
Shelf Life:
12 months after date of receipt unopened.
Use:
For research use only.
Kit Components:
The ELISA kit box contains 96-well pre-coated strip plate(s), protein standards, detection reagents, wash and sample buffers, substrate buffer, stop solution and detailed protocols.
Specificity:
Bovine A1 beta-casein
Storage:
Store at 2-8°C
Range:
3.1 - 200 ng/mL
Sample Type:
Bovine Milk
Sensitivity:
This bovine A1 beta-casein ELISA kit detects a minimum of 3 ng/mL A1 beta-casein in assay buffer (defined as A1 concentration at blank OD plus 3x standard deviations of the blank OD (n=10))
Cross Reactivity:
No cross-reactivity is observed with bovine A2 beta-Casein
?-Casein is expressed as 13 genetic variants resulting from single nucleotide polymorphisms (SNP) in the CSN2 gene. The most frequent genetic variants in western dairy breeds are ?-Casein A1 and ?-Casein A2. The two types of ?-Casein protein, A1 and A2, differ by a single-point mutation at amino acid position 82 (P82/H82). The Biosensis Bovine A1 ?-Casein enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the quantification of the bovine A1 ?-Casein isoform in 5 hours. This kit consists of a pre-coated rabbit anti-Bovine ?-Casein polyclonal capture antibody, a chicken anti-bovine A1 ?-Casein detection antibody and a horseradish peroxidase (HRP)-conjugated donkey anti-chicken IgY antibody. The addition of a substrate (3,3',5,5' -tetramethylbenzidine, TMB) yields a coloured reaction product which is directly proportional to the concentration of Bovine A1 ?-Casein present in samples and protein standards. Extensive validation has shown accurate quantification of A1 ?-Casein in UHT (Ultra High Temperature) treated milk or long life milk, organic pasteurized and homogenized full cream milk, fresh pasteurized and homogenized milk, cold-pressed raw milk (non-pasteurized, non-homogenized), and biodynamic full-cream whole milk. Please refer to the kit protocol for specific use instructions. The A2 isoform is not detected in this ELISA assay.
Product Type:
ELISA Assay
Species Reactivity:
Bovine
Immunogen:
Purified bovine beta Casein and peptide specific peptides for A1
Applications:
ELISA
Application Details:
ELISA. For the quantification of A1 Beta casein (A1) in Bovine Milk. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
Alternative Names:
CSN2; Bovine A1 Beta Casein; A1;
Biosensis Brand:
Biosensis®
Detection Method:
Colorimetric
Shelf Life:
12 months after date of receipt unopened.
Use:
For research use only.
Kit Components:
The ELISA kit box contains 96-well pre-coated strip plate(s), protein standards, detection reagents, wash and sample buffers, substrate buffer, stop solution and detailed protocols.
Specificity:
Bovine A1 beta-casein
Storage:
Store at 2-8°C
Range:
3.1 - 200 ng/mL
Sample Type:
Bovine Milk
Sensitivity:
This bovine A1 beta-casein ELISA kit detects a minimum of 3 ng/mL A1 beta-casein in assay buffer (defined as A1 concentration at blank OD plus 3x standard deviations of the blank OD (n=10)).
Cross Reactivity:
No cross-reactivity is observed with bovine A2 beta-Casein.
?-Casein is expressed as 13 genetic variants resulting from single nucleotide polymorphisms (SNP) in the CSN2 gene. The most frequent genetic variants in western dairy breeds are ?-Casein A1 and ?-Casein A2. The two types of ?-Casein protein, A1 and A2, differ by a single-point mutation at amino acid position 82 (P82/H82). The Biosensis Bovine A1 ?-Casein enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the quantification of the bovine A1 ?-Casein isoform in 5 hours. This kit consists of a pre-coated rabbit anti-Bovine ?-Casein polyclonal capture antibody, a chicken anti-bovine A1 ?-Casein detection antibody and a horseradish peroxidase (HRP)-conjugated donkey anti-chicken IgY antibody. The addition of a substrate (3,3',5,5' -tetramethylbenzidine, TMB) yields a coloured reaction product which is directly proportional to the concentration of Bovine A1 ?-Casein present in samples and protein standards. Extensive validation has shown accurate quantification of A1 ?-Casein in UHT (Ultra High Temperature) treated milk or long life milk, organic pasteurized and homogenized full cream milk, fresh pasteurized and homogenized milk, cold-pressed raw milk (non-pasteurized, non-homogenized), and biodynamic full-cream whole milk. Please refer to the kit protocol for specific use instructions. The A2 isoform is not detected in this ELISA assay.
Product Type:
ELISA Assay
Species Reactivity:
Bovine
Immunogen:
Purified bovine beta Casein and peptide specific peptides for A1
Applications:
ELISA
Application Details:
ELISA. For the quantification of A1 Beta casein (A1) in Bovine Milk. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
Alternative Names:
CSN2; Bovine A1 Beta Casein; A1;
Biosensis Brand:
Biosensis®
Detection Method:
Colorimetric
Shelf Life:
12 months after date of receipt unopened.
Use:
For research use only.
Kit Components:
The ELISA kit box contains 96-well pre-coated strip plate(s), protein standards, detection reagents, wash and sample buffers, substrate buffer, stop solution and detailed protocols.
Specificity:
Bovine A1 beta-casein
Storage:
Store at 2-8°C
Range:
3.1 - 200 ng/mL
Sample Type:
Bovine Milk
Sensitivity:
This bovine A1 beta-casein ELISA kit detects a minimum of 3 ng/mL A1 beta-casein in assay buffer (defined as A1 concentration at blank OD plus 3x standard deviations of the blank OD (n=10)).
Cross Reactivity:
No cross-reactivity is observed with bovine A2 beta-Casein.
?-Casein is expressed as 13 genetic variants resulting from single nucleotide polymorphisms (SNP) in the CSN2 gene. The most frequent genetic variants in western dairy breeds are ?-Casein A1 and ?-Casein A2. The two types of ?-Casein protein, A1 and A2, differ by a single-point mutation at amino acid position 82 (P82/H82). The Biosensis Bovine A1 ?-Casein enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the quantification of the bovine A1 ?-Casein isoform in 5 hours. This kit consists of a pre-coated rabbit anti-Bovine ?-Casein polyclonal capture antibody, a chicken anti-bovine A1 ?-Casein detection antibody and a horseradish peroxidase (HRP)-conjugated donkey anti-chicken IgY antibody. The addition of a substrate (3,3',5,5' -tetramethylbenzidine, TMB) yields a coloured reaction product which is directly proportional to the concentration of Bovine A1 ?-Casein present in samples and protein standards. Extensive validation has shown accurate quantification of A1 ?-Casein in UHT (Ultra High Temperature) treated milk or long life milk, organic pasteurized and homogenized full cream milk, fresh pasteurized and homogenized milk, cold-pressed raw milk (non-pasteurized, non-homogenized), and biodynamic full-cream whole milk. Please refer to the kit protocol for specific use instructions. The A2 isoform is not detected in this ELISA assay.
Product Type:
ELISA Assay
Species Reactivity:
Bovine
Immunogen:
Purified bovine beta Casein and peptide specific peptides for A1
Applications:
ELISA
Application Details:
ELISA. For the quantification of A1 Beta casein (A1) in Bovine Milk. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
Alternative Names:
CSN2; Bovine A1 Beta Casein; A1;
Biosensis Brand:
Biosensis®
Detection Method:
Colorimetric
Shelf Life:
12 months after date of receipt unopened.
Use:
For research use only.
Kit Components:
The ELISA kit box contains 96-well pre-coated strip plate(s), protein standards, detection reagents, wash and sample buffers, substrate buffer, stop solution and detailed protocols.
Specificity:
Bovine A1 beta-casein
Storage:
Store at 2-8°C
Range:
3.1 - 200 ng/mL
Sample Type:
Bovine Milk
Sensitivity:
This bovine A1 beta-casein ELISA kit detects a minimum of 3 ng/mL A1 beta-casein in assay buffer (defined as A1 concentration at blank OD plus 3x standard deviations of the blank OD (n=10))
Cross Reactivity:
No cross-reactivity is observed with bovine A2 beta-Casein
?-Casein is expressed as 13 genetic variants resulting from single nucleotide polymorphisms (SNP) in the CSN2 gene. The most frequent genetic variants in western dairy breeds are ?-Casein A1 and ?-Casein A2. The two types of ?-Casein protein, A1 and A2, differ by a single-point mutation at amino acid position 82 (P82/H82). The Biosensis Bovine A2 ?-Casein enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the quantification of the bovine A2 ?-Casein isoform in 5 hours. This kit consists of a pre-coated rabbit anti-bovine ?-Casein polyclonal capture antibody, a chicken anti-bovine A2 ?-Casein detection antibody and a horseradish peroxidase (HRP)-conjugated donkey anti-chicken IgY antibody. The addition of a substrate (3,3',5,5' -tetramethylbenzidine, TMB) yields a coloured reaction product which is directly proportional to the concentration of Bovine A2 ?-Casein present in samples and protein standards. Extensive validation has shown accurate quantification of A2 ?-Casein in full cream milk, skim milk and reconstituted A2 milk powder. Please refer to the kit protocol for specific use instructions. The A1 isoform is not detected in this ELISA assay.
Product Type:
ELISA Assay
Species Reactivity:
Bovine
Immunogen:
Purified bovine beta Casein and peptide specific peptides for A2
Applications:
ELISA
Application Details:
ELISA. For the quantification of A2 Beta casein (A2) in Bovine Milk. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
Alternative Names:
CSN2; Bovine A2 Beta Casein; A2;
Biosensis Brand:
Biosensis®
Detection Method:
Colorimetric
Shelf Life:
12 months after date of receipt unopened.
Use:
For research use only.
Kit Components:
The ELISA kit box contains 96-well pre-coated strip plate(s), protein standards, detection reagents, wash and sample buffers, substrate buffer, stop solution and detailed protocols.
Specificity:
Bovine A2 beta-casein
Storage:
Store at 2-8°C
Range:
3.1 - 200 ng/mL
Sample Type:
Bovine Milk
Sensitivity:
This bovine A2 beta-casein ELISA kit detects a minimum of 2 ng/mL A2 beta-casein in assay buffer (defined as A1 concentration at blank OD plus 3x standard deviations of the blank OD (n=10))
Cross Reactivity:
No cross-reactivity is observed with bovine A1 beta-Casein
?-Casein is expressed as 13 genetic variants resulting from single nucleotide polymorphisms (SNP) in the CSN2 gene. The most frequent genetic variants in western dairy breeds are ?-Casein A1 and ?-Casein A2. The two types of ?-Casein protein, A1 and A2, differ by a single-point mutation at amino acid position 82 (P82/H82). The Biosensis Bovine A2 ?-Casein enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the quantification of the bovine A2 ?-Casein isoform in 5 hours. This kit consists of a pre-coated rabbit anti-bovine ?-Casein polyclonal capture antibody, a chicken anti-bovine A2 ?-Casein detection antibody and a horseradish peroxidase (HRP)-conjugated donkey anti-chicken IgY antibody. The addition of a substrate (3,3',5,5' -tetramethylbenzidine, TMB) yields a coloured reaction product which is directly proportional to the concentration of Bovine A2 ?-Casein present in samples and protein standards. Extensive validation has shown accurate quantification of A2 ?-Casein in full cream milk, skim milk and reconstituted A2 milk powder. Please refer to the kit protocol for specific use instructions. The A1 isoform is not detected in this ELISA assay.
Product Type:
ELISA Assay
Species Reactivity:
Bovine
Immunogen:
Purified bovine beta Casein and peptide specific peptides for A2
Applications:
ELISA
Application Details:
ELISA. For the quantification of A2 Beta casein (A2) in Bovine Milk. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
Alternative Names:
CSN2; Bovine A2 Beta Casein; A2;
Biosensis Brand:
Biosensis®
Detection Method:
Colorimetric
Shelf Life:
12 months after date of receipt unopened.
Use:
For research use only.
Kit Components:
The ELISA kit box contains 96-well pre-coated strip plate(s), protein standards, detection reagents, wash and sample buffers, substrate buffer, stop solution and detailed protocols.
Specificity:
Bovine A2 beta-casein
Storage:
Store at 2-8°C
Range:
3.1 - 200 ng/mL
Sample Type:
Bovine Milk
Sensitivity:
This bovine A2 beta-casein ELISA kit detects a minimum of 2 ng/mL A2 beta-casein in assay buffer (defined as A1 concentration at blank OD plus 3x standard deviations of the blank OD (n=10))
Cross Reactivity:
No cross-reactivity is observed with bovine A1 beta-Casein.
?-Casein is expressed as 13 genetic variants resulting from single nucleotide polymorphisms (SNP) in the CSN2 gene. The most frequent genetic variants in western dairy breeds are ?-Casein A1 and ?-Casein A2. The two types of ?-Casein protein, A1 and A2, differ by a single-point mutation at amino acid position 82 (P82/H82). The Biosensis Bovine A2 ?-Casein enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the quantification of the bovine A2 ?-Casein isoform in 5 hours. This kit consists of a pre-coated rabbit anti-bovine ?-Casein polyclonal capture antibody, a chicken anti-bovine A2 ?-Casein detection antibody and a horseradish peroxidase (HRP)-conjugated donkey anti-chicken IgY antibody. The addition of a substrate (3,3',5,5' -tetramethylbenzidine, TMB) yields a coloured reaction product which is directly proportional to the concentration of Bovine A2 ?-Casein present in samples and protein standards. Extensive validation has shown accurate quantification of A2 ?-Casein in full cream milk, skim milk and reconstituted A2 milk powder. Please refer to the kit protocol for specific use instructions. The A1 isoform is not detected in this ELISA assay.
Product Type:
ELISA Assay
Species Reactivity:
Bovine
Immunogen:
Purified bovine beta Casein and peptide specific peptides for A2
Applications:
ELISA
Application Details:
ELISA. For the quantification of A2 Beta casein (A2) in Bovine Milk. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
Alternative Names:
CSN2; Bovine A2 Beta Casein; A2;
Biosensis Brand:
Biosensis®
Detection Method:
Colorimetric
Shelf Life:
12 months after date of receipt unopened.
Use:
For research use only.
Kit Components:
The ELISA kit box contains 96-well pre-coated strip plate(s), protein standards, detection reagents, wash and sample buffers, substrate buffer, stop solution and detailed protocols.
Specificity:
Bovine A2 beta-casein
Storage:
Store at 2-8°C
Range:
3.1 - 200 ng/mL
Sample Type:
Bovine Milk
Sensitivity:
This bovine A2 beta-casein ELISA kit detects a minimum of 2 ng/mL A2 beta-casein in assay buffer (defined as A1 concentration at blank OD plus 3x standard deviations of the blank OD (n=10)).
Cross Reactivity:
No cross-reactivity is observed with bovine A1 beta-Casein.
?-Casein is expressed as 13 genetic variants resulting from single nucleotide polymorphisms (SNP) in the CSN2 gene. The most frequent genetic variants in western dairy breeds are ?-Casein A1 and ?-Casein A2. The two types of ?-Casein protein, A1 and A2, differ by a single-point mutation at amino acid position 82 (P82/H82). The Biosensis Bovine A2 ?-Casein enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the quantification of the bovine A2 ?-Casein isoform in 5 hours. This kit consists of a pre-coated rabbit anti-bovine ?-Casein polyclonal capture antibody, a chicken anti-bovine A2 ?-Casein detection antibody and a horseradish peroxidase (HRP)-conjugated donkey anti-chicken IgY antibody. The addition of a substrate (3,3',5,5' -tetramethylbenzidine, TMB) yields a coloured reaction product which is directly proportional to the concentration of Bovine A2 ?-Casein present in samples and protein standards. Extensive validation has shown accurate quantification of A2 ?-Casein in full cream milk, skim milk and reconstituted A2 milk powder. Please refer to the kit protocol for specific use instructions. The A1 isoform is not detected in this ELISA assay.
Product Type:
ELISA Assay
Species Reactivity:
Bovine
Immunogen:
Purified bovine beta Casein and peptide specific peptides for A2
Applications:
ELISA
Application Details:
ELISA. For the quantification of A2 Beta casein (A2) in Bovine Milk. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
Alternative Names:
CSN2; Bovine A2 Beta Casein; A2;
Biosensis Brand:
Biosensis®
Detection Method:
Colorimetric
Shelf Life:
12 months after date of receipt unopened.
Use:
For research use only.
Kit Components:
The ELISA kit box contains 96-well pre-coated strip plate(s), protein standards, detection reagents, wash and sample buffers, substrate buffer, stop solution and detailed protocols.
Specificity:
Bovine A2 beta-casein
Storage:
Store at 2-8°C
Range:
3.1 - 200 ng/mL
Sample Type:
Bovine Milk
Sensitivity:
This bovine A2 beta-casein ELISA kit detects a minimum of 2 ng/mL A2 beta-casein in assay buffer (defined as A1 concentration at blank OD plus 3x standard deviations of the blank OD (n=10)).
Cross Reactivity:
No cross-reactivity is observed with bovine A1 beta-Casein.
The Blook gel illumination system for the visualisation of DNA gels stained with ethidium bromide or alternatives such as NovelJuice (cat no LD001). This CE marked Blue Light LED system is more reliable than UV lamp transilluminators as the LEDs have a life time of 30,000 hours of continual use. The unit also includes an Amber filter to allow visualisation of the gel whilst protecting the eyes. The Blook has no external powerpack and takes up a minimal amount of bench space. Plus it is so light it can be stored on a standard lab shelf easily when not in use.
[SPECIFICATIONS] Dimensions (mm): 210D X 210W X 30H >> Viewing surface (mm): 120 X 70 >> Wavelength (nm): 470 >> Amber filter: amber filter shield with metal frame >> LED arrangements: matrix for two-side illumination >> LED lifetime:50,000 hours >> Power: No external power supply required >> Compatible with mini gel size (mm): 110 X 60 & 55 X 60 >> Weight (kg): 2.3 >>
BL-001-1250 contains a proprietary mixture of proteins and buffer reagents designed to reduce the sIgA cross-reactivity present in certain substrates such as milk. Following ELISA assays in the Biosensis Rapid TM ELISA range have been validated to achieve accurate results using BL-001-1250: BEK-2211, Mature BDNF; Application: human milk One vial of BL-001-1250 contains 1250 ?g of proprietary immunoglobulins, which is sufficient as sample diluent additive for one 96-well plate. Other ELISA assays may also benefit from addition of blocker BL-001-1250, but require optimization of working concentration and assay validation for accurate results.
Product Type:
Immunoassay Blocker
Format:
Lyophilized.
Species Reactivity:
Human
Applications:
ELISA
Application Details:
Immunoassay blocker to reduce or eliminate secretory IgA (sIgA) interference in sandwich ELISA assays for validated sample applications.
Biosensis Brand:
Biosensis®
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Storage:
Store unopened vial at 2-8°C.
Purification:
Purified
Target:
Secretory IgA immunoassay Blocker for BEK-2211 and similar ELISA assays
BL-002-1250 contains a proprietary mixture of proteins and buffer reagents designed to reduce heterophilic interactions in ELISA assays utilizing mouse immunoreagents. One vial of BL-002-1250 contains 1250 ?g IgG which is sufficient as sample diluent additive for one 96-well plate if used at 50 ?g/mL. Optimal blocker concentration needs to be validated by the end-user for accurate results.
Product Type:
Immunoassay Blocker
Format:
Lyophilized.
Species Reactivity:
Human
Applications:
ELISA
Application Details:
Immunoassay blocker to reduce or eliminate heterophilic antibody interference in sandwich ELISA assays utilizing mouse antibodies.
Biosensis Brand:
Biosensis®
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Storage:
Store unopened vial at 2-8°C.
Purification:
Purified
Target:
Heterophilic antibody immunoassay blocker for BEK-2219 and similar ELISA assays
BL-003-1000 contains a proprietary mixture of proteins and buffer reagents designed to reduce heterophilic interactions in ELISA assays utilizing a combination of sheep and mouse immunoreagents. Following ELISA assays in the Biosensis Rapid TM ELISA range have been validated to achieve accurate results using BL-003-1000: BEK-2226, Human proNGF; Application: Serum, Heparin-Plasma BEK-2218, Human NT4/5; Application: Citrate-Plasma One vial of BL-003-1000 contains 1000 ?g IgG which is sufficient as sample diluent additive for one 96-well plate. Other ELISA assays that use sheep and mouse assay antibodies may also benefit from addition of blocker BL-003-1000, but require optimization of working concentration and assay validation for accurate results.
Product Type:
Immunoassay Blocker
Format:
Lyophilized.
Species Reactivity:
Human
Applications:
ELISA
Application Details:
Immunoassay blocker to reduce or eliminate heterophilic antibody interference in sandwich ELISA assays for validated sample applications.
Biosensis Brand:
Biosensis®
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Storage:
Store unopened vial at 2-8°C.
Purification:
Purified
Target:
Heterophilic antibody immunoassay blocker for BEK-2226 & BEK-2218 and similar ELISA assays
BL-004-500 contains a proprietary mixture of proteins and buffer reagents designed to reduce heterophilic interactions in ELISA assays utilizing sheep immunoreagents. Following ELISA assays in the Biosensis Rapid TM ELISA range have been validated to achieve accurate results using BL-004-500: BEK-2217/2240, Human proBDNF; Application: Serum, Citrate-Plasma BEK-2221, Human NT3; Application: Plasma (Citrate and EDTA) BEK-2237, Human proBDNF; Application: Serum, EDTA-Plasma One vial of BL-004-500 contains 500 ?g IgG which is sufficient as sample diluent additive for one 96-well plate. Other ELISA assays that use sheep assay antibodies may also benefit from addition of blocker BL-004-500, but require optimization of working concentration and assay validation for accurate results.
Product Type:
Immunoassay Blocker
Format:
Lyophilized.
Species Reactivity:
Human
Applications:
ELISA
Application Details:
Immunoassay blocker to reduce or eliminate heterophilic antibody interference in sandwich ELISA assays for validated sample applications.
Biosensis Brand:
Biosensis®
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Storage:
Store unopened vial at 2-8°C.
Purification:
Purified
Target:
Heterophilic antibody immunoassay blocker for BEK-2217, BEK-2221, BEK-2237 & BEK-2240 and similar ELISA assays
BL-005-500 contains a proprietary mixture of proteins and buffer reagents designed to reduce heterophilic interactions in ELISA assays utilizing mouse immunoreagents. Following ELISA assays in the Biosensis Rapid TM ELISA range have been validated to achieve accurate results using BL-005-500: BEK-2212, Human NGF; Application: Citrate-Plasma One vial of BL-005-500 contains 500 ?g IgG which is sufficient as sample diluent additive for one 96-well plate. Other ELISA assays that use mouse assay antibodies may also benefit from addition of blocker BL-005-500, but require optimization of working concentration and assay validation for accurate results.
Product Type:
Immunoassay Blocker
Format:
Lyophilized.
Species Reactivity:
Human
Applications:
ELISA
Application Details:
Immunoassay blocker to reduce or eliminate heterophilic antibody interference in sandwich ELISA assays for validated sample applications.
Biosensis Brand:
Biosensis®
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Storage:
Store unopened vial at 2-8°C.
Purification:
Purified
Target:
Heterophilic antibody immunoassay blocker for BEK-2212 and similar ELISA assays
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Country Of Origin:
Normal Bovine Serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Country Of Origin:
Normal Bovine Serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Country Of Origin:
Normal Bovine Serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Cytokeratin 20 (CK20) is expressed in enterocytes and goblet cells of the gastrointestinal (GI) tract. It is also expressed in specific types of simple epithelial cells of the urinary tract. CK20 is useful marker of colorectal carcinoma, gastric, pancreas, urothelium, merkel and biliary system carcinomas.
Cytokeratin 20 (CK20) is expressed in enterocytes and goblet cells of the gastrointestinal (GI) tract. It is also expressed in specific types of simple epithelial cells of the urinary tract. CK20 is useful marker of colorectal carcinoma, gastric, pancreas, urothelium, merkel and biliary system carcinomas.
B-cell lymphoma/leukaemia-2 (Bcl-2) is an inhibitor of apoptosis, and its expression is generally abundant in cells which dividing and differentiating. In lymphatic tissue, Bcl-2 is highly expressed in T-cells, maturating B cells as well as mature B-cells. However, expression level in germinal center B-cells is downregulated. Overexpression of the Bcl-2 is common in leukemia and various carcinomas and sarcomas. Overexpression is common especially in non-Hodgkins lymphoma. Bcl-2 is helpful to classification of the follicular lymphoma or other lymphomas
B-cell lymphoma/leukaemia-2 (Bcl-2) is an inhibitor of apoptosis, and its expression is generally abundant in cells which dividing and differentiating. In lymphatic tissue, Bcl-2 is highly expressed in T-cells, maturating B cells as well as mature B-cells. However, expression level in germinal center B-cells is downregulated. Overexpression of the Bcl-2 is common in leukemia and various carcinomas and sarcomas. Overexpression is common especially in non-Hodgkins lymphoma. Bcl-2 is helpful to classification of the follicular lymphoma or other lymphomas
Napsin A is an aspartic proteinase that is expressed predominantly in lung (type II pneumocytes) and kidney and lower levels in spleen and blood leukocytes. Alveolar macrophages also contain Napsin A due phagosytosis of pneumocytes. Napsin A in useful especially in the differential diagnosis of lung adenocarcinoma between squamous cell carcinoma.
Napsin A is an aspartic proteinase that is expressed predominantly in lung (type II pneumocytes) and kidney and lower levels in spleen and blood leukocytes. Alveolar macrophages also contain Napsin A due phagosytosis of pneumocytes. Napsin A in useful especially in the differential diagnosis of lung adenocarcinoma between squamous cell carcinoma.
Melan-A (MART-1) is a transmembrane protein which is recognized by autologous cytotoxic T lymphocytes. Melan a is expressed in skin melanocytes and melanocyte lineages. This antibody is useful for the identification of melanomas and it should be included into standard melanoma panel for diagnostic. This antibody not cross react with cells of adrenal cortex.
Melan-A (MART-1) is a transmembrane protein which is recognized by autologous cytotoxic T lymphocytes. Melan a is expressed in skin melanocytes and melanocyte lineages. This antibody is useful for the identification of melanomas and it should be included into standard melanoma panel for diagnostic. This antibody not cross react with cells of adrenal cortex.
CD7 transmembrane protein is a member of the immunoglobulin superfamily. This protein is found on thymocytes, mature T cells and NK-cells. It plays an essential role in T-cell interactions and also in T-cell/B-cell interaction during early lymphoid development.
CD7 transmembrane protein is a member of the immunoglobulin superfamily. This protein is found on thymocytes, mature T cells and NK-cells. It plays an essential role in T-cell interactions and also in T-cell/B-cell interaction during early lymphoid development.
The CD20 antigen is present on human pre B lymphocytes and on B lymphocytes at all stages of maturation, except on plasma cells. Low level expression of the CD20 antigen has been detected on subpopulation of T lymphocytes. CD20 is expressed widely in the large majority of cases of B-cell leukaemia and lymphoma. The CD20 molecule is involved in regulation of B cell differentiation, presumably via its reported function as a Ca++ channel subunit.
The CD20 antigen is present on human pre B lymphocytes and on B lymphocytes at all stages of maturation, except on plasma cells. Low level expression of the CD20 antigen has been detected on subpopulation of T lymphocytes. CD20 is expressed widely in the large majority of cases of B-cell leukaemia and lymphoma. The CD20 molecule is involved in regulation of B cell differentiation, presumably via its reported function as a Ca++ channel subunit.
CD34 is a transmembrane glycoprotein with a molecular mass of approximately 110 kD that is selectively expressed on human hematopoietic progenitor cells, endothelial cells and some fibroblasts. It could act as a scaffold for the attachment of lineage specific glycans, allowing stem cells to bind to lectins expressed by stromal cells or other marrow components. CD34 is highly expressed on hematopoietic progenitors, as well as on endothelial cells. CD34 has been used to measure angiogenesis, which reportedly predicts tumor recurrence.
CD34 is a transmembrane glycoprotein with a molecular mass of approximately 110 kD that is selectively expressed on human hematopoietic progenitor cells, endothelial cells and some fibroblasts. It could act as a scaffold for the attachment of lineage specific glycans, allowing stem cells to bind to lectins expressed by stromal cells or other marrow components. CD34 is highly expressed on hematopoietic progenitors, as well as on endothelial cells. CD34 has been used to measure angiogenesis, which reportedly predicts tumor recurrence.
CD22 protein may be involved in the localization of B-cells in lymphoid tissues. CD22 is expressed in the cytoplasm and cell membrane of B-cells. CD22 is especially useful in diagnostics of hairy cell leukemia and classification of the B-cell lymphomas.
CD22 protein may be involved in the localization of B-cells in lymphoid tissues. CD22 is expressed in the cytoplasm and cell membrane of B-cells. CD22 is especially useful in diagnostics of hairy cell leukemia and classification of the B-cell lymphomas.
Insulin is a pancreatic hormone that regulates glucose level in blood and it is involved in the synthesis of proteins and fat. Insulin increases cell permeability to monosaccharides, amino acids, and fatty acids. It accelerates glycolysis, the pentose phosphate cycle, and glycogen synthesis in liver. Insulin is a heterodimer of a B chain and A chain linked by two disulfide bonds. Defects in insulin are the cause of familial hyperproinsulinemia. Insulin is present on the insulin secreted beta cells in islets of Langerhans.
Insulin is a pancreatic hormone that regulates glucose level in blood and it is involved in the synthesis of proteins and fat. Insulin increases cell permeability to monosaccharides, amino acids, and fatty acids. It accelerates glycolysis, the pentose phosphate cycle, and glycogen synthesis in liver. Insulin is a heterodimer of a B chain and A chain linked by two disulfide bonds. Defects in insulin are the cause of familial hyperproinsulinemia. Insulin is present on the insulin secreted beta cells in islets of Langerhans.
CD43 (leukosialin, sialophorin) is a transmembrane mucin-like glycoprotein which expressed in plasma membrane especially in T-lymphocytes, some B-cells and cells from myelomonolineage. It is useful for lymphoma diagnostic and it expressed in most T-cell lymphomas and some B-cell lymphomas.
CD43 (leukosialin, sialophorin) is a transmembrane mucin-like glycoprotein which expressed in plasma membrane especially in T-lymphocytes, some B-cells and cells from myelomonolineage. It is useful for lymphoma diagnostic and it expressed in most T-cell lymphomas and some B-cell lymphomas.
Glutamine synthetase is enzyme which catalyzes the synthesis of glutamine from glutamate and ammonia in the liver tissue. In normal liver glutamine sythetase expressed in pericentral hepatocytes. Glutamine synthetase can be useful marker in hepatocellular carcinoma diagnostic with panel of other hepatocellular carcinoma markers.
Glutamine synthetase is enzyme which catalyzes the synthesis of glutamine from glutamate and ammonia in the liver tissue. In normal liver glutamine sythetase expressed in pericentral hepatocytes. Glutamine synthetase can be useful marker in hepatocellular carcinoma diagnostic with panel of other hepatocellular carcinoma markers.
Beta-Catenin is a member of catenin family together with alpha and gamma catenin. It mediates cell-cell adhesion with cadherins and it is key regulatory protein in signaling through the WNT pathway. Beta catenin has a role in cellular proliferation, differentiation and development. Mutations in beta catenin gene (CTNNB1) leads accumulation of the beta catenin protein in cytoplasm and nucleus in different type of tumors eg. endometrial carcinoma and desmoid tumors. This antibody is useful in differentiation diagnostic of tumors.
Beta-Catenin is a member of catenin family together with alpha and gamma catenin. It mediates cell-cell adhesion with cadherins and it is key regulatory protein in signaling through the WNT pathway. Beta catenin has a role in cellular proliferation, differentiation and development. Mutations in beta catenin gene (CTNNB1) leads accumulation of the beta catenin protein in cytoplasm and nucleus in different type of tumors eg. endometrial carcinoma and desmoid tumors. This antibody is useful in differentiation diagnostic of tumors.
SOX2 is a transcription factor which is a member of SRY-related HMG-box (SOX) family. It has a role in the regulation of embryonic development and pluripotency of stem cells. It can be useful especially in lung squamous cell carcinoma diagnostic with panel of other relative markers of squamous carcinoma like P63/P40 and CK5/CK14 for example.
SOX2 is a transcription factor which is a member of SRY-related HMG-box (SOX) family. It has a role in the regulation of embryonic development and pluripotency of stem cells. It can be useful especially in lung squamous cell carcinoma diagnostic with panel of other relative markers of squamous carcinoma like P63/P40 and CK5/CK14 for example.
CD11c is cell surface transmembrane receptor which is mostly expressed on granulocytes, macrophages, monocytes, NK-cells, and some of T- and B-lymphocytes. CD11c is useful especially for diagnosis of hairy cell leukemia (HCL). CD11c can be offer great value for detection panel of HCL with DBA.44, CD103 and other HCL markers
CD11c is cell surface transmembrane receptor which is mostly expressed on granulocytes, macrophages, monocytes, NK-cells, and some of T- and B-lymphocytes. CD11c is useful especially for diagnosis of hairy cell leukemia (HCL). CD11c can be offer great value for detection panel of HCL with DBA.44, CD103 and other HCL markers
Cytokeratin 7 (CK7) is a protein that in humans is encoded by the KRT7 gene. CK7 is a member of the keratin family and it is specifically expressed in the simple epithelia lining the cavities of the internal organs and in the gland ducts. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains co-expressed during differentiation of simple and stratified epithelial tissues. IHC staining of cytokeratin 7 is useful for carcinoma diagnostic especially for differential diagnosis of urothelial, lung, breast carcinomas to colorectal or prostate carcinomas. CK7 is especially marker of lung adenocarcinoma. Pancreas is the good tissue control for CK7.
Cytokeratin 7 (CK7) is a protein that in humans is encoded by the KRT7 gene. CK7 is a member of the keratin family and it is specifically expressed in the simple epithelia lining the cavities of the internal organs and in the gland ducts. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains co-expressed during differentiation of simple and stratified epithelial tissues. IHC staining of cytokeratin 7 is useful for carcinoma diagnostic especially for differential diagnosis of urothelial, lung, breast carcinomas to colorectal or prostate carcinomas. CK7 is especially marker of lung adenocarcinoma. Pancreas is the good tissue control for CK7.
The protein encoded by this gene is the CD3-epsilon polypeptide, which together with CD3-gamma, -delta and -zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T-cell receptor-CD3 complex. This complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. The genes encoding the epsilon, gamma and delta polypeptides are located in the same cluster on chromosome 11. The epsilon polypeptide plays an essential role in T-cell development. CD3e is an important pan T-cell marker for the classification of malignant lymphomas and lymphoid leukaemias.
The protein encoded by this gene is the CD3-epsilon polypeptide, which together with CD3-gamma, -delta and -zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T-cell receptor-CD3 complex. This complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. The genes encoding the epsilon, gamma and delta polypeptides are located in the same cluster on chromosome 11. The epsilon polypeptide plays an essential role in T-cell development. CD3e is an important pan T-cell marker for the classification of malignant lymphomas and lymphoid leukaemias.
CD7 transmembrane protein is a member of the immunoglobulin superfamily. This protein is found on thymocytes, mature T cells and NK-cells. It plays an essential role in T-cell interactions and also in T-cell/B-cell interaction during early lymphoid development.
CD7 transmembrane protein is a member of the immunoglobulin superfamily. This protein is found on thymocytes, mature T cells and NK-cells. It plays an essential role in T-cell interactions and also in T-cell/B-cell interaction during early lymphoid development.
The human leukocyte differentiation antigen CD23 (FCER2) is a key molecule for B-cell activation and growth. It is the low-affinity receptor for IgE. The truncated molecule can be secreted, then functioning as a potent mitogenic growth factor. It is expressed on most mature, conventional B cells (but not on peritoneal CD5+ B cells), and can also be found on the surface of T cells, macrophages, platelets and EBV transformed B lymphoblasts. Expression of CD23 has been detected in neoplastic cells from cases of B cell chronic Lymphocytic leukemia. CD23 is expressed by B cells in the follicular mantle zone but not by proliferating germinal centre cells. CD23 is also expressed by eosinophils. CD23 is distinct from the high affinity IgE receptors found on basophils and mast cells, which mediate allergic reactions. The low affinity receptors are thought to play a role in isotype specific immunoregulation. The regulation of CD23 surface expression appears to be integral with the complex IgE system, which involves interactions of cells, cytokines, antibodies and regulatory factors.
The human leukocyte differentiation antigen CD23 (FCER2) is a key molecule for B-cell activation and growth. It is the low-affinity receptor for IgE. The truncated molecule can be secreted, then functioning as a potent mitogenic growth factor. It is expressed on most mature, conventional B cells (but not on peritoneal CD5+ B cells), and can also be found on the surface of T cells, macrophages, platelets and EBV transformed B lymphoblasts. Expression of CD23 has been detected in neoplastic cells from cases of B cell chronic Lymphocytic leukemia. CD23 is expressed by B cells in the follicular mantle zone but not by proliferating germinal centre cells. CD23 is also expressed by eosinophils. CD23 is distinct from the high affinity IgE receptors found on basophils and mast cells, which mediate allergic reactions. The low affinity receptors are thought to play a role in isotype specific immunoregulation. The regulation of CD23 surface expression appears to be integral with the complex IgE system, which involves interactions of cells, cytokines, antibodies and regulatory factors.
Cell adhesion molecule with an important role in the development of the nervous system. The L1, neural cell adhesion molecule (L1CAM) plays an important role in axon growth, fasciculation, neural migration and in mediating neuronal differentiation. L1 protein is expressed to tissues arising from neuroectoderm. L1CAM plays also an important role in the malignancy of human tumors and according to several studies, L1CAM positive carcinomas have a bad prognosis. L1CAM is overexpressed in many human carcinomas but it is useful especially in endometrium carcinoma diagnostic.
Cell adhesion molecule with an important role in the development of the nervous system. The L1, neural cell adhesion molecule (L1CAM) plays an important role in axon growth, fasciculation, neural migration and in mediating neuronal differentiation. L1 protein is expressed to tissues arising from neuroectoderm. L1CAM plays also an important role in the malignancy of human tumors and according to several studies, L1CAM positive carcinomas have a bad prognosis. L1CAM is overexpressed in many human carcinomas but it is useful especially in endometrium carcinoma diagnostic.
The p63 gene is a homologue of the p53 tumor suppressor gene. Like p53, p63 contains a transactivation (TA) domain induce the transcription of target genes, a DNA binding domain, and an oligomerization domain (OD), used to form tetramers. In contrast to p53, the p63 gene encodes for at least six major isotypes. Three isotypes (TAp63?, TAp63?, and TAp63?) contain the transactivating (TA) domain and are able to transactivate p53 report genes and induce apoptosis. In contrast, the other three isotypes (?Np63?, ?Np63?, ?Np63?) are transcribed from an internal promoter localized within intron3, lack the TA domain, and act as dominant-negatives to suppress transactivation by both p53 and TAp63 isotypes. p63 is highly expressed in the basal cells of the epithelium significant for proper limb outgrowth and morphogenesis.4 In differentiating tissues, p63 is crucial for maintaining the stem cell identity of the basal cells, and is indispensable for correct development of the skin as well as the limb. p63-deficient mice lack all squamous epithelia and their derivatives, including hair, whiskers, teeth, as well as mammary, lacrimal, and salivary glands.Tissue specificity: Widely expressed, notably in heart, kidney, placenta, prostate, skeletal muscle, testis and thymus, although the precise isoform varies according to tissue type. Progenitor cell layers of skin, breast, eye and prostate express high levels of DeltaN-type isoforms. Isoform 10 is predominantly expressed in skin squamous cell carcinomas, but not in normal skin tissues
The p63 gene is a homologue of the p53 tumor suppressor gene. Like p53, p63 contains a transactivation (TA) domain induce the transcription of target genes, a DNA binding domain, and an oligomerization domain (OD), used to form tetramers. In contrast to p53, the p63 gene encodes for at least six major isotypes. Three isotypes (TAp63?, TAp63?, and TAp63?) contain the transactivating (TA) domain and are able to transactivate p53 report genes and induce apoptosis. In contrast, the other three isotypes (?Np63?, ?Np63?, ?Np63?) are transcribed from an internal promoter localized within intron3, lack the TA domain, and act as dominant-negatives to suppress transactivation by both p53 and TAp63 isotypes. p63 is highly expressed in the basal cells of the epithelium significant for proper limb outgrowth and morphogenesis.4 In differentiating tissues, p63 is crucial for maintaining the stem cell identity of the basal cells, and is indispensable for correct development of the skin as well as the limb. p63-deficient mice lack all squamous epithelia and their derivatives, including hair, whiskers, teeth, as well as mammary, lacrimal, and salivary glands.Tissue specificity: Widely expressed, notably in heart, kidney, placenta, prostate, skeletal muscle, testis and thymus, although the precise isoform varies according to tissue type. Progenitor cell layers of skin, breast, eye and prostate express high levels of DeltaN-type isoforms. Isoform 10 is predominantly expressed in skin squamous cell carcinomas, but not in normal skin tissues
The CD79 protein is a heterodimer with two CD79a and CD79b phosphoproteins. CD79a is specific for B-cells. The antigen appearing before the pre-B cell stage and it is still expressed at the plasma cell stage. Together with CD20, CD79a is one the most important marker for B-cell neoplasms.
The CD79 protein is a heterodimer with two CD79a and CD79b phosphoproteins. CD79a is specific for B-cells. The antigen appearing before the pre-B cell stage and it is still expressed at the plasma cell stage. Together with CD20, CD79a is one the most important marker for B-cell neoplasms.
The CD4 is membrane glycoprotein (58kDa) and it is highly expressed on human T-helper lymphocytes and thymocytes, as well as at lower levels on cells from monocyte lineage. CD4 is useful marker for recognition of different subtypes of lymphocytes and in diagnostic for T-lymphoblastic lymphomas and histiocytic neoplasia.
The CD4 is membrane glycoprotein (58kDa) and it is highly expressed on human T-helper lymphocytes and thymocytes, as well as at lower levels on cells from monocyte lineage. CD4 is useful marker for recognition of different subtypes of lymphocytes and in diagnostic for T-lymphoblastic lymphomas and histiocytic neoplasia.
CD38 is a type II integral membrane glycoprotein which is present on early B and T cell lineages and activated B and T cells but is absent from most mature resting peripheral lymphocytes. CD38 is also found on thymocytes, pre-B cells, germinal center B cells, mitogen-activated T cells, monocytes and Ig-secreting plasma cells. On hematopoietic cells CD38 induces activation, proliferation, and differentiation of mature T and B cells and mediates apoptosis of myeloid and lymphoid progenitor cells. CD38 marker is useful for lymphoma diagnostic eg. using in plasmacytoma diagnostic.
CD38 is a type II integral membrane glycoprotein which is present on early B and T cell lineages and activated B and T cells but is absent from most mature resting peripheral lymphocytes. CD38 is also found on thymocytes, pre-B cells, germinal center B cells, mitogen-activated T cells, monocytes and Ig-secreting plasma cells. On hematopoietic cells CD38 induces activation, proliferation, and differentiation of mature T and B cells and mediates apoptosis of myeloid and lymphoid progenitor cells. CD38 marker is useful for lymphoma diagnostic eg. using in plasmacytoma diagnostic.
Beta-Catenin is a member of catenin family together with alpha and gamma catenin. It mediates cell-cell adhesion with cadherins and it is key regulatory protein in signaling through the WNT pathway. Beta catenin has a role in cellular proliferation, differentiation and development. Mutations in beta catenin gene (CTNNB1) leads accumulation of the beta catenin protein in cytoplasm and nucleus in different type of tumors eg. endometrial carcinoma and desmoid tumors. This antibody is useful in differentiation diagnostic of tumors.
Beta-Catenin is a member of catenin family together with alpha and gamma catenin. It mediates cell-cell adhesion with cadherins and it is key regulatory protein in signaling through the WNT pathway. Beta catenin has a role in cellular proliferation, differentiation and development. Mutations in beta catenin gene (CTNNB1) leads accumulation of the beta catenin protein in cytoplasm and nucleus in different type of tumors eg. endometrial carcinoma and desmoid tumors. This antibody is useful in differentiation diagnostic of tumors.
CK5 (keratin 5) is a member of the keratin gene family. Biochemically, most members of the CK family fall into one of two classes, type I (acidic polypeptides) and type II (basic polypeptides). The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the basal layer of the epidermis with family member KRT14. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. At least one member of the acidic family and one member of the basic family is expressed in all epithelial cells. Cytokeratin 5 is expressed in normal basal cells. Mutations of the Cytokeratin5 gene (KRT5) have been shown to result in the autosomal dominant disorderepidermolysis bullosa (EB). Defects in KRT5 are a cause of epidermolysis bullosa simplex.
CK5 (keratin 5) is a member of the keratin gene family. Biochemically, most members of the CK family fall into one of two classes, type I (acidic polypeptides) and type II (basic polypeptides). The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the basal layer of the epidermis with family member KRT14. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. At least one member of the acidic family and one member of the basic family is expressed in all epithelial cells. Cytokeratin 5 is expressed in normal basal cells. Mutations of the Cytokeratin5 gene (KRT5) have been shown to result in the autosomal dominant disorderepidermolysis bullosa (EB). Defects in KRT5 are a cause of epidermolysis bullosa simplex.
Cytokeratin 14 (CK14) is an acidic type I human intermediate filament protein. It mostly found in basal cells of squamous epithelia, myoepithelium, some glandular epithelia and mesothelial cells. Molecular weight of CK14 is 50 kDa, and it usually pairs with CK5, which is a type II (basic) cytokeratin. In neoplastic cells, CK14 is a useful marker especially in identification of basal cell epithelium in prostate and myoepithelium in breast. It also useful for detecting squamous cell carcinomas. CK5 and CK14 antibodies can be used as a cocktail as well.
Cytokeratin 14 (CK14) is an acidic type I human intermediate filament protein. It mostly found in basal cells of squamous epithelia, myoepithelium, some glandular epithelia and mesothelial cells. Molecular weight of CK14 is 50 kDa, and it usually pairs with CK5, which is a type II (basic) cytokeratin. In neoplastic cells, CK14 is a useful marker especially in identification of basal cell epithelium in prostate and myoepithelium in breast. It also useful for detecting squamous cell carcinomas. CK5 and CK14 antibodies can be used as a cocktail as well.
Granzyme B (GZMB), is the cell death-inducing serine protease, which expressed in the cytotoxic T lymphocytes and natural killer (NK) cells. Granzyme B is crucial for the rapid induction of target cell apoptosis and it has essential role in immunosurveillance. Granzyme B enters in the target cells with perforin, and results in the activation of apoptosis through caspase-dependent and -independent pathways. Granzyme B is the useful marker especially in NK/T-cell lymphomas.
Granzyme B (GZMB), is the cell death-inducing serine protease, which expressed in the cytotoxic T lymphocytes and natural killer (NK) cells. Granzyme B is crucial for the rapid induction of target cell apoptosis and it has essential role in immunosurveillance. Granzyme B enters in the target cells with perforin, and results in the activation of apoptosis through caspase-dependent and -independent pathways. Granzyme B is the useful marker especially in NK/T-cell lymphomas.
Mismatch repair proteins are nuclear enzymes which participate in repair of mismatch errors during DNA replication. Loss of Mismatch repair proteins increases the number of DNA replication errors in the proliferating cells. Errors occur especially in areas of the genome with short repetitive nucleotide sequences - causing microsatellite instability (MSI). MSH6 is a mismatch repair protein which is not expressed in a high proportion of patients with MSI-H. MSH6 antibody can be useful for immunohistochemical analyses of MSH6 protein in neoplastic tissues and identification of loss of MSH6. Immunohistochemical analysis of MSH6 should be performed in IHC panel together with MLH1, MSH2 and PMS2.
Mismatch repair proteins are nuclear enzymes which participate in repair of mismatch errors during DNA replication. Loss of Mismatch repair proteins increases the number of DNA replication errors in the proliferating cells. Errors occur especially in areas of the genome with short repetitive nucleotide sequences - causing microsatellite instability (MSI). MSH6 is a mismatch repair protein which is not expressed in a high proportion of patients with MSI-H. MSH6 antibody can be useful for immunohistochemical analyses of MSH6 protein in neoplastic tissues and identification of loss of MSH6. Immunohistochemical analysis of MSH6 should be performed in IHC panel together with MLH1, MSH2 and PMS2.
LI-Cadherin (Cadherin-17, CDH17), is liver-intestinal cadherin and it belongs to the cadherin superfamily. Structure and cellular locations of LI-Cadherin differs from other cadherins like E-CAD, N-CAD or P-CAD. LI-Cadherin is expressed in epithelium of appendix, colon, and intestine and it is not expressed in other normal tissues. LI-Cadherin is positive in carcinomas of colorectal carcinomas and some cases of gastric and pancreas adenocarcinoma.
LI-Cadherin (Cadherin-17, CDH17), is liver-intestinal cadherin and it belongs to the cadherin superfamily. Structure and cellular locations of LI-Cadherin differs from other cadherins like E-CAD, N-CAD or P-CAD. LI-Cadherin is expressed in epithelium of appendix, colon, and intestine and it is not expressed in other normal tissues. LI-Cadherin is positive in carcinomas of colorectal carcinomas and some cases of gastric and pancreas adenocarcinoma.
Carbonic anhydrase 9 (CA9) is a member of the zinc metalloenzymes that catalyse the reversible hydration of carbon dioxide and is anchored to cell membrane. CA9 is expressed in human gastrointestinal tract, chiefly in stomach, and bile ducts of liver. In neoplasia, high expression levels have been reported in different carcinomas, especially in clear-cell renal cell carcinoma. CA9 is also upregulated in hypoxia.
Carbonic anhydrase 9 (CA9) is a member of the zinc metalloenzymes that catalyse the reversible hydration of carbon dioxide and is anchored to cell membrane. CA9 is expressed in human gastrointestinal tract, chiefly in stomach, and bile ducts of liver. In neoplasia, high expression levels have been reported in different carcinomas, especially in clear-cell renal cell carcinoma. CA9 is also upregulated in hypoxia.
CD13 is a transmembrane protease which expressed widely in different tissues and cells. CD13 expressed especially cells of myeloid origin but also eg. in bile canaliculi of liver, fibroblasts, proximal tubules of kidney, and vascular endothelia. CD13 is useful marker for acute myeloid leukaemia (AML) and differentiating between hepatocellular carcinoma (HCC) and non-hepatocellular tumors.
CD13 is a transmembrane protease which expressed widely in different tissues and cells. CD13 expressed especially cells of myeloid origin but also eg. in bile canaliculi of liver, fibroblasts, proximal tubules of kidney, and vascular endothelia. CD13 is useful marker for acute myeloid leukaemia (AML) and differentiating between hepatocellular carcinoma (HCC) and non-hepatocellular tumors.
CD50 (ICAM-3) that is expressed in virtually all leukocytes, belongs to the family of the intercellular adhesion molecules. It is also shown to be important part in immune response initiation. CD50 is a useful marker for non-hodgkins lymphoma and it is expressed in almost all the tumors with tendency to be lost in high grade lymphomas.
CD50 (ICAM-3) that is expressed in virtually all leukocytes, belongs to the family of the intercellular adhesion molecules. It is also shown to be important part in immune response initiation. CD50 is a useful marker for non-hodgkins lymphoma and it is expressed in almost all the tumors with tendency to be lost in high grade lymphomas.
AIB-1 also known as allograft inflammation factor-1 is cytoplasmic actin and calcium binding protein that is expressed especially in activated macrophages and microglia, but also plays part in vascular smooth muscle cell activation and migration. In clinical use IBA-1 can be valuable marker of allograft rejection, macrophages and microglia.
AIB-1 also known as allograft inflammation factor-1 is cytoplasmic actin and calcium binding protein that is expressed especially in activated macrophages and microglia, but also plays part in vascular smooth muscle cell activation and migration. In clinical use IBA-1 can be valuable marker of allograft rejection, macrophages and microglia.
Cytokeratin 8, also known as CK8, is a member of the low molecular weight type II keratin family. Type I and type II keratins heteropolymerize to form intermediate-sized filaments in the cytoplasm of epithelial cells. CK8 typically dimerizes with CK18 to form an intermediate filament in simple single-layered epithelial cells. It is useful for especially diagnostic of most non-squamous epithelial tumors. squamous tumors are negative for this antibody as a rule.
Cytokeratin 8, also known as CK8, is a member of the low molecular weight type II keratin family. Type I and type II keratins heteropolymerize to form intermediate-sized filaments in the cytoplasm of epithelial cells. CK8 typically dimerizes with CK18 to form an intermediate filament in simple single-layered epithelial cells. It is useful for especially diagnostic of most non-squamous epithelial tumors. squamous tumors are negative for this antibody as a rule.
Phosphohistone H3 (Ser10) (PHH3) is a histone protein, which complexes with the other histones to form the major constituents of chromatin in eukaryotic cells. Phosphorylation of serine 10 amino acid residues in histone H3 occurs only during mitosis late G2 phase. PHH3 is a useful marker for mitoses in several types of tumors and it is useful for identifying mitotic figures in tumors accurately.
Phosphohistone H3 (Ser10) (PHH3) is a histone protein, which complexes with the other histones to form the major constituents of chromatin in eukaryotic cells. Phosphorylation of serine 10 amino acid residues in histone H3 occurs only during mitosis late G2 phase. PHH3 is a useful marker for mitoses in several types of tumors and it is useful for identifying mitotic figures in tumors accurately.
Cyclin D1, is cell cycle regulator and it is over expressed in a wide variety of human neoplasms. Cyclin D1 forms a complex with regulatory subunit of CDK4 or CDK6 kinases and it is required for cell cycle G1/S transition. The expression is maximal in G1 and minimal in S phase of cell cycle. Cyclin D1 expression is located mainly to the proliferative zone of normal epithelial tissues. Localization of the cyclin D1 is mainly nuclear. Cyclin D is useful for lymphoma diagnostic, especially diagnosis of mantle cell lymphoma.
Cyclin D1, is cell cycle regulator and it is over expressed in a wide variety of human neoplasms. Cyclin D1 forms a complex with regulatory subunit of CDK4 or CDK6 kinases and it is required for cell cycle G1/S transition. The expression is maximal in G1 and minimal in S phase of cell cycle. Cyclin D1 expression is located mainly to the proliferative zone of normal epithelial tissues. Localization of the cyclin D1 is mainly nuclear. Cyclin D is useful for lymphoma diagnostic, especially diagnosis of mantle cell lymphoma.
Programmed cell death ligand 1 (PDL1, CD274) is a type 1 transmembrane protein with role in the regulation of cellular immune responses. PDL1 and its receptor PD-1, interacts and regulating T lymphocyte activation and immune tolerance. Blockade of PD-L1/PD-1 interaction, it enhances the antitumor activity of T lymphocytes. PDL1 is commonly expressed in many tissues and cells, eg. placenta, tonsil and histiocytes. It over expressed in many human tumors such as non-small cell lung carcinoma (NSCLC), melanoma, DLBCL, and different kind of carcinomas. The staining pattern is membranous.
Programmed cell death ligand 1 (PDL1, CD274) is a type 1 transmembrane protein with role in the regulation of cellular immune responses. PDL1 and its receptor PD-1, interacts and regulating T lymphocyte activation and immune tolerance. Blockade of PD-L1/PD-1 interaction, it enhances the antitumor activity of T lymphocytes. PDL1 is commonly expressed in many tissues and cells, eg. placenta, tonsil and histiocytes. It over expressed in many human tumors such as non-small cell lung carcinoma (NSCLC), melanoma, DLBCL, and different kind of carcinomas. The staining pattern is membranous.
ERBB2: v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian). This gene encodes a member of the epidermal growth factor (EGF) receptor family of receptor tyrosine kinases. This protein has no ligand binding domain of its own and therefore cannot bind growth factors. However, it does bind tightly to other ligand-bound EGF receptor family members to form a heterodimer, stabilizing ligand binding and enhancing kinase-mediated activation of downstream signalling pathways, such as those involving mitogen-activated protein kinase and phosphatidylinositol-3 kinase. Allelic variations at amino acid positions 654 and 655 of isoform a (positions 624 and 625 of isoform b) have been reported, with the most common allele, Ile654/Ile655, shown here. Amplification and/or overexpression of this gene has been reported in numerous cancers, including breast and ovarian tumors. Alternative splicing results in several additional transcript variants, some encoding different isoforms and others that have not been fully characterized
ERBB2: v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian). This gene encodes a member of the epidermal growth factor (EGF) receptor family of receptor tyrosine kinases. This protein has no ligand binding domain of its own and therefore cannot bind growth factors. However, it does bind tightly to other ligand-bound EGF receptor family members to form a heterodimer, stabilizing ligand binding and enhancing kinase-mediated activation of downstream signalling pathways, such as those involving mitogen-activated protein kinase and phosphatidylinositol-3 kinase. Allelic variations at amino acid positions 654 and 655 of isoform a (positions 624 and 625 of isoform b) have been reported, with the most common allele, Ile654/Ile655, shown here. Amplification and/or overexpression of this gene has been reported in numerous cancers, including breast and ovarian tumors. Alternative splicing results in several additional transcript variants, some encoding different isoforms and others that have not been fully characterized
Calretinin is a calcium-binding protein and it is expressed in neurons and in nervous system. Calretinin is also expressed in mesothelial cells and steroid producing cells eg. Leydig cells and adrenal cortical cells as well as fat cells and some neuroendocrine cells. Calretinin located in the cells to nucleus and cytoplasm. Calretinin is useful for mesothelioma diagnostic (differentiate diagnostic between mesothelioma from carcinoma) and it is expressed in most malignant mesothelioma.
Calretinin is a calcium-binding protein and it is expressed in neurons and in nervous system. Calretinin is also expressed in mesothelial cells and steroid producing cells eg. Leydig cells and adrenal cortical cells as well as fat cells and some neuroendocrine cells. Calretinin located in the cells to nucleus and cytoplasm. Calretinin is useful for mesothelioma diagnostic (differentiate diagnostic between mesothelioma from carcinoma) and it is expressed in most malignant mesothelioma.
The CD5 antigen is a transmembrane glycoprotein which is expressed on the most mature human T-cells and expression level of CD5 will be increased during T-cell maturation. CD5 is also expressed in a small subset of normal human B-cells as well. CD5 is expressed in most T-cell lymphomas and leukemias and negative expression of the CD5 in T-cell lymphoma indicates a worse prognosis. In B-cell lymphomas eg. small lymphocytic lymphoma, small-cell lymphoma (CD20+), and mantle cell lymphoma are typically CD5 positive and marginal zone lymphoma and follicular lymphoma, are CD5 negative.
The CD5 antigen is a transmembrane glycoprotein which is expressed on the most mature human T-cells and expression level of CD5 will be increased during T-cell maturation. CD5 is also expressed in a small subset of normal human B-cells as well. CD5 is expressed in most T-cell lymphomas and leukemias and negative expression of the CD5 in T-cell lymphoma indicates a worse prognosis. In B-cell lymphomas eg. small lymphocytic lymphoma, small-cell lymphoma (CD20+), and mantle cell lymphoma are typically CD5 positive and marginal zone lymphoma and follicular lymphoma, are CD5 negative.
This gene encodes a member of the paired box (PAX) family of transcription factors. The central feature of this gene family is a novel, highly conserved DNA-binding motif, known as the paired box. PAX proteins are important regulators in early development, and alterations in the expression of their genes are thought to contribute to neoplastic transformation. This gene encodes the B-cell lineage specific activator protein that is expressed at early, but not late stages of B-cell differentiation. Its expression has also been detected in developing CNS and testis and so the encoded protein may also play a role in neural development and spermatogenesis. This gene is located at 9p13, which is involved in t(9;14)(p13;q32) translocations recurring in small lymphocytic lymphomas of the plasmacytoid subtype, and in derived large-cell lymphomas. This translocation brings the potent E-mu enhancer of the IgH gene into close proximity of the PAX5 promoter, suggesting that the deregulation of transcription of this gene contributes to the pathogenesis of these lymphomas. Alternatively spliced transcript variants encoding different isoforms have been described but their biological validity has not been determined.
This gene encodes a member of the paired box (PAX) family of transcription factors. The central feature of this gene family is a novel, highly conserved DNA-binding motif, known as the paired box. PAX proteins are important regulators in early development, and alterations in the expression of their genes are thought to contribute to neoplastic transformation. This gene encodes the B-cell lineage specific activator protein that is expressed at early, but not late stages of B-cell differentiation. Its expression has also been detected in developing CNS and testis and so the encoded protein may also play a role in neural development and spermatogenesis. This gene is located at 9p13, which is involved in t(9;14)(p13;q32) translocations recurring in small lymphocytic lymphomas of the plasmacytoid subtype, and in derived large-cell lymphomas. This translocation brings the potent E-mu enhancer of the IgH gene into close proximity of the PAX5 promoter, suggesting that the deregulation of transcription of this gene contributes to the pathogenesis of these lymphomas. Alternatively spliced transcript variants encoding different isoforms have been described but their biological validity has not been determined.
CD11b is a membranous protein with a role in adhesive interactions of many leukocytes, especially macrophages, and subsets of lymphocytes. The expression of CD11b increases during maturation and expression levels vary depending on the type of cell. CD11b can be used as common myeloid and NK cell marker. Useful marker for acute promyelocytic leukemia, hair cell leukemia and AML differentiations. Systemic lupus erythematosus is also shown to be associated with CD11b dysfunction.
CD11b is a membranous protein with a role in adhesive interactions of many leukocytes, especially macrophages, and subsets of lymphocytes. The expression of CD11b increases during maturation and expression levels vary depending on the type of cell. CD11b can be used as common myeloid and NK cell marker. Useful marker for acute promyelocytic leukemia, hair cell leukemia and AML differentiations. Systemic lupus erythematosus is also shown to be associated with CD11b dysfunction.
Caveolin-1 is a protein which is major structural component of the cell membrane caveolae. Caveolae is structure of the cell membrane invagination. Caveolin-1 is widely expressed in the normal tissue, eg. muscle tissue, vascular endothelia, fibroblasts and adipocytes. Caveolin-1 is useful in lung marker panel, especially in differentiating diagnosis of the epithelioid mesothelioma from lung adenocarcinoma.
Caveolin-1 is a protein which is major structural component of the cell membrane caveolae. Caveolae is structure of the cell membrane invagination. Caveolin-1 is widely expressed in the normal tissue, eg. muscle tissue, vascular endothelia, fibroblasts and adipocytes. Caveolin-1 is useful in lung marker panel, especially in differentiating diagnosis of the epithelioid mesothelioma from lung adenocarcinoma.
Glial Fibrillary Acidic Protein (GFAP) is the intermediate filament protein which is highly specific to astrocytes in the central nervous system (CNS). GFAP is also expressed some cells in peripheral nervous system eg. in Schwann cells and satellite cells. GFAP is useful especially for differential diagnosis of astrocytoma from non-glial neoplasm. Schwannoma and neurofibroma frequently express GFAP.
Glial Fibrillary Acidic Protein (GFAP) is the intermediate filament protein which is highly specific to astrocytes in the central nervous system (CNS). GFAP is also expressed some cells in peripheral nervous system eg. in Schwann cells and satellite cells. GFAP is useful especially for differential diagnosis of astrocytoma from non-glial neoplasm. Schwannoma and neurofibroma frequently express GFAP.
The CD44 antigen, also referred as homing cell adhesion molecule (HCAM), is a multi-structural and multifunctional cell-surface glycoprotein involved in cellcell interactions, cell adhesion, and migration. Most tissues are CD44 positive, including astrocyte restricted precursor cells, breast myoepithelial cells, colon, lung type II pneumocytes, red blood cells, stomach, urothelial basal cells, uterus and white blood cells. Negative staining results is seen in testis, kidney tubular epithelium, cardiac muscle, hepatocytes. In disease, positive staining is seen in colorectal carcinoma (most), Langerhans histiocytosis, oligodendroglioma, thymoma, small cell prostate carcinoma.
The CD44 antigen, also referred as homing cell adhesion molecule (HCAM), is a multi-structural and multifunctional cell-surface glycoprotein involved in cellcell interactions, cell adhesion, and migration. Most tissues are CD44 positive, including astrocyte restricted precursor cells, breast myoepithelial cells, colon, lung type II pneumocytes, red blood cells, stomach, urothelial basal cells, uterus and white blood cells. Negative staining results is seen in testis, kidney tubular epithelium, cardiac muscle, hepatocytes. In disease, positive staining is seen in colorectal carcinoma (most), Langerhans histiocytosis, oligodendroglioma, thymoma, small cell prostate carcinoma.
CD117 is a cell membrane protein encoded by the c-kit proto-oncogene. CD117 is expressed in mast cells, skin melanocytes and interstitial Cajal cells (ICC). These cells show a strong membrane and cytoplasmic staining. CD117 is also expressed in various epithelia (salivary glands, renal tubular cells etc.). Appendix serves as a good positive and negative control tissue. Neoplasms such as gastrointestinal stromal tumor (GIST), mast cell neoplasms and many other (seminoma, Mercel cell carcinoma etc.) express CD117. This antibody (together with DOG-1, CD34, SMA) is of great importance in the diagnosis of GIST, because of specific treatment of GIST patient with Gleveec.
CD117 is a cell membrane protein encoded by the c-kit proto-oncogene. CD117 is expressed in mast cells, skin melanocytes and interstitial Cajal cells (ICC). These cells show a strong membrane and cytoplasmic staining. CD117 is also expressed in various epithelia (salivary glands, renal tubular cells etc.). Appendix serves as a good positive and negative control tissue. Neoplasms such as gastrointestinal stromal tumor (GIST), mast cell neoplasms and many other (seminoma, Mercel cell carcinoma etc.) express CD117. This antibody (together with DOG-1, CD34, SMA) is of great importance in the diagnosis of GIST, because of specific treatment of GIST patient with Gleveec.
MSH2 (MutS Homologue 2) is one of the five key genes (besides MLH1, PMS1, PMS2, MSH6) of the Mis-Match Repair family (MMR). These genes encode MMR proteins, a group of nuclear enzymes that initiates repair of base-base mismatch, that can occur in DNA replication. MMR nuclear proteins form heterodimers, that bind abnormal DNA and initiates its removal. Loss of MMR proteins lead to accumulation of DNA replication errors in the proliferating cells. The above mentioned MMR genes have clinical interest, as they may mutate in families with hereditary non-polyposis colorectal cancer (HNPCC). About 3-5% of all colorectal carcinomas are related to MMR protein mutation. Carriers of an MLH1 or MSH2 mutation have a more than 70% lifetime risk of developing a colorectal carcinoma, with increased risk of developing endometrial carcinomas (50%). Staining for MLH1, MSH2 and MSH6 in colorectal carcinomas should be carried out in patients < 55 years-of-age or with a family history of these tumors.
MSH2 (MutS Homologue 2) is one of the five key genes (besides MLH1, PMS1, PMS2, MSH6) of the Mis-Match Repair family (MMR). These genes encode MMR proteins, a group of nuclear enzymes that initiates repair of base-base mismatch, that can occur in DNA replication. MMR nuclear proteins form heterodimers, that bind abnormal DNA and initiates its removal. Loss of MMR proteins lead to accumulation of DNA replication errors in the proliferating cells. The above mentioned MMR genes have clinical interest, as they may mutate in families with hereditary non-polyposis colorectal cancer (HNPCC). About 3-5% of all colorectal carcinomas are related to MMR protein mutation. Carriers of an MLH1 or MSH2 mutation have a more than 70% lifetime risk of developing a colorectal carcinoma, with increased risk of developing endometrial carcinomas (50%). Staining for MLH1, MSH2 and MSH6 in colorectal carcinomas should be carried out in patients < 55 years-of-age or with a family history of these tumors.
MUM1 is a nuclear transcriptional factor (IRF4 or Multiple Myeloma 1 ) and is expressed in final step of intragerminal center B cell differentiation and in post-germinal center B cells. MUM1 is usually mutually exclusive with BCL6 in nonneoplastic tissue. Nuclear expression is present also in a subpopulation of activated T- lymphocytes and expressed in normal and neoplastic melanocytes. In neoplasms MUM1 is found mainly in B-cell lymphoma and melanocytic lesions. In combination with CD138 and Ig´s makes MUM1 more specific marker for differentiating B-cells before plasma cell stage. MUM1 helps to divide diffuse large B cell lymphomas into germinal center (MUM1-) /non-germinal center (MUM1+) phenotypes and helps also to differentiate double hit from Burkitt and DLCL.
MUM1 is a nuclear transcriptional factor (IRF4 or Multiple Myeloma 1 ) and is expressed in final step of intragerminal center B cell differentiation and in post-germinal center B cells. MUM1 is usually mutually exclusive with BCL6 in nonneoplastic tissue. Nuclear expression is present also in a subpopulation of activated T- lymphocytes and expressed in normal and neoplastic melanocytes. In neoplasms MUM1 is found mainly in B-cell lymphoma and melanocytic lesions. In combination with CD138 and Ig´s makes MUM1 more specific marker for differentiating B-cells before plasma cell stage. MUM1 helps to divide diffuse large B cell lymphomas into germinal center (MUM1-) /non-germinal center (MUM1+) phenotypes and helps also to differentiate double hit from Burkitt and DLCL.
Thyroid transcription factor, also called thyroid specific enhancer binding nuclear protein (38 kDa), that regulates transcription activity of thyroid (thyroglobulin, thyroid peroxidase, sodium-iodide transport protein, calcitonin and MHC class I) and lung (surfactant proteins A, B and C, Clara cell secretory protein). The expression of TTF1 is confined to follicular epithelial cells and the C-cells in the thyroid, and to the type II pneumocytes and the Clara cells in the lung. In tumor diagnostics TTF1 distinguish primary (TTF+) vs. metastatic (usually TTF1-) lung carcinoma (LCa), pulmonary adenoca (TTF1+) from squamous cell Ca (usually TTF1 -), pleural lung Ca (TTF1+) vs.mesothelioma (TTF1 - ) and pulmonary small cell Ca (TTF1+) vs. Mercel cell Ca (TTF - ). Mucinous lung adeno ca is usually TTF1 negative.
Thyroid transcription factor, also called thyroid specific enhancer binding nuclear protein (38 kDa), that regulates transcription activity of thyroid (thyroglobulin, thyroid peroxidase, sodium-iodide transport protein, calcitonin and MHC class I) and lung (surfactant proteins A, B and C, Clara cell secretory protein). The expression of TTF1 is confined to follicular epithelial cells and the C-cells in the thyroid, and to the type II pneumocytes and the Clara cells in the lung. In tumor diagnostics TTF1 distinguish primary (TTF+) vs. metastatic (usually TTF1-) lung carcinoma (LCa), pulmonary adenoca (TTF1+) from squamous cell Ca (usually TTF1 -), pleural lung Ca (TTF1+) vs.mesothelioma (TTF1 - ) and pulmonary small cell Ca (TTF1+) vs. Mercel cell Ca (TTF - ). Mucinous lung adeno ca is usually TTF1 negative.
CD8 T cell surface antigen belongs to the type I membrane protein and it is heterodimer of an alpha and a beta chain linked by two disulfide bonds. CD8 positive T-lymphocytes are cytotoxic cells and it thought to play a role in the process of T-cell mediated killing. CD8 antibody is useful for classification of lymphocytes and malignant lymphomas.
CD8 T cell surface antigen belongs to the type I membrane protein and it is heterodimer of an alpha and a beta chain linked by two disulfide bonds. CD8 positive T-lymphocytes are cytotoxic cells and it thought to play a role in the process of T-cell mediated killing. CD8 antibody is useful for classification of lymphocytes and malignant lymphomas.
Cytokeratin 20 (CK20) is expressed in enterocytes and goblet cells of the gastrointestinal (GI) tract. It is also expressed in specific types of simple epithelial cells of the urinary tract. CK20 is useful marker of colorectal carcinoma, gastric, pancreas, urothelium, merkel and biliary system carcinomas.
Cytokeratin 20 (CK20) is expressed in enterocytes and goblet cells of the gastrointestinal (GI) tract. It is also expressed in specific types of simple epithelial cells of the urinary tract. CK20 is useful marker of colorectal carcinoma, gastric, pancreas, urothelium, merkel and biliary system carcinomas.
CD14 antigen is a GPI-linked glycoprotein with a molecular weight of 55kD. The CD14 antigen is expressed on cells of the myelomonocytic lineage including monocytes, macrophages and Langerhans cells. Low expression is observed on neutrophils and on human B cells. CD14 antigen is a receptor for bacterial lipopolysaccharide (LPS, endotoxin) and the lipopolysaccharide binding protein (LBP). LBP and CD14 antigen serves two physiological roles. These proteins act as opsonin and opsonic receptor, respectively, to promote the phagocytic uptake of bacteria or LPScoated particles by macrophages.
CD14 antigen is a GPI-linked glycoprotein with a molecular weight of 55kD. The CD14 antigen is expressed on cells of the myelomonocytic lineage including monocytes, macrophages and Langerhans cells. Low expression is observed on neutrophils and on human B cells. CD14 antigen is a receptor for bacterial lipopolysaccharide (LPS, endotoxin) and the lipopolysaccharide binding protein (LBP). LBP and CD14 antigen serves two physiological roles. These proteins act as opsonin and opsonic receptor, respectively, to promote the phagocytic uptake of bacteria or LPScoated particles by macrophages.
CD10 is a 100kDa glycoprotein, also designated Common Acute Lymphocytic Leukemia Antigen (CALLA). It is a cell surface enzyme with neutral metalloendopeptidase activity which inactivates a variety of biologically active peptides. CD10 is expressed on the cells of lymphoblastic, Burkitts, and follicular germinal center lymphomas, and on cells from patients with chronic myelocytic leukemia (CML). It is also expressed on the surface of normal early lymphoid progenitor cells, immature B cells within adult bone marrow and germinal center B cells within lymphoid tissue. CD10 is also present on breast myoepithelial cells, bile canaliculi, fibroblasts, with especially high expression on the brush border of kidney and gut epithelial cells.
CD10 is a 100kDa glycoprotein, also designated Common Acute Lymphocytic Leukemia Antigen (CALLA). It is a cell surface enzyme with neutral metalloendopeptidase activity which inactivates a variety of biologically active peptides. CD10 is expressed on the cells of lymphoblastic, Burkitts, and follicular germinal center lymphomas, and on cells from patients with chronic myelocytic leukemia (CML). It is also expressed on the surface of normal early lymphoid progenitor cells, immature B cells within adult bone marrow and germinal center B cells within lymphoid tissue. CD10 is also present on breast myoepithelial cells, bile canaliculi, fibroblasts, with especially high expression on the brush border of kidney and gut epithelial cells.
Desmin (DES), with 470-amino acid protein (about 52kDa), belongs to the intermediate filament family and Desmin is class III intermediate filaments found in muscle cells. Homopolymers of Desmin form a stable intracytoplasmic filamentous network connecting myofibrils to each other and to the plasma membrane.Mutations in Desmin are associated with desmin-related myopathy, a familial cardiac and skeletal myopathy (CSM), and with distal myopathies.Desmin is also expressed in smooth muscle cells of both airways and alveolar ducts and Desmin is a load-bearing protein that stiffens the airways and consequently the lung and modulates airway contractile response.
Desmin (DES), with 470-amino acid protein (about 52kDa), belongs to the intermediate filament family and Desmin is class III intermediate filaments found in muscle cells. Homopolymers of Desmin form a stable intracytoplasmic filamentous network connecting myofibrils to each other and to the plasma membrane.Mutations in Desmin are associated with desmin-related myopathy, a familial cardiac and skeletal myopathy (CSM), and with distal myopathies.Desmin is also expressed in smooth muscle cells of both airways and alveolar ducts and Desmin is a load-bearing protein that stiffens the airways and consequently the lung and modulates airway contractile response.
Vimentin is the major subunit protein of the intermediate filaments of mesenchymal cells. It is believed to be involved with the intracellular transport of proteins between the nucleus and plasma membrane. Vimentin has been implicated to be involved in the rate of steroid synthesis via its role as a storage network for steroidogenic cholesterol containing lipid droplets. Vimentin phosphorylation by a protein kinase causes the breakdown of intermediate filaments and activation of an ATP and myosin light chain dependent contractile event. This results in cytoskeletal changes that facilitate the interaction of the lipid droplets within mitochondria, and subsequent transport of cholesterol to the organelles leading to an increase in steroid synthesis. Immunohistochemical staining for Vimentin is characteristic of sarcomas (of neural, muscle and fibroblast origin) compared to carcinomas which are generally negative. Melanomas, lymphomas and vascular tumors may all stain for Vimentin. Vimentin antibodies are thus of value in the differential diagnosis of undifferentiated neoplasms and malignant tumors. They are generally used with a panel of other antibodies including those recognising cytokeratins, lymphoid markers, S100, desmin and neurofilaments.
Vimentin is the major subunit protein of the intermediate filaments of mesenchymal cells. It is believed to be involved with the intracellular transport of proteins between the nucleus and plasma membrane. Vimentin has been implicated to be involved in the rate of steroid synthesis via its role as a storage network for steroidogenic cholesterol containing lipid droplets. Vimentin phosphorylation by a protein kinase causes the breakdown of intermediate filaments and activation of an ATP and myosin light chain dependent contractile event. This results in cytoskeletal changes that facilitate the interaction of the lipid droplets within mitochondria, and subsequent transport of cholesterol to the organelles leading to an increase in steroid synthesis. Immunohistochemical staining for Vimentin is characteristic of sarcomas (of neural, muscle and fibroblast origin) compared to carcinomas which are generally negative. Melanomas, lymphomas and vascular tumors may all stain for Vimentin. Vimentin antibodies are thus of value in the differential diagnosis of undifferentiated neoplasms and malignant tumors. They are generally used with a panel of other antibodies including those recognising cytokeratins, lymphoid markers, S100, desmin and neurofilaments.
Biochemically, most members of the CK family fall into one of two classes, type I (acidic polypeptides) and type II (basic polypeptides). The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. Cytokeratins comprise a diverse group of intermediate filament proteins (IFPs) that are expressed as pairs in both keratinized and non-keratinized epithelial tissue. Cytokeratins play a critical role in differentiation and tissue specialization and function to maintain the overall structural integrity of epithelial cells. Cytokeratins have been found to be useful markers of tissue differentiation which is directly applicable to the characterization of malignant tumors.
Biochemically, most members of the CK family fall into one of two classes, type I (acidic polypeptides) and type II (basic polypeptides). The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. Cytokeratins comprise a diverse group of intermediate filament proteins (IFPs) that are expressed as pairs in both keratinized and non-keratinized epithelial tissue. Cytokeratins play a critical role in differentiation and tissue specialization and function to maintain the overall structural integrity of epithelial cells. Cytokeratins have been found to be useful markers of tissue differentiation which is directly applicable to the characterization of malignant tumors.
AMACR (alpha-methylacyl-CoA racemase) has been recently described as prostate cancer-specific gene that encodes a protein involved in the beta-oxidation of branched chain fatty acids. Expression of AMACR protein is found in prostatic adenocarcinoma but not in benign prostatic tissue. It stains premalignant lesions of prostate: high-grade prostatic intraepithelial neoplasia (PIN) and atypical adenomatous hyperplasia. AMACR can be used as a positive marker for PIN. Defects in AMACR are the cause of congenital bile acid synthesis defect type 4 (CBAS4); also known as cholestasis, intrahepatic, with defective conversion of trihydroxycoprostanic acid to cholic acid or trihydroxycoprostanic acid in bile. Clinical features include neonatal jaundice, intrahepatic cholestasis, bile duct deficiency and absence of cholic acid from bile.
AMACR (alpha-methylacyl-CoA racemase) has been recently described as prostate cancer-specific gene that encodes a protein involved in the beta-oxidation of branched chain fatty acids. Expression of AMACR protein is found in prostatic adenocarcinoma but not in benign prostatic tissue. It stains premalignant lesions of prostate: high-grade prostatic intraepithelial neoplasia (PIN) and atypical adenomatous hyperplasia. AMACR can be used as a positive marker for PIN. Defects in AMACR are the cause of congenital bile acid synthesis defect type 4 (CBAS4); also known as cholestasis, intrahepatic, with defective conversion of trihydroxycoprostanic acid to cholic acid or trihydroxycoprostanic acid in bile. Clinical features include neonatal jaundice, intrahepatic cholestasis, bile duct deficiency and absence of cholic acid from bile.
ERBB2: v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian). This gene encodes a member of the epidermal growth factor (EGF) receptor family of receptor tyrosine kinases. This protein has no ligand binding domain of its own and therefore cannot bind growth factors. However, it does bind tightly to other ligand-bound EGF receptor family members to form a heterodimer, stabilizing ligand binding and enhancing kinase-mediated activation of downstream signalling pathways, such as those involving mitogen-activated protein kinase and phosphatidylinositol-3 kinase. Allelic variations at amino acid positions 654 and 655 of isoform a (positions 624 and 625 of isoform b) have been reported, with the most common allele, Ile654/Ile655, shown here. Amplification and/or overexpression of this gene has been reported in numerous cancers, including breast and ovarian tumors. Alternative splicing results in several additional transcript variants, some encoding different isoforms and others that have not been fully characterized
ERBB2: v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian). This gene encodes a member of the epidermal growth factor (EGF) receptor family of receptor tyrosine kinases. This protein has no ligand binding domain of its own and therefore cannot bind growth factors. However, it does bind tightly to other ligand-bound EGF receptor family members to form a heterodimer, stabilizing ligand binding and enhancing kinase-mediated activation of downstream signalling pathways, such as those involving mitogen-activated protein kinase and phosphatidylinositol-3 kinase. Allelic variations at amino acid positions 654 and 655 of isoform a (positions 624 and 625 of isoform b) have been reported, with the most common allele, Ile654/Ile655, shown here. Amplification and/or overexpression of this gene has been reported in numerous cancers, including breast and ovarian tumors. Alternative splicing results in several additional transcript variants, some encoding different isoforms and others that have not been fully characterized
DNA-mismatch repair (MMR), a conserved process that involves correcting errors made during DNA synthesis, is crucial to the maintenance of genomic integrity. Lack of a functional DNA-mismatch repair pathway is a common characteristic of several different types of human cancers, either due to an MMR gene mutation or promoter-methylation gene silencing. MLH1 is a human homolog of the E. coli DNA mismatch repair gene mutL, consistent with the characteristic alterations in microsatellite sequences (RER+ phenotype) found in hereditary nonpolyposis colon cancer (HNPCC). MLH1 is an integral part of the protein complex responsible for mismatch repair expressed in lymphocytes, heart, colon, breast, lung, spleen, testis, prostate, thyroid and gall bladder, and is methylated in several ovarian tumors. Loss of MLH1 protein expression is associated with a mutated phenotype, microsatellite instability and a predisposition to cancer. In hereditary nonpolyposis colorectal cancer (HNPCC), an autosomal dominant inherited cancer syndrome that signifies a high risk of colorectal and various other types of cancer, the MLH1 gene exhibits a pathogenic mutation. Inactivation of the MLH1 gene causes genome instability and predisposition to cancer. MLH1 also plays a role in meiotic recombination.
DNA-mismatch repair (MMR), a conserved process that involves correcting errors made during DNA synthesis, is crucial to the maintenance of genomic integrity. Lack of a functional DNA-mismatch repair pathway is a common characteristic of several different types of human cancers, either due to an MMR gene mutation or promoter-methylation gene silencing. MLH1 is a human homolog of the E. coli DNA mismatch repair gene mutL, consistent with the characteristic alterations in microsatellite sequences (RER+ phenotype) found in hereditary nonpolyposis colon cancer (HNPCC). MLH1 is an integral part of the protein complex responsible for mismatch repair expressed in lymphocytes, heart, colon, breast, lung, spleen, testis, prostate, thyroid and gall bladder, and is methylated in several ovarian tumors. Loss of MLH1 protein expression is associated with a mutated phenotype, microsatellite instability and a predisposition to cancer. In hereditary nonpolyposis colorectal cancer (HNPCC), an autosomal dominant inherited cancer syndrome that signifies a high risk of colorectal and various other types of cancer, the MLH1 gene exhibits a pathogenic mutation. Inactivation of the MLH1 gene causes genome instability and predisposition to cancer. MLH1 also plays a role in meiotic recombination.
Cytokeratin 18, also known as CK18, CYK18, KRT18. Entrez Protein NP_000215. It encodes the type I intermediate filament chain keratin 18. Keratin 18, together with its filament partner keratin 8, are perhaps the most commonly found members of the intermediate filament gene family. They are expressed in single layer epithelial tissues of the body. Mutations in this gene have been linked to cryptogenic cirrhosis. Two transcript variants encoding the same protein have been found for this gene.
Cytokeratin 18, also known as CK18, CYK18, KRT18. Entrez Protein NP_000215. It encodes the type I intermediate filament chain keratin 18. Keratin 18, together with its filament partner keratin 8, are perhaps the most commonly found members of the intermediate filament gene family. They are expressed in single layer epithelial tissues of the body. Mutations in this gene have been linked to cryptogenic cirrhosis. Two transcript variants encoding the same protein have been found for this gene.
Cytokeratin 19, also known as KRT19, CK19, CK19, K1CS, MGC15366. Entrez Protein NP_002267. It is a member of the keratin family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. The type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. Unlike its related family members, this smallest known acidic cytokeratin is not paired with a basic cytokeratin in epithelial cells. It is specifically expressed in the periderm, the transiently superficial layer that envelopes the developing epidermis.
Cytokeratin 19, also known as KRT19, CK19, CK19, K1CS, MGC15366. Entrez Protein NP_002267. It is a member of the keratin family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. The type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. Unlike its related family members, this smallest known acidic cytokeratin is not paired with a basic cytokeratin in epithelial cells. It is specifically expressed in the periderm, the transiently superficial layer that envelopes the developing epidermis.
Ki67, also known as MKI67, is aprototypic cell cycle related nuclear protein, expressed by proliferating cells in all phases of the active cell cycle (G1, S, G2 and M phase). It is absent in resting (G0) cells. Ki67 antibodies are useful in establishing the cell growing fraction in neoplasms (immunohistochemically quantified by determining the number of Ki67 positive cells among the total number of resting cells = Ki67 index). In neoplastic tissues the prognostic value is comparable to the tritiated thymidine labelling index. The correlation between low Ki67 index and histologically low grade tumours is strong. Ki67 is routinely used as a neuronal marker of cell cycling and proliferation
Ki67, also known as MKI67, is aprototypic cell cycle related nuclear protein, expressed by proliferating cells in all phases of the active cell cycle (G1, S, G2 and M phase). It is absent in resting (G0) cells. Ki67 antibodies are useful in establishing the cell growing fraction in neoplasms (immunohistochemically quantified by determining the number of Ki67 positive cells among the total number of resting cells = Ki67 index). In neoplastic tissues the prognostic value is comparable to the tritiated thymidine labelling index. The correlation between low Ki67 index and histologically low grade tumours is strong. Ki67 is routinely used as a neuronal marker of cell cycling and proliferation
CK17, also known as KRT17, it is the type I intermediate filament chain keratin 17. It is found in nail beds, hair follicles, sebaceous glands, and other epidermal appendages. Mutations in this gene lead to Jackson-Lawler type pachyonychia congenita and steatocystoma multiplex. May play a role in the formation and maintenance of various skin appendages, specifically in determining shape and orientation of hair. May be a marker of basal cell differentiation in complex epithelia and therefore indicative of a certain type of epithelial "stem cells". May act as an autoantigen in the immunopathogenesis of psoriasis, with certain peptide regions being a major target for autoreactive T-cells and hence causing their proliferation. Required for the correct growth of hair follicles, in particular for the persistence of the anagen (growth) state. Modulates the function of TNF-alpha in the specific context of hair cycling. Regulates protein synthesis and epithelial cell growth through binding to the adapter protein SFN and by stimulating Akt/mTOR pathway. Involved in tissue repair.
CK17, also known as KRT17, it is the type I intermediate filament chain keratin 17. It is found in nail beds, hair follicles, sebaceous glands, and other epidermal appendages. Mutations in this gene lead to Jackson-Lawler type pachyonychia congenita and steatocystoma multiplex. May play a role in the formation and maintenance of various skin appendages, specifically in determining shape and orientation of hair. May be a marker of basal cell differentiation in complex epithelia and therefore indicative of a certain type of epithelial "stem cells". May act as an autoantigen in the immunopathogenesis of psoriasis, with certain peptide regions being a major target for autoreactive T-cells and hence causing their proliferation. Required for the correct growth of hair follicles, in particular for the persistence of the anagen (growth) state. Modulates the function of TNF-alpha in the specific context of hair cycling. Regulates protein synthesis and epithelial cell growth through binding to the adapter protein SFN and by stimulating Akt/mTOR pathway. Involved in tissue repair.
CD38 is a type II integral membrane glycoprotein which is present on early B and T cell lineages and activated B and T cells but is absent from most mature resting peripheral lymphocytes. CD38 is also found on thymocytes, pre-B cells, germinal center B cells, mitogen-activated T cells, monocytes and Ig-secreting plasma cells. CD38 acts as a NAD glycohydrolase in T lym- phocytes. On hematopoietic cells CD38 induces activation, proliferation, and differentiation of mature T and B cells and mediates apoptosis of myeloid and lymphoid progenitor cells. In addition to acting as a signaling receptor, CD38 is also an enzyme capable of producing several calcium-mobilizing metabo- lites, including cyclic adenosine diphosphate ribose (cADPR). CD38 also plays a role in maintaining survival of an invariant NK T (iNKT) cell subset that preferentially contributes to the maintenance of immunological tolerance.
CD38 is a type II integral membrane glycoprotein which is present on early B and T cell lineages and activated B and T cells but is absent from most mature resting peripheral lymphocytes. CD38 is also found on thymocytes, pre-B cells, germinal center B cells, mitogen-activated T cells, monocytes and Ig-secreting plasma cells. CD38 acts as a NAD glycohydrolase in T lym- phocytes. On hematopoietic cells CD38 induces activation, proliferation, and differentiation of mature T and B cells and mediates apoptosis of myeloid and lymphoid progenitor cells. In addition to acting as a signaling receptor, CD38 is also an enzyme capable of producing several calcium-mobilizing metabo- lites, including cyclic adenosine diphosphate ribose (cADPR). CD38 also plays a role in maintaining survival of an invariant NK T (iNKT) cell subset that preferentially contributes to the maintenance of immunological tolerance.
The androgen receptor (AR), also known as NR3C4 (nuclear receptor subfamily 3, group C, member 4), is a type of nuclear receptor which is activated by binding of either of the androgenic hormones testosterone or dihydrotestosterone in the cytoplasm and then translocating into the nucleus. The androgen receptor is most closely related to the progesterone receptor, and progestins in higher dosages can block the androgen receptor. The main function of the androgen receptor is as a DNA binding transcription factor which regulates gene expression; however, the androgen receptor has other functions as well. Androgen regulated genes are critical for the development and maintenance of the male sexual phenotype.
The androgen receptor (AR), also known as NR3C4 (nuclear receptor subfamily 3, group C, member 4), is a type of nuclear receptor which is activated by binding of either of the androgenic hormones testosterone or dihydrotestosterone in the cytoplasm and then translocating into the nucleus. The androgen receptor is most closely related to the progesterone receptor, and progestins in higher dosages can block the androgen receptor. The main function of the androgen receptor is as a DNA binding transcription factor which regulates gene expression; however, the androgen receptor has other functions as well. Androgen regulated genes are critical for the development and maintenance of the male sexual phenotype.
The protein encoded by this gene is T-cell receptor zeta, which together with T-cell receptor alpha/beta and gamma/delta heterodimers, and with CD3-gamma, -delta and -epsilon, forms the T-cell receptor-CD3 complex. The zeta chain plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. Low expression of the antigen results in impaired immune response. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.
The protein encoded by this gene is T-cell receptor zeta, which together with T-cell receptor alpha/beta and gamma/delta heterodimers, and with CD3-gamma, -delta and -epsilon, forms the T-cell receptor-CD3 complex. The zeta chain plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. Low expression of the antigen results in impaired immune response. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.
Synaptophysin (p38) is an integral membrane protein of small synaptic vesicles in brain and endocrine cells.Synaptophysin contains four transmembrane domains that form a hexameric channel or gap junction-like pore. Synaptophysin binds to the SNARE protein synaptobrevin/VAMP, which prevents the inclusion of synaptobrevin in the synaptic vesicle fusion complex and creates a pool of synaptobrevin for exocytosis when synapse activity increases. Synaptophysin is also responsible for targeting synaptobrevin 2/VAMP2 to synaptic vesicles, a critical component of the fusion complex.
Synaptophysin (p38) is an integral membrane protein of small synaptic vesicles in brain and endocrine cells.Synaptophysin contains four transmembrane domains that form a hexameric channel or gap junction-like pore. Synaptophysin binds to the SNARE protein synaptobrevin/VAMP, which prevents the inclusion of synaptobrevin in the synaptic vesicle fusion complex and creates a pool of synaptobrevin for exocytosis when synapse activity increases. Synaptophysin is also responsible for targeting synaptobrevin 2/VAMP2 to synaptic vesicles, a critical component of the fusion complex.
This gene encodes a carcinoma-associated antigen and is a member of a family that includes at least two type I membrane proteins. This antigen is expressed on most normal epithelial cells and gastrointestinal carcinomas and functions as a homotypic calcium-independent cell adhesion molecule. The antigen is being used as a target for immunotherapy treatment of human carcinomas. Mutations in this gene result in congenital tufting enteropathy.Tissue specificity: This protein is expressed in almost all epithelial cell membranes but not on mesodermal or neural cell membranes. Found on the surface of adenocarcinomas. EPCAM:Epithelial Cell Adhesion Molecule (EpCAM) is a 40 kDa cell surface antigen. This antigen has been identified independently by a number of groups, and has been known by a variety of names. Several monoclonal antibodies have been raised against EpCAM, many of which have been described as tumour specific molecules on carcinomas. EpCAM is a Type 1 transmembrane glycoprotein. It is expressed on the basolateral membrane of cells by the majority of epithelial tissues, with the exception of adult squamous epithelium and some specific epithelial cell types including hepatocytes and gastric epithelial cells. EpCAM expression has been reported to be a possible marker of early malignancy, with expression being increased in tumour cells, and de novo expression being seen in dysplastic squamous epithelium. This cell surface, glycosylated 40kD protein is highly expressed in the bone marrow, colon, lung, and most normal epithelial cells and is expressed on carcinomas of gastrointestinal origin.
This gene encodes a carcinoma-associated antigen and is a member of a family that includes at least two type I membrane proteins. This antigen is expressed on most normal epithelial cells and gastrointestinal carcinomas and functions as a homotypic calcium-independent cell adhesion molecule. The antigen is being used as a target for immunotherapy treatment of human carcinomas. Mutations in this gene result in congenital tufting enteropathy.Tissue specificity: This protein is expressed in almost all epithelial cell membranes but not on mesodermal or neural cell membranes. Found on the surface of adenocarcinomas. EPCAM:Epithelial Cell Adhesion Molecule (EpCAM) is a 40 kDa cell surface antigen. This antigen has been identified independently by a number of groups, and has been known by a variety of names. Several monoclonal antibodies have been raised against EpCAM, many of which have been described as tumour specific molecules on carcinomas. EpCAM is a Type 1 transmembrane glycoprotein. It is expressed on the basolateral membrane of cells by the majority of epithelial tissues, with the exception of adult squamous epithelium and some specific epithelial cell types including hepatocytes and gastric epithelial cells. EpCAM expression has been reported to be a possible marker of early malignancy, with expression being increased in tumour cells, and de novo expression being seen in dysplastic squamous epithelium. This cell surface, glycosylated 40kD protein is highly expressed in the bone marrow, colon, lung, and most normal epithelial cells and is expressed on carcinomas of gastrointestinal origin.
The protein encoded by this gene is actually a preproprotein that is cleaved into four distinct mature peptides. One of these, glucagon, is a pancreatic hormone that counteracts the glucose-lowering action of insulin by stimulating glycogenolysis and gluconeogenesis. Glucagon is a ligand for a specific G-protein linked receptor whose signalling pathway controls cell proliferation. Two of the other peptides are secreted from gut endocrine cells and promote nutrient absorption through distinct mechanisms. Finally, the fourth peptide is similar to glicentin, an active enteroglucagon.Tissue specificity: Glucagon is secreted in the A cells of the islets of Langerhans. GLP-1, GLP-2, oxyntomodulin and glicentin are secreted from enteroendocrine cells throughout the gastrointestinal tract. GLP1 and GLP2 are also secreted in selected neurons in the brain.
The protein encoded by this gene is actually a preproprotein that is cleaved into four distinct mature peptides. One of these, glucagon, is a pancreatic hormone that counteracts the glucose-lowering action of insulin by stimulating glycogenolysis and gluconeogenesis. Glucagon is a ligand for a specific G-protein linked receptor whose signalling pathway controls cell proliferation. Two of the other peptides are secreted from gut endocrine cells and promote nutrient absorption through distinct mechanisms. Finally, the fourth peptide is similar to glicentin, an active enteroglucagon.Tissue specificity: Glucagon is secreted in the A cells of the islets of Langerhans. GLP-1, GLP-2, oxyntomodulin and glicentin are secreted from enteroendocrine cells throughout the gastrointestinal tract. GLP1 and GLP2 are also secreted in selected neurons in the brain.
E-Cadherin is a 120 kDa transmembrane glycoprotein that is localized in the adherens junctions of epithelial cells. There, it interacts with the cytoskeleton through the associated cytoplasmic catenin proteins. In addition to being a calcium-dependent adhesion molecule, E-Cadherin is also a critical regulator of epithelial junction formation. Its association with catenins is necessary for cell-cell adhesion. These E-cadherin/catenin complexes associate with corical actin bundles at both the zonula adherens and the lateral adhesion plaques. Tyrosine phosphorylation can disrupt these complexes, leading to changes in cell adhesion properties. E-Cadherin expression is often down-regulated in highly invasive, poorly differentiated carcinomas. Increased expression of E-Cadherin in these cells reduces invasiveness. Thus, loss of expression or function of E-Cadherin appears to be an important step in tumorigenic progression.Tissue specificity: Non-neural epithelial tissues.
E-Cadherin is a 120 kDa transmembrane glycoprotein that is localized in the adherens junctions of epithelial cells. There, it interacts with the cytoskeleton through the associated cytoplasmic catenin proteins. In addition to being a calcium-dependent adhesion molecule, E-Cadherin is also a critical regulator of epithelial junction formation. Its association with catenins is necessary for cell-cell adhesion. These E-cadherin/catenin complexes associate with corical actin bundles at both the zonula adherens and the lateral adhesion plaques. Tyrosine phosphorylation can disrupt these complexes, leading to changes in cell adhesion properties. E-Cadherin expression is often down-regulated in highly invasive, poorly differentiated carcinomas. Increased expression of E-Cadherin in these cells reduces invasiveness. Thus, loss of expression or function of E-Cadherin appears to be an important step in tumorigenic progression.Tissue specificity: Non-neural epithelial tissues.
Mammaglobin is a gene that is expressed almost exclusively in the normal breast epithelium and human breast cancer. It is a member of the secretoglobin gene family and forms a heterodimer with lipophilin B. It has been suggested that mammaglobin may be a useful marker for breast cancer clinical research. Studies investigating the detection of mRNA by RT PCR from circulating carcinoma cells in the peripheral blood of breast cancer patients have shown that mammaglobin is a highly specific marker and correlates with several prognostic factors. Mammaglobin is mammary gland specific and it over expressed in breast cancer.
Mammaglobin is a gene that is expressed almost exclusively in the normal breast epithelium and human breast cancer. It is a member of the secretoglobin gene family and forms a heterodimer with lipophilin B. It has been suggested that mammaglobin may be a useful marker for breast cancer clinical research. Studies investigating the detection of mRNA by RT PCR from circulating carcinoma cells in the peripheral blood of breast cancer patients have shown that mammaglobin is a highly specific marker and correlates with several prognostic factors. Mammaglobin is mammary gland specific and it over expressed in breast cancer.
This gene encodes a homodimeric transmembrane protein which is a major glycoprotein of the vascular endothelium. This protein is a component of the transforming growth factor beta receptor complex and it binds TGFB1 and TGFB3 with high affinity. Mutations in this gene cause hereditary hemorrhagic telangiectasia, also known as Osler-Rendu-Weber syndrome 1, an autosomal dominant multisystemic vascular dysplasia.
This gene encodes a homodimeric transmembrane protein which is a major glycoprotein of the vascular endothelium. This protein is a component of the transforming growth factor beta receptor complex and it binds TGFB1 and TGFB3 with high affinity. Mutations in this gene cause hereditary hemorrhagic telangiectasia, also known as Osler-Rendu-Weber syndrome 1, an autosomal dominant multisystemic vascular dysplasia.
The protein encoded by the classic MBP gene is a major constituent of the myelin sheath of oligodendrocytes and Schwann cells in the nervous system. However, MBP-related transcripts are also present in the bone marrow and the immune system. These mRNAs arise from the long MBP gene (otherwise called "Golli-MBP") that contains 3 additional exons located upstream of the classic MBP exons. Alternative splicing from the Golli and the MBP transcription start sites gives rise to 2 sets of MBP-related transcripts and gene products. The Golli mRNAs contain 3 exons unique to Golli-MBP, spliced in-frame to 1 or more MBP exons. They encode hybrid proteins that have N-terminal Golli aa sequence linked to MBP aa sequence. The second family of transcripts contain only MBP exons and produce the well characterized myelin basic proteins. This complex gene structure is conserved among species suggesting that the MBP transcription unit is an integral part of the Golli transcription unit and that this arrangement is important for the function and/or regulation of these genes.
The protein encoded by the classic MBP gene is a major constituent of the myelin sheath of oligodendrocytes and Schwann cells in the nervous system. However, MBP-related transcripts are also present in the bone marrow and the immune system. These mRNAs arise from the long MBP gene (otherwise called "Golli-MBP") that contains 3 additional exons located upstream of the classic MBP exons. Alternative splicing from the Golli and the MBP transcription start sites gives rise to 2 sets of MBP-related transcripts and gene products. The Golli mRNAs contain 3 exons unique to Golli-MBP, spliced in-frame to 1 or more MBP exons. They encode hybrid proteins that have N-terminal Golli aa sequence linked to MBP aa sequence. The second family of transcripts contain only MBP exons and produce the well characterized myelin basic proteins. This complex gene structure is conserved among species suggesting that the MBP transcription unit is an integral part of the Golli transcription unit and that this arrangement is important for the function and/or regulation of these genes.
The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein forms a complex with MCM4, 6, and 7, and has been shown to regulate the helicase activity of the complex. This protein is phosphorylated, and thus regulated by, protein kinases CDC2 and CDC7.
The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein forms a complex with MCM4, 6, and 7, and has been shown to regulate the helicase activity of the complex. This protein is phosphorylated, and thus regulated by, protein kinases CDC2 and CDC7.
This gene encodes a member of the paired box (PAX) family of transcription factors. The central feature of this gene family is a novel, highly conserved DNA-binding motif, known as the paired box. PAX proteins are important regulators in early development, and alterations in the expression of their genes are thought to contribute to neoplastic transformation. This gene encodes the B-cell lineage specific activator protein that is expressed at early, but not late stages of B-cell differentiation. Its expression has also been detected in developing CNS and testis and so the encoded protein may also play a role in neural development and spermatogenesis. This gene is located at 9p13, which is involved in t(9;14)(p13;q32) translocations recurring in small lymphocytic lymphomas of the plasmacytoid subtype, and in derived large-cell lymphomas. This translocation brings the potent E-mu enhancer of the IgH gene into close proximity of the PAX5 promoter, suggesting that the deregulation of transcription of this gene contributes to the pathogenesis of these lymphomas. Alternatively spliced transcript variants encoding different isoforms have been described but their biological validity has not been determined.
This gene encodes a member of the paired box (PAX) family of transcription factors. The central feature of this gene family is a novel, highly conserved DNA-binding motif, known as the paired box. PAX proteins are important regulators in early development, and alterations in the expression of their genes are thought to contribute to neoplastic transformation. This gene encodes the B-cell lineage specific activator protein that is expressed at early, but not late stages of B-cell differentiation. Its expression has also been detected in developing CNS and testis and so the encoded protein may also play a role in neural development and spermatogenesis. This gene is located at 9p13, which is involved in t(9;14)(p13;q32) translocations recurring in small lymphocytic lymphomas of the plasmacytoid subtype, and in derived large-cell lymphomas. This translocation brings the potent E-mu enhancer of the IgH gene into close proximity of the PAX5 promoter, suggesting that the deregulation of transcription of this gene contributes to the pathogenesis of these lymphomas. Alternatively spliced transcript variants encoding different isoforms have been described but their biological validity has not been determined.
The preproprotein encoded by this gene. Somatostatin is expressed throughout the body and inhibits the release of numerous secondary hormones by binding to high-affinity G-protein-coupled somatostatin receptors. This hormone is an important regulator of the endocrine system through its interactions with pituitary growth hormone, thyroid stimulating hormone, and most hormones of the gastrointestinal tract. Somatostatin also affects rates of neurotransmission in the central nervous system and proliferation of both normal and tumorigenic cells.
The preproprotein encoded by this gene. Somatostatin is expressed throughout the body and inhibits the release of numerous secondary hormones by binding to high-affinity G-protein-coupled somatostatin receptors. This hormone is an important regulator of the endocrine system through its interactions with pituitary growth hormone, thyroid stimulating hormone, and most hormones of the gastrointestinal tract. Somatostatin also affects rates of neurotransmission in the central nervous system and proliferation of both normal and tumorigenic cells.
This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional activator after forming a protein complex with other proteins. This protein acts as a nucleocytoplasmic shuttle protein and is important for neural crest and peripheral nervous system development. SOX10 is important and sensitive marker of melanoma especially for spindle cell and desmoplastic melanomas and schwannian neoplasms.
This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional activator after forming a protein complex with other proteins. This protein acts as a nucleocytoplasmic shuttle protein and is important for neural crest and peripheral nervous system development. SOX10 is important and sensitive marker of melanoma especially for spindle cell and desmoplastic melanomas and schwannian neoplasms.
CD45 is transmembrane protein that is present on all differentiated hematopoietic cells (including basophils, granulocytes, lymphocytes, macrophages / histiocytes, mast cells, monocytes, dendritic cells, medullary thymocytes, plasma cells). Erythrocytes and their immediate progenitors do not express CD45 antigen. This antigen is used in routine immunohistochemistry to differentiate between immune cell types, as well as to differentiate hematological malignancies from other tumors. CD 45 is a good marker for AML, ALCL and most B- and T-cell lymphomas. Epithelial tumors, follicular dendritic cell sarcomas, germ cell tumors, melanoma, mesothelioma do not express CD45.
CD45 is transmembrane protein that is present on all differentiated hematopoietic cells (including basophils, granulocytes, lymphocytes, macrophages / histiocytes, mast cells, monocytes, dendritic cells, medullary thymocytes, plasma cells). Erythrocytes and their immediate progenitors do not express CD45 antigen. This antigen is used in routine immunohistochemistry to differentiate between immune cell types, as well as to differentiate hematological malignancies from other tumors. CD 45 is a good marker for AML, ALCL and most B- and T-cell lymphomas. Epithelial tumors, follicular dendritic cell sarcomas, germ cell tumors, melanoma, mesothelioma do not express CD45.
CD2 is a surface antigen of the human T-lymphocyte lineage that is expressed on all peripheral blood T-lymphocytes. It is one of the earliest T-cell markers, being present on more than 95% of thymocytes; it is also found on some natural killer cells but not on B lymphocytes. CD2 antibody is useful for lymphoma diagnostic.
CD2 is a surface antigen of the human T-lymphocyte lineage that is expressed on all peripheral blood T-lymphocytes. It is one of the earliest T-cell markers, being present on more than 95% of thymocytes; it is also found on some natural killer cells but not on B lymphocytes. CD2 antibody is useful for lymphoma diagnostic.
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Chicken anti-Casein kinase I isoform alpha (CKI-alpha) Polyclonal Antibody (Unconjugated), suitable for WB, ICC, IHC-Frozen.
Background Info:
Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates. It can phosphorylate a large number of proteins. Participates in Wnt signaling. Phosphorylates CTNNB1 at 'Ser-45'. May phosphorylate PER1 and PER2. May play a role in segregating chromosomes during mitosis. May play a role in keratin cytoskeleton disassembly and thereby, it may regulate epithelial cell migration. (Reference: uniprot.org)
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized from PBS buffer pH 7.2-7.6 with 0.1% trehalose, without preservatives
Host Animal:
Chicken
Species Reactivity:
Bovine,Chicken,Horse,Human,Mouse,Pig,Rat
Immunogen:
Shortest isoform of recombinant full length CK1a.
Applications:
ICC,IHC-Frozen,WB
Antibody Isotype:
IgY
Application Details:
Western Blotting (WB): 1:5,000 - 1:10,000. Casein kinase 1 alpha has a predicted molecular weight of 38 kDa. <br><br>Immunocytochemistry (ICC): 1:500-1:1,000.<br><br>Biosensis recommends optimal dilutions/concentrations should be determined by the end user.
Alternative Names:
CK1; CKI-alpha;
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Specificity:
Antibody recognizes CK1 by western blot and immunohistochemistry. Cross reactivity
Storage:
After reconstitution of lyophilized antibody, aliquot and store at -20°C for a higher stability. Avoid freeze-thaw cycles.
Chicken anti-Glial fibrillary acidic protein (GFAP) Polyclonal Antibody (Unconjugated), suitable for WB, IHC-Paraffin-embedded, IHC-Frozen, ICC.
Background Info:
Glial fibrillary acidic protein (GFAP) is approx. 50 kDa intra-cytoplasmic filamentous protein of the cytoskeleton in astrocytes. During the development of the central nervous system, it is a cell-specific marker that distinguishes astrocytes from other glial cells. GFAP immunoreactivity has been shown in immature oligodendrocytes, epiglottic cartilage, pituicytes, papillary meningiomas, myoepithelial cells of the breast and in non-CNS: Schwann cells, salivary gland neoplasms, enteric glia cells, and metastasizing renal carcinomas.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized from PBS buffer pH 7.2-7.6 with 0.1% trehalose, without preservatives
Host Animal:
Chicken
Species Reactivity:
Cat,Human,Mouse,Other Mammals (Predicted),Rat
Immunogen:
Recombinant GFAP (expressed in E.coli) and native bovine GFAP
Applications:
ICC,IHC-Frozen,IHC-Paraffin-embedded,WB
Antibody Isotype:
IgY
Application Details:
Western Blotting (WB), Immunocytochemistry (ICC) and Immunohistochemistry (IHC). WB: A dilution of 1:5,000 is recommended. ICC: A dilution of 1:1,000-1:5,000 using fluorescent secondary antibodies or peroxidase or other enzyme-linked methods is recommended on 4% PFA fixed cells in culture, with 3hr-o/n incubation of primary antibody. IHC: 4% PFA frozen tissues, permeabilized. IHC (paraffin-embedded): capable, HEIR treatment typically necessary. Biosensis recommends optimal dilutions/concentrations should be determined by the end user.
Alternative Names:
Astrocyte; Glial fibrillary acidic protein; GFAP;
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Product references:
Hascup KN et al. (2020) Riluzole attenuates glutamatergic tone and cognitive decline in A?PP/PS1 mice. J Neurochem. [Epub ahead of print] Application: Mouse, IHC(IF).
Specificity:
The specificity of this antibody has been confirmed by WB. Human, Rat, Mouse, Feline. Predicted to react with other mammals.
Storage:
After reconstitution of lyophilized antibody, aliquot and store at -20°C for a higher stability. Avoid freeze-thaw cycles.
Neurofilaments can be defined as the intermediate or 10nm diameter filaments found in neuronal cells. They are composed a mixture of subunits which often includes the neurofilament triplet proteins, NF-L, NF-M and NF-H. Neurofilaments may also include peripherin, alpha-internexin, nestin and in some cases vimentin. Alpha-internexin is a ~66 kDa Class IV intermediate filament subunit expressed in large amounts early in neuronal development, but is downregulated in many neurons as development procedes. Many classes of mature neurons contain alpha-internexin in addition to NF-L, NF-M and NF-H. In some mature neurons alpha-internexin is the only neurofilament subunit expressed. Antibodies to alpha-internexin are therefore unique probes to study and classify neuronal types and follow their processes in sections and in tissue culture. In addition the very early developmental expression of alpha-internexin means its presence is an early and convenient diagnostic feature of neuronal progenitors cells and other cell committed to the neuronal lineage.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized from PBS buffer pH 7.2-7.6 with 0.1% trehalose, without preservatives
Host Animal:
Chicken
Species Reactivity:
Cat,Human,Mouse,Other Mammals (Predicted),Rat
Immunogen:
Recombinant rat alpha-internexin expressed and purified from E. coli
Applications:
ICC,IHC-Frozen,WB
Antibody Isotype:
IgY
Application Details:
Western Blotting (WB), Immunocytochemistry (ICC) and Immunohistochemistry (IHC). A dilution of 1:5,000 - 10,000 is recommended for WB. A dilution of 1:500-1,000 is recommended for ICC and IHC. Biosensis recommends optimal dilutions/concentrations should be determined by the end user.
The specificity of this antibody has been confirmed by WB. This antibody is specific for the 64-66 kDa alpha-internexin protein. Molecular weight will depend on species. Human, Rat, Mouse, Feline. It is predicted to react with other mammals.
Storage:
After reconstitution of lyophilized antibody, aliquot and store at -20°C for a higher stability. Avoid freeze-thaw cycles.
Chicken anti-Microtubule-associated protein 2 (MAP2) Polyclonal Antibody (Unconjugated), suitable for WB, IHC-Frozen, IHC-Paraffin-embedded, ICC.
Background Info:
Microtubules are 25nm diameter protein rods found in most kinds of eukarytic cells. They are polymerized from a dimeric subunit made of one a subunit and one b tubulin subunit. Microtubules are associated with a family of proteins called microtubule associated proteins (MAPs), which includes the protein t (tau) and a group of proteins referred to as MAP1, MAP2, MAP3, MAP4 and MAP5. MAP2 is made up of two ~280 kDa apparent molecular weight bands referred to as MAP2a and MAP2b. A third lower molecular weight form, usually called MAP2c, corresponds to a pair of protein bands running at ~70 kDa on SDS-PAGE gels. All these MAP2 forms are derived from a single gene by alternate transcription, and all share a C-terminal sequence which includes either three or four microtubule binding peptide sequences, which are very similar to those found in the related microtubule binding protein t (tau). MAP2 isoforms are expressed only in neuronal cells and specifically in the perikarya and dendrites of these cells. Antibodies to MAP2 are therefore excellent markers on neuronal cells, their perikarya and neuronal dendrites.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized from PBS buffer pH 7.2-7.6 with 0.1% trehalose, without preservatives
Host Animal:
Chicken
Species Reactivity:
Bovine,Human,Mouse,Rat
Immunogen:
Bovine MAP2 isolated from brain by the GTP microtubule cycling method.
Applications:
ICC,IHC-Frozen,IHC-Paraffin-embedded,WB
Antibody Isotype:
IgY
Application Details:
Western Blotting (WB), Immunocytochemistry (ICC) and Immunohistochemistry (IHC). Suggested dilutions are: 1:10,00-1:20,000 (WB), 1:5,000-1:10,000 (ICC, IHC). Biosensis recommends optimal dilutions/concentrations should be determined by the end user.
Alternative Names:
Microtubule-associated protein 2; MAP-2; MAP2;
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Product references:
Michurina A (2021) "Loss of Setd1b methyltransferase in the murine forebrain as a novel model for human intellectual disability." PhD Thesis. Application: IHC (IF) Species: Mouse. Iwata M et al. (2019) "Regulatory mechanisms for the axonal localization of tau protein in neurons." Mol Biol Cell. 30(19):2441-57. Application: ICC/IF Species: Mouse, rat. Duda JK et al. (2019) "The role of DLG-MAGUKs in mediating signaling specificity at the postsynaptic density." PhD Thesis. [Epub ahead of print]. Application: ICC/IF Species: Mouse. Awashti A et al. (2018) "Synaptotagmin-3 drives AMPA receptor endocytosis, depression of synapse strength, and forgetting." Science. 2018; [Epub ahead of print]. Application: IHC/ICC/IF Species: Mouse. Wolfes AC et al. (2016) "A novel method for culturing stellate astrocytes reveals spatially distinct Ca2+ signaling and vesicle recycling in astrocytic processes." J Gen Physiol. 2016; [Epub ahead of print]. Application: IF Species: Rat. Dziennis S et al. (2007) "Role of signal transducer and activator of transcription-3 in estradiol-mediated neuroprotection." J Neurosci. 2007; 27(27):7268-74. Application: IHC Species: Rat.
Specificity:
The specificity of this antibody has been confirmed by IC. Hu, Rat, Ms, Bov
Storage:
After reconstitution of lyophilized antibody, aliquot and store at -20°C for a higher stability. Avoid freeze-thaw cycles.
Chicken anti-Myelin basic protein (MBP) Polyclonal Antibody (Unconjugated), suitable for WB, IHC-Frozen, IHC-Paraffin-embedded, ICC.
Background Info:
Myelin is a membrane characteristic of the nervous tissue and functions as an insulator to increase the velocity of the stimuli being transmitted between a nerve cell body and its target. Myelin isolated from human and bovine nervous tissue is composed of approximately 80% lipid and 20% protein, and 30% of the protein fraction constitutes myelin basic protein (MBP). MBP is an 'intrinsically unstructured' protein with a high proportion (approximately 75%) of random coil, but postulated to have core elements of beta-sheet and alpha-helix. MBP is a major protein in CNS myelin and is expressed specifically in the nervous system. A detailed immunochemical examination of monoclonal and polyclonal antibody responses to MBP and its peptides has revealed the existence of as many as 27 antigenic determinants, many of them conformational. Topological mapping of the potential antigenic determinants onto a model of MBP secondary structure places these determinants within 11 separate regions of the molecule, including those portions that have been found to be encephalitogenic. The message for myelin basic protein is selectively translocated to the ends of the cell processes. Immunization with myelin-associated antigens including MBP significantly promotes recovery after spinal cord contusion injury in the rat model. FUNCTION: Is, with PLP, the most abundant protein component of the myelin membrane in the CNS. Has a role in both the formation and stabilization of this compact multilayer arrangement of bilayers. Each splice variant and charge isomer may have a specialized function in the assembly of an optimized, biochemically functional myelin membrane (By similarity). SUBUNIT: Homodimer (By similarity). SUBCELLULAR LOCATION: Myelin membrane; peripheral membrane protein; cytoplasmic side. Cytoplasmic side of myelin. TISSUE SPECIFICITY: Found in both the central and the peripheral nervous system.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized from PBS buffer pH 7.2-7.6 with 0.1% trehalose, without preservatives
Host Animal:
Chicken
Species Reactivity:
Bovine,Human,Mouse,Other Mammals (Predicted),Rat
Immunogen:
Three peptide sequences conserved in higher verterbrate MBP protein.
Applications:
ICC,IHC-Frozen,IHC-Paraffin-embedded,WB
Antibody Isotype:
IgY
Application Details:
Western Blotting (WB), Immunocytochemistry (ICC) and Immunohistochemistry (IHC). The recommended dilution for WB is 1:5,000-10,0000 and 1:500-1,000 for IC and IH. Biosensis recommends optimal dilutions/concentrations should be determined by the end user.
Rangaraju S. et al (2009) Molecular architecture of myelinated peripheral nerves is supported by calorie restriction with aging. Aging Cell. 2009 Apr;8(2):178-91.
Specificity:
The specificity of this antibody has been confirmed by WB. This antibody stains a prominent band at approx. 20 kDa. A suitable control tissue is rat spinal cord or peripheral nerve homogenate. The major isoforms of MBP run as a closely spaced double of 22 kDa and 18 kDa. Hu, Rat, Ms, Bov. Predicted to react with other mammalian tissues due to sequence homology.
Storage:
After reconstitution of lyophilized antibody, aliquot and store at -20°C for a higher stability. Avoid freeze-thaw cycles.
Chicken anti-Neurofilament heavy polypeptide, phosphorylated (pNF-H) Polyclonal Antibody (Unconjugated), suitable for WB, ICC, IHC-Frozen.
Background Info:
Neurofilaments contain three intermediate filament proteins: light (68 kDa), medium (160 kDa) and heavy (200 kDa). Neurofilament heavy (NF200 or NF-H) is phosphorylated and it is thought that this results in the formation of interfilament cross bridges that are important in the maintenance of axonal caliber. This antibody binds primarily to the phosphorylated axonal forms of NF-H.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized from PBS buffer pH 7.2-7.6 with 0.1% trehalose, without preservatives
Western Blotting (WB), Immunocytochemistry (ICC) and Immunohistochemistry (IHC). Suggested dilution for WB is 1:20,000-50,000. Suggested dilution for ICC/IHC is 1:20,000. Biosensis recommends optimal dilutions/concentrations should be determined by the end user.
Alternative Names:
NF-200; NF200; NF-H; NEFH; N52; Neurofilament heavy polypeptide; Neurofilament triplet H protein; 200 kDa neurofilament protein; KIAA0845; NFH;
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Product references:
Jarjour A.A. et al (2007) Maintenance of axo-oligodendroglial paranodal junctions requires DCC and netrin-1. J Neurosci. 2008 Oct 22;28(43):11003-14. Pearse D.D. et al (2007) Transplantation of Schwann cells and/or olfactory ensheathing glia into the contused spinal cord: Survival, migration, axon association, and functional recovery. Glia. 2007 Jul;55(9):976-1000. Shaw G. et al (2005) Hyperphosphorylated neurofilament NF-H is a serum biomarker of axonal injury. Biochem Biophys Res Commun. 2005 Nov 4;336(4):1268-77.
Specificity:
This antibody reacts with phosphorylated NF-H and is seen as a band of approx 200 kDa in WB. Refer to publication by Shaw et al (2005) for the use of this antibody in an ELISA to detect NF-H. Hu, Rat, Ms, Fel, Chk. Predicted to react with other mammalian tissues due to sequence homology.
Storage:
Store lyophilized antibody at 2-8°C. After reconstitution, aliquot and store at -20°C for a higher stability. Avoid freeze-thaw cycles.
Purification:
IgY
Target:
Neurofilament heavy polypeptide, phosphorylated (pNF-H)
Neurofilaments are composed of three intermediate filament proteins: light (~68 kDa), medium (~160 kDa) and heavy (~200 kDa), which are involved in the maintenance of the neuronal caliber. Neurofilament light (NF68 or NF-L) is the most abundant of the three proteins.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized from PBS buffer pH 7.2-7.6 with 0.1% trehalose, without preservatives
Purified porcine NF-L from spinal cord and recombinant NF-L.
Applications:
ICC,IHC-Frozen,IHC-Paraffin-embedded,WB
Antibody Isotype:
IgY
Application Details:
Western Blotting (WB), Immunocytochemistry (ICC) and Immunohistochemistry (IHC). A dilution of 1:5,000 - 1:10,000 is recommended for WB. A dilution of 1:1,000 - 1:5,000 is recommended for ICC and IHC. Biosensis recommends optimal dilutions/concentrations should be determined by the end user.
Rangaraju S. et al (2009) Molecular architecture of myelinated peripheral nerves is supported by calorie restriction with aging. Aging Cell. 2009 Apr;8(2):178-91.
Specificity:
The specificity of this antibody has been confirmed by IC. Hu, Rat, Ms, Fel, Chk. Predicted to react with other mammalian tissues due to sequence homology.
Storage:
After reconstitution of lyophilized antibody, aliquot and store at -20°C for a higher stability. Avoid freeze-thaw cycles.
Chicken anti-Neurofilament medium polypeptide (NF-M) Polyclonal Antibody (Unconjugated), suitable for WB, IHC-Frozen, IHC-Paraffin-embedded, ICC.
Background Info:
Neurofilaments are composed of three intermediate filament proteins: light (~68 kDa), medium (~160 kDa) and heavy (~200 kDa), which are involved in the maintenance of the neuronal caliber. Neurofilament medium runs on SDS-PAGE gels in the range 145-170 kDa, with some variation in different species.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized from PBS buffer pH 7.2-7.6 with 0.1% trehalose, without preservatives
Recombinant fusion protein containing the extreme C-terminal segment of rat NF-M.
Applications:
ICC,IHC-Frozen,IHC-Paraffin-embedded,WB
Antibody Isotype:
IgY
Application Details:
Western Blotting (WB), Immunocytochemistry (ICC) and Immunohistochemistry (IHC). A dilution of 1:5,000 - 1:10,000 is recommended for WB. A dilution of 1:1,000 - 1:2,000 is recommended for ICC and IHC. Biosensis recommends optimal dilutions/concentrations should be determined by the end user.
Alternative Names:
Neurofilament medium polypeptide; NF-M; 160 kDa neurofilament protein; Neurofilament 3; Neurofilament triplet M protein; Nefm; Nef3; Nfm;
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Product references:
Jarjour A.A. et al (2007) Maintenance of axo-oligodendroglial paranodal junctions requires DCC and netrin-1. J Neurosci. 2008 Oct 22;28(43):11003-14. Rangaraju S. et al (2009) Molecular architecture of myelinated peripheral nerves is supported by calorie restriction with aging. Aging Cell. 2009 Apr;8(2):178-91. Pearse D.D. et al (2007) Transplantation of Schwann cells and/or olfactory ensheathing glia into the contused spinal cord: Survival, migration, axon association, and functional recovery. Glia. 2007 Jul;55(9):976-1000. Shaw G. et al (2004) Characterization of the bovine neurofilament NF-M protein and cDNA sequence, and identification of in vitro and in vivo calpain cleavage sites. Biochem Biophys Res Commun. 2004 Dec 10;325(2):619-25.
Specificity:
Specifically recognizes the medium neurofilament subunit NF-L in WB. Band appears at ~145 kDa in WB from rodent and ~160 kDa for human and bovine WB. Hu, Rat, Ms, Fel, Chk. Predicted to react with other mammalian tissues due to sequence homology.
Storage:
After reconstitution of lyophilized antibody, aliquot and store at -20°C for a higher stability. Avoid freeze-thaw cycles.
The enzyme Peptidylprolyl isomerase (Pin1) is responsible for flipping the proline ring from the cis to trans conformation. This enzyme regulates mitosis presumably by interacting with NIMA and attenuating its mitosis-promoting activity (ref: SWISSPROT). Pin1 is concentrated in the nucleus in small punctate structures and is particularly obvious in tumor cells.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized from PBS buffer pH 7.2-7.6 with 0.1% trehalose, without preservatives
Host Animal:
Chicken
Species Reactivity:
Cat,Human,Mouse,Other Mammals (Predicted),Rat
Immunogen:
Recombinant full length Peptidylprolyl isomerase (Pin1) purified from E.coli
Applications:
ICC,IHC-Frozen,IHC-Paraffin-embedded,WB
Antibody Isotype:
IgY
Application Details:
Western Blotting (WB) and Immunocytochemistry (ICC). A dilution of 1:5,000 - 1:10,000 is recommended for WB. A dilution of 1:500-1,000 is recommended for IC. Biosensis recommends optimal dilutions/concentrations should be determined by the end user.
The specificity of this antibody has been confirmed by WB. This antibody detects ~21 kDa Pin1 protein. Human, Rat, Mouse and Feline. Predicted to react with other mammalian tissue.
Storage:
After reconstitution of lyophilized antibody, aliquot and store at -20°C for a higher stability. Avoid freeze-thaw cycles.
Peripherin is a class-III neuronal intermediate filament protein found in certain classes of neuron, most of which are located in the peripheral nervous system.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized from PBS buffer pH 7.2-7.6 with 0.1% trehalose, without preservatives
Host Animal:
Chicken
Species Reactivity:
Cat,Human,Mouse,Other Mammals,Rat
Immunogen:
Recombinant full length rat Peripherin protein expressed in and purified from E.coli
Applications:
ICC,IHC-Frozen,IHC-Paraffin-embedded,WB
Antibody Isotype:
IgY
Application Details:
Western Blotting (WB) and Immunocytochemistry (ICC). A dilution of 1:5,000 - 1:10,000 is recommended for WB. A dilution of 1:500-1,000 is recommended for IC. Biosensis recommends optimal dilutions/concentrations should be determined by the end user.
Alternative Names:
Peripherin; Prph; Prph1;
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Product references:
Sekerkova G. et al (2008) Espin actin-cytoskeletal proteins are in rat type I spiral ganglion neurons and include splice-isoforms with a functional nuclear localization signal. J Comp Neurol. 2008 Aug 20;509(6):661-76.
Specificity:
The specificity of this antibody has been confirmed by WB. This antibody detects ~57 kDa Peripherin protein. A suitable control tissue is rat spinal cord or peripheral nerve homogenate. Hu, Rat, Ms, Fel, and other mammals
Storage:
After reconstitution of lyophilized antibody, aliquot and store at -20°C for a higher stability. Avoid freeze-thaw cycles.
This enzyme is a thiol protease that recognizes and hydrolyzes a peptide bond at the C-terminal glycine of ubiquitin. The enzyme also binds to free monoubiquitin and may prevent its degradation in lysosomes (ref: SWISSPROT).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized from PBS buffer pH 7.2-7.6 with 0.1% trehalose, without preservatives
Recombinant full length human Ubiquitin C Terminal Hydrolase 1 (UCHL1) purified from E. coli.
Applications:
ICC,IHC-Frozen,IHC-Paraffin-embedded,WB
Antibody Isotype:
IgY
Application Details:
Western Blotting (WB) and Immunocytochemistry (ICC). A dilution of 1:5,000 - 1:10,000 is recommended for WB. A dilution of 1:500-1,000 is recommended for IC. Biosensis recommends optimal dilutions/concentrations should be determined by the end user.
The specificity of this antibody has been confirmed by WB. This antibody detects ~24 kDa UCHL1 enzyme. Suitable control tissue is rat spinal cord or peripheral nerve homogenate. Hu, Rat, Ms, Bov, Por. Predicted to react with other mammalian tissues due to sequence homology.
Storage:
After reconstitution of lyophilized antibody, aliquot and store at -20°C for a higher stability. Avoid freeze-thaw cycles.
Chicken anti-Vimentin Polyclonal Antibody (Unconjugated), suitable for WB, IHC-Frozen, ICC.
Background Info:
Vimentins are class-III intermediate filaments specific to mesenchymal tissue. Vimentin is an important cytoskeletal component responsible for maintaining cell integrity and has a probable role in the intracellular transport of proteins such as lipoproteins between the nucleus and plasma membrane. Immunohistochemical staining for Vimentin is characteristic of sarcomas.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized from PBS buffer pH 7.2-7.6 with 0.1% trehalose, without preservatives
Host Animal:
Chicken
Species Reactivity:
Human,Mouse,Other Mammals (Predicted),Rat
Immunogen:
Recombinant human Vimentin purified from E.coli
Applications:
ICC,IHC-Frozen,WB
Antibody Isotype:
IgY
Application Details:
Western Blotting (WB) and Immunocytochemistry (ICC). A dilution of 1:5,000 - 1:10,000 is recommended for WB. A dilution of 1:1,000-5,000 is recommended for IC. Biosensis recommends optimal dilutions/concentrations should be determined by the end user.
Alternative Names:
VIM;
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Specificity:
The specificity of this antibody has been confirmed by WB. This antibody detects ~50 kDa Vimentin enzyme. Hu, Rat, Ms. It is predicted to react with other mammals due to sequence homology.
Storage:
After reconstitution of lyophilized antibody, aliquot and store at -20°C for a higher stability. Avoid freeze-thaw cycles.
Chicken anti-C-reactive protein (CRP) Polyclonal Antibody (Unconjugated), suitable for WB, ELISA.
Background Info:
C-reactive protein has several roles associated with host defence such as; promoting agglutination, bacterial capsular swelling, phagocytosis and complement fixation through its calcium-dependent binding to phosphorylcholine. It can interact with DNA and histones and may scavenge nuclear material released from damaged circulating cells. COFACTOR: Binds 2 calcium ions per subunit. C-reactive protein exists as a homopentamer. There are 2 alternatively spliced isoforms. C-reactive protein is found in plasma and its concentration increases greatly during acute phase response to tissue injury, infection or other inflammatory stimuli. It is induced by IL-1 and IL-6.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid. PBS with 0.02% Sodium Azide
Host Animal:
Chicken
Species Reactivity:
Human
Immunogen:
Purified human C-reactive protein
Applications:
ELISA,WB
Antibody Isotype:
IgY
Application Details:
ELISA and WB. Suggested dilution of 1:2,000-1:5,000. Biosensis recommends that the optimal working dilution should be determined by the end user.
Alternative Names:
CRP; PTX1;
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Specificity:
Human C-reactive protein Human
Storage:
Short term storage at 2-8°C for one week. At -20°C as an undiluted liquid for up to 12 months.
Chicken anti-Leptin Polyclonal Antibody (Unconjugated), suitable for WB, ELISA.
Background Info:
Leptin is secreted by white adipocytes and functions as part of a signaling pathway that can inhibit food intake and/or regulate energy expenditure to maintain constancy of the adipose mass. Leptin also has several endocrine functions and is involved in the regulation of immune and inflammatory responses, hematopoiesis, angiogenesis and wound healing (Ref: Entrez Gene).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid. PBS with 0.02% Sodium Azide
Host Animal:
Chicken
Species Reactivity:
Human
Immunogen:
Recombinant human Leptin protein
Applications:
ELISA,WB
Antibody Isotype:
IgY
Application Details:
ELISA and WB. Suggested dilution of 1:1,000-1:2,000. Biosensis recommends that the optimal working dilution should be determined by the end user.
Alternative Names:
Leptin; Obesity factor; Lep; Ob; Obese protein;
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Specificity:
Human Leptin
Storage:
Short term storage at 2-8°C for one week. At -20°C as an undiluted liquid for up to 12 months.
Chicken anti-C-reactive protein (CRP) Polyclonal Antibody (Unconjugated), suitable for WB, ELISA.
Background Info:
C-reactive protein has several roles associated with host defence such as; promoting agglutination, bacterial capsular swelling, phagocytosis and complement fixation through its calcium-dependent binding to phosphorylcholine. It can interact with DNA and histones and may scavenge nuclear material released from damaged circulating cells. COFACTOR: Binds 2 calcium ions per subunit. C-reactive protein exists as a homopentamer. There are 2 alternatively spliced isoforms. C-reactive protein is found in plasma and its concentration increases greatly during acute phase response to tissue injury, infection or other inflammatory stimuli. It is induced by IL-1 and IL-6.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid. PBS with 0.02% Sodium Azide
Host Animal:
Chicken
Species Reactivity:
Mouse
Immunogen:
A peptide from the C-terminus of mouse C-reactive protein (210-225 aa).
Applications:
ELISA,WB
Antibody Isotype:
IgY
Application Details:
ELISA and WB. Suggested dilution of 1:2,000-1:5,000. Biosensis recommends that the optimal working dilution should be determined by the end user.
Alternative Names:
CRP; PTX1;
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Specificity:
C-reactive protein Mouse
Storage:
Short term storage at 2-8°C for one week. At -20°C as an undiluted liquid for up to 12 months.
Chicken anti-Neurotrophin-3 (NT-3) Polyclonal Antibody (Unconjugated), suitable for ELISA.
Background Info:
FUNCTION: Seems to promote the survival of visceral and proprioceptive sensory neurons. SUBCELLULAR LOCATION: Secreted protein. TISSUE SPECIFICITY: Brain and peripheral tissues. SIMILARITY: Belongs to the NGF-beta family.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid. PBS with 0.02% Sodium Azide
Host Animal:
Chicken
Species Reactivity:
Human,Mouse
Immunogen:
Mixture of two human NT3 peptides (90-104 and 199-214 aa).
Applications:
ELISA
Antibody Isotype:
IgY
Application Details:
ELISA at suggested dilution of 1:500-1:2,000. Biosensis recommends that the optimal working dilution should be determined by the end user.
Chicken anti-Neurotrophin-4/5 (NT-4/5) Polyclonal Antibody (Unconjugated), suitable for ELISA.
Background Info:
FUNCTION: Target-derived survival factor for peripheral sensory sympathetic neurons. SUBCELLULAR LOCATION: Secreted protein. TISSUE SPECIFICITY: Highest levels in prostate, lower levels in thymus, placenta, and skeletal muscle. Expressed in embryonic and adult tissues. SIMILARITY: Belongs to the NGF-beta family.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid. PBS with 0.02% Sodium Azide
Host Animal:
Chicken
Species Reactivity:
Human,Mouse
Immunogen:
Mixture of two human NT4/NT5 peptides (104-118 and 198-210 aa).
Applications:
ELISA
Antibody Isotype:
IgY
Application Details:
ELISA at suggested dilution of 1:500-1:2,000. Biosensis recommends that the optimal working dilution should be determined by the end user.
Chicken anti-Leptin Polyclonal Antibody (Unconjugated), suitable for WB, ELISA.
Background Info:
Leptin is secreted by white adipocytes and functions as part of a signaling pathway that can inhibit food intake and/or regulate energy expenditure to maintain constancy of the adipose mass. Leptin also has several endocrine functions and is involved in the regulation of immune and inflammatory responses, hematopoiesis, angiogenesis and wound healing (Ref: Entrez Gene) .
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid. PBS with 0.02% Sodium Azide
Host Animal:
Chicken
Species Reactivity:
Mouse,Rat
Immunogen:
Recombinant rat Leptin protein
Applications:
ELISA,WB
Antibody Isotype:
IgY
Application Details:
ELISA and WB. Suggested dilution of 1:1,000-1:5,000. Biosensis recommends that the optimal working dilution should be determined by the end user.
Alternative Names:
Leptin; Obesity factor; Lep; Ob; Obese protein;
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Specificity:
Rat Leptin
Storage:
Short term storage at 2-8°C for one week. At -20°C as an undiluted liquid for up to 12 months.
Chicken anti-Acetyl-lysine Polyclonal Antibody (Unconjugated), suitable for WB, ELISA.
Background Info:
Lysine acetylation of histones and non-histone proteins plays an important part in many cellular processes such as chromatin and nuclear signaling, transcription, gene silencing, cell cycle progression, apoptosis, differentiation, DNA replication and repair.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid. PBS with 0.02% Sodium Azide
Host Animal:
Chicken
Species Reactivity:
Species Independent
Immunogen:
Acetylated Lysine OVA
Applications:
ELISA,WB
Antibody Isotype:
IgY
Application Details:
ELISA and WB. Suggested dilution of 1:1,000-1:5,000. Biosensis recommends that the optimal working dilution should be determined by the end user.
Alternative Names:
Acetyl-lysine;
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Specificity:
Binds to proteins with acetylated lysine residues.
Storage:
Short term storage at 2-8°C for one week. At -20°C as an undiluted liquid for up to 12 months.
BDNF belongs to the neurotrophin family and regulates the survival and differentiation of neurons during development. The alterations in BDNF expression induced by various kinds of brain insult including stress, ischemia, seizure activity and hypoglycemia, may contribute to some pathologies such as depression, epilepsy, Alzheimer's, and Parkinson's disease. Microglia release BDNF that may contribute to neuroinflammation and neuropathic pain. FUNCTION: Promotes the survival of neuronal populations that are all located either in the central nervous system or directly connected to it. Major regulator of synaptic transmission and plasticity at adult synapses in many regions of the CNS. The versatility of BDNF is emphasized by its contribution to a range of adaptive neuronal responses including long-term potentiation (LTP), long-term depression (LTD), certain forms of short-term synaptic plasticity, as well as homeostatic regulation of intrinsic neuronal excitability. SUBUNIT: Monomers and homodimers. Binds to NTRK2/TRKB. SUBCELLULAR LOCATION: Secreted protein. POst translation modification: Converted into mature BDNF by plasmin (PLG). SIMILARITY: Belongs to the NGF-beta family.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid. PBS with 0.02% Sodium Azide
Host Animal:
Chicken
Species Reactivity:
Human,Mouse
Immunogen:
Mixture of two human BDNF peptides (73-87 and 194-208 aa). Both peptides are highly conserved in human and mouse.
Applications:
ELISA
Antibody Isotype:
IgY
Application Details:
ELISA. Suggested dilution at 1:500 to 1:2,000. Biosensis recommends that the optimal working dilution should be determined by the end user.
GDNF is a glycosylated, disulfide-bonded homodimer molecule. It was first discovered as a potent survival factor for midbrain dopaminergic neurons and was then shown to rescue these neurons in animal models of Parkinson's disease. GDNF is about 100 times more efficient survival factor for spinal motor neurons than the neurotrophins. FUNCTION: Neurotrophic factor that enhances survival and morphological differentiation of dopaminergic neurons and increases their high-affinity dopamine uptake. SUBUNIT: Homodimer; disulfide-linked. SUBCELLULAR LOCATION: Secreted protein. ALTERNATIVE PRODUCTS: 2 named isoforms produced by alternative splicing. DISEASE: Defects in GDNF may be a cause of Hirschsprung disease (HSCR). In association with mutations of RET gene, defects in GDNF may be involved in Hirschsprung disease. This genetic disorder of neural crest development is characterized by the absence of intramural ganglion cells in the hindgut, often resulting in intestinal obstruction. DISEASE: Defects in GDNF are a cause of congenital central hypoventilation syndrome (CCHS); also known as congenital failure of autonomic control or Ondine curse. CCHS is a rare disorder characterized by abnormal control of respiration in the absence of neuromuscular or lung disease, or an identifiable brain stem lesion. A deficiency in autonomic control of respiration results in inadequate or negligible ventilatory and arousal responses to hypercapnia and hypoxemia. SIMILARITY: Belongs to the TGF-beta family. GDNF subfamily.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid. PBS with 0.02% Sodium Azide
Host Animal:
Chicken
Species Reactivity:
Human,Mouse,Rat
Immunogen:
Mixture of two human GDNF peptides (101-118 and 199-211 aa). Both peptides are highly conserved in human and mouse.
Applications:
ELISA,ICC,IHC-Frozen,WB
Antibody Isotype:
IgY
Application Details:
ELISA, WB and IHC. WB suggested dilution of 1:500-1:2,000. IHC suggested dilution of 1:50-1:500. Biosensis recommends that the optimal working dilution should be determined by the end user.
Chicken anti-Appetite-regulating hormone (Grehlin) Polyclonal Antibody (Unconjugated), suitable for ELISA.
Background Info:
Ghrelin is the ligand for growth hormone secretagogue receptor type 1 (GHSR) and upon binding to the receptor it induces the release of growth hormone from the pituitary. This ligand has an appetite-stimulating effect and is involved in growth regulation (Ref: SWISSPROT).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid. PBS with 0.02% Sodium Azide
Host Animal:
Chicken
Species Reactivity:
Human,Mouse,Rat
Immunogen:
Synthetic peptide from human Ghrelin, C-terminal, (17-28 aa)
Applications:
ELISA
Antibody Isotype:
IgY
Application Details:
ELISA. Suggested dilution at 1:500 to 1:2,000. Biosensis recommends that the optimal working dilution should be determined by the end user.
Chicken anti-G-Protein B3 (Rho) Polyclonal Antibody (Unconjugated), suitable for WB.
Background Info:
G-Protein b3 (GNB3) is a guanine nucleotide-binding protein (G protein). G-proteins are involved as a modulator or transducer in various transmembrane signaling systems (Ref: SWISSPROT).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid. PBS with 0.02% Sodium Azide
Host Animal:
Chicken
Species Reactivity:
Human,Mouse,Rat
Immunogen:
Human GNB3 peptide (216-230 aa)
Applications:
WB
Antibody Isotype:
IgY
Application Details:
WB. Suggested dilution at 1:1,000 to 1:5,000. Biosensis recommends that the optimal working dilution should be determined by the end user.
Chicken anti-Rhodopsin Polyclonal Antibody (Unconjugated), suitable for WB.
Background Info:
Rod shaped photoreceptor cells that are required for image-forming vision at low light intensity and for photoreceptor cell viability after birth (ref: SWISSPROT).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Purified chicken IgY. Liquid in PBS with 0.02% Sodium Azide. Concentration 1 mg/mL.
Host Animal:
Chicken
Species Reactivity:
Mouse,Rat,Tiger Finch,Zebra Finch
Immunogen:
Mixture of synthetic peptide (14-26 aa) of Mouse Green cones Opsin 1 and synthetic peptide (18-30 aa) of Tiger finch red cones opsin 1 was used as immunogen.
Applications:
WB
Antibody Isotype:
IgY
Application Details:
WB. Suggested dilution at 1:500 to 1:2,000. The antibody recognizes a band of approximately 37 kD on mouse brain lysate. To minimise background staining, a higher concentration of detergent (such as Tween-20) is suggested in the dilution and washing steps. Biosensis recommends that the optimal working dilution should be determined by the end user.
Alternative Names:
Rho; Green cone; Red cone; opsin1;
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Specificity:
Mouse, Rat, Tiger Finch, Zebra finch
Storage:
Short term storage at 2-8°C for one week. At -20°C as an undiluted liquid for up to 12 months.
Chicken anti-Hormone-sensitive lipase (HSL) Polyclonal Antibody (Unconjugated), suitable for WB.
Background Info:
Hormone Sensitive Lipase (HSL) hydrolyzes stored triglycerides to free fatty acids in adipose tissue and heart. In steroidogenic tissues, HSL principally converts cholesteryl esters to free cholesterol for steroid hormone production (ref: SWISSPROT).
Chicken anti-Hormone-sensitive lipase (HSL) Polyclonal Antibody (Unconjugated), suitable for WB.
Background Info:
Hormone Sensitive Lipase (HSL) hydrolyzes stored triglycerides to free fatty acids in adipose tissue and heart. In steroidogenic tissues, HSL principally converts cholesteryl esters to free cholesterol for steroid hormone production (ref: SWISSPROT).
WB. Suggested dilution at 1:1,000 to 1:5,000. Biosensis recommends that the optimal working dilution should be determined by the end user.
Alternative Names:
HSL; LIPE; Hormone-sensitive lipase; Lipe;
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Specificity:
This antibody detects HSL at approx 83 kDa in various fat cell lysates from mouse and rat. Additional weaker band may appear at approx 40 kDa (unknown). Mouse, Rat, Human
Storage:
Short term storage at 2-8°C for one week. At -20°C as an undiluted liquid for up to 12 months.
Chicken anti-Adiponectin Polyclonal Antibody (Unconjugated), suitable for WB.
Background Info:
Adiponectin is synthesized by adipocytes and is involved in the control of fat metabolism and insulin sensitivity, with direct anti-diabetic, anti-atherogenic and anti-inflammatory activities (ref: SWISSPROT).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid. PBS with 0.02% Sodium Azide
Host Animal:
Chicken
Species Reactivity:
Human,Mouse,Rat
Immunogen:
A synthetic peptide from human Adiponectin (230-244 aa).
Applications:
WB
Antibody Isotype:
IgY
Application Details:
WB. Suggested dilution of 1:2,000-1:5,000. Biosensis recommends that the optimal working dilution should be determined by the end user.
Chicken anti-Appetite-regulating hormone, active (Active Ghrelin) Polyclonal Antibody (Unconjugated), suitable for ELISA.
Background Info:
Ghrelin is the ligand for growth hormone secretagogue receptor type 1 (GHSR) and upon binding to the receptor it induces the release of growth hormone from the pituitary. This ligand has an appetite-stimulating effect and is involved in growth regulation (Ref: SWISSPROT).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid. PBS with 0.02% Sodium Azide
Host Animal:
Chicken
Species Reactivity:
Human,Mouse,Rat
Immunogen:
Human active Ghrelin peptide (24-33 aa) S3n-octanoicacid covalently linked to amino acid 28
Applications:
ELISA
Antibody Isotype:
IgY
Application Details:
ELISA . Suggested dilution at 1:500 to 1:4,000. Biosensis recommends that the optimal working dilution should be determined by the end user.
CNTF is a survival promoting factor for different types of neurons in vitro and in vivo. The essential structural features for the biological function of human CNTF were investigated by Thier, M. et al. They showed that deletion of 14 N-terminal and 18 C-terminal amino acids significantly increased bioactivity compared to wild-type CNTF. FUNCTION: CNTF is a survival factor for various neuronal cell types. Seems to prevent the degeneration of motor axons after axotomy. SUBUNIT: Homodimer. SUBCELLULAR LOCATION: Cytoplasm. TISSUE SPECIFICITY: Nervous system. PHARMACEUTICAL: CNTF is being tested under the name Axokine by Regeneron Pharmaceuticals for treatment of human motor neuron diseases, such as amyotrophic lateral sclerosis (ALS). As it induces substantial weight loss, preferentially of fat as opposed to lean body mass, it is being used for obesity treatment. SIMILARITY: Belongs to the CNTF family.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid. PBS with 0.02% Sodium Azide
Host Animal:
Chicken
Species Reactivity:
Human,Mouse,Rat
Immunogen:
Mixture of two peptides from human CNTF (11-25 and 186-200 aa). Both peptides are highly conserved among human and mouse.
Applications:
ELISA,WB
Antibody Isotype:
IgY
Application Details:
WB and ELISA at a suggested dilution of 1:500 to 1:2,000. A titration between 1:50 to 1:500 is suggested for IHC. Biosensis recommends that the optimal working dilution should be determined by the end user.
Alternative Names:
Ciliary neurotrophic factor; CNTF;
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Specificity:
CNTF, Cross reactivity to other species is expected
Storage:
Short term storage at 2-8°C for one week. At -20°C as an undiluted liquid for up to 12 months.
Fatty acid-binding protein, adipocyte (ALBP) is a lipid transport protein which binds long chain fatty acids and other hydrophobic ligands and delivers them to their receptors in the nucleus. ALBP is found in the cytoplasm and nucleus of adipocytes.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid. PBS with 0.02% Sodium Azide
Host Animal:
Chicken
Species Reactivity:
Human
Immunogen:
Human Fatty acid-binding protein, adipocyte peptide (97-111 aa).
Applications:
WB
Antibody Isotype:
IgY
Application Details:
WB. Suggested dilution of 1:2,000-1:5,000. Biosensis recommends that the optimal working dilution should be determined by the end user.
Fatty acid-binding protein, adipocyte (ALBP) is a lipid transport protein which binds long chain fatty acids and other hydrophobic ligands and delivers them to their receptors in the nucleus. ALBP is found in the cytoplasm and nucleus of adipocytes.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid. PBS with 0.02% Sodium Azide
Host Animal:
Chicken
Species Reactivity:
Human,Mouse,Rat
Immunogen:
Mixture of two human Fatty acid-binding protein, adipocyte peptide peptides (71-82 aa, 97-111 aa).
Applications:
ELISA,WB
Antibody Isotype:
IgY
Application Details:
WB and ELISA. Suggested dilution of 1:1,000-1:5,000. Biosensis recommends that the optimal working dilution should be determined by the end user.
Beta-adrenergic receptors are multi-pass membrane proteins that belong to the G-protein coupled receptor 1 family. Their function is to mediate the catecholamine-induced activation of adenylate cyclase through the action of G-proteins (ref: SWISSPROT).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid. PBS with 0.02% Sodium Azide
Host Animal:
Chicken
Species Reactivity:
Mouse,Rat
Immunogen:
A synthetic peptide from mouse beta 3 Adrenergic Receptor (386-400 aa).
Applications:
ELISA,WB
Antibody Isotype:
IgY
Application Details:
WB and ELISA. Suggested dilution of 1:2,000-1:5,000. Biosensis recommends that the optimal working dilution should be determined by the end user.
Chicken anti-Obestatin Polyclonal Antibody (Unconjugated), suitable for ELISA.
Background Info:
Obestatin is generated from the proteolytic cleavage of Ghrelin.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid. PBS with 0.02% Sodium Azide
Host Animal:
Chicken
Species Reactivity:
Mouse,Rat
Immunogen:
Obestatin peptide (76-98 aa) from mouse ghrelin precursor.
Applications:
ELISA
Antibody Isotype:
IgY
Application Details:
ELISA . Suggested dilution at 1:500 to 1:2,000 in coating buffer as coating antibody in competitive ELISA testing. Biosensis recommends that the optimal working dilution should be determined by the end user.
Chicken anti-Orexin A Polyclonal Antibody (Unconjugated), suitable for ELISA.
Background Info:
FUNCTION: Neuropeptides that play a significant role in the regulation of food intake and sleep-wakefulness, possibly by coordinating the complex behavioral and physiologic responses of these complementary homeostatic functions. A broader role in the homeostatic regulation of energy metabolism, autonomic function, hormonal balance and the regulation of body fluids, is also suggested. Orexin-A binds to both OX1R and OX2R with a high affinity, whereas orexin-B binds only to OX2R with a similar high affinity. SUBCELLULAR LOCATION: Endoplasmic reticulum; rough endoplasmic reticulum. Associated with perikaryal rough endoplasmic reticulum as well as cytoplasmic large granular vesicles at synapses. SIMILARITY: Belongs to the orexin family.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid. PBS with 0.02% Sodium Azide
Host Animal:
Chicken
Species Reactivity:
Human,Mouse,Rat
Immunogen:
A peptide from the N-terminus of human Orexin A (1-13 aa) .
Applications:
ELISA
Antibody Isotype:
IgY
Application Details:
ELISA . Suggested dilution at 1:2,000 to 1:5,000 as a detection antibody and 1:200 to 1:1,000 as a coating antibody in sandwich ELISA. Biosensis recommends that the optimal working dilution should be determined by the end user.
Chicken anti-Orexin B Polyclonal Antibody (Unconjugated), suitable for ELISA.
Background Info:
FUNCTION: Neuropeptides that play a significant role in the regulation of food intake and sleep-wakefulness, possibly by coordinating the complex behavioral and physiologic responses of these complementary homeostatic functions. A broader role in the homeostatic regulation of energy metabolism, autonomic function, hormonal balance and the regulation of body fluids, is also suggested. Orexin-A binds to both OX1R and OX2R with a high affinity, whereas orexin-B binds only to OX2R with a similar high affinity. SUBCELLULAR LOCATION: Endoplasmic reticulum; rough endoplasmic reticulum. Associated with perikaryal rough endoplasmic reticulum as well as cytoplasmic large granular vesicles at synapses. SIMILARITY: Belongs to the orexin family.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid. PBS with 0.02% Sodium Azide
Host Animal:
Chicken
Species Reactivity:
Human,Mouse,Rat
Immunogen:
A peptide from the N-terminus of human Orexin B (1-14 aa).
Applications:
ELISA
Antibody Isotype:
IgY
Application Details:
ELISA . Suggested dilution at 1:2,000 to 1:5,000 as a detection antibody and 1:200 to 1:1,000 as a coating antibody in sandwich ELISA. Biosensis recommends that the optimal working dilution should be determined by the end user.
Peroxisome proliferator-activated receptor gamma (PPARG) is a nuclear hormone receptor that binds peroxisome proliferators such as hypolipidemic drugs and fatty acids. Once activated by a ligand, the receptor binds to a promoter element in the gene for acyl-CoA oxidase and activates its transcription (Ref: SWISSPROT).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid. PBS with 0.02% Sodium Azide
Host Animal:
Chicken
Species Reactivity:
Human
Immunogen:
Human Peroxisome proliferator-activated receptor gamma peptide (115-129 aa).
Applications:
WB
Antibody Isotype:
IgY
Application Details:
WB. Suggested dilution at 1:2,000 to 1:5,000. Biosensis recommends that the optimal working dilution should be determined by the end user.
Alternative Names:
PPAR gamma; PPAR-gamma; Nuclear receptor subfamily 1 group C member 3; PPARG; NR1C3;
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Specificity:
Human Peroxisome proliferator-activated receptor gamma
Storage:
Short term storage at 2-8°C for one week. At -20°C as an undiluted liquid for up to 12 months.
Chicken anti-Presenilin-1 (PS-1) Polyclonal Antibody (Unconjugated), suitable for WB, ELISA.
Background Info:
Presenilin-1 (PSEN1) is a multi-pass membrane protein and component of the gamma-secretase complex. PSEN1 is thought to play a role in intracellular signaling and gene expression or in linking chromatin to the nuclear membrane. It may also play a role in hematopoiesis. Defects in PSEN1 are a cause of Alzheimer disease type 3 (AD3), a familial early-onset form of Alzheimer disease (Ref:SWISS-Prot).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid. PBS with 0.02% Sodium Azide
Host Animal:
Chicken
Species Reactivity:
Human,Mouse,Rat
Immunogen:
Mixture of two human Presenilin 1 peptides (311-322 and 341-352 aa). Both sequences are highly conserved in human, mouse and rat.
Applications:
ELISA,WB
Antibody Isotype:
IgY
Application Details:
WB and ELISA. Suggested dilution of 1:1,000 to 1:4,000. To minimise background staining, a higher concentration of detergent (such as Tween-20) is suggested in the dilution and washing steps. Biosensis recommends that the optimal working dilution should be determined by the end user.
Alternative Names:
Presenilin 1; PS-1; Protein S182; PS1-CTF12; PSEN1; AD3; PS1; PSNL1;
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Specificity:
Human Presenilin 1
Storage:
Short term storage at 2-8°C for one week. At -20°C as an undiluted liquid for up to 12 months.
Chicken anti-Presenilin-2 (PS-2) Polyclonal Antibody (Unconjugated), suitable for WB, ELISA.
Background Info:
Presenilin-2 (PSEN2) is a multi-pass membrane protein and component of the gamma-secretase complex. Defects in PSEN2 are a cause of Alzheimer disease type 4 (AD4), an autosomal dominant Alzheimer disease. (Ref:SWISS-Prot).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid. PBS with 0.02% Sodium Azide
Host Animal:
Chicken
Species Reactivity:
Human,Mouse,Rat
Immunogen:
Mixture of two human Presenilin 2 peptides (319-330 and 349-360 aa). Both sequences are highly conserved in human, mouse and rat.
Applications:
ELISA,WB
Antibody Isotype:
IgY
Application Details:
WB and ELISA. Suggested dilution of 1:1,000 to 1:4,000. To minimise background staining, a higher concentration of detergent (such as Tween-20) is suggested in the dilution and washing steps. Biosensis recommends that the optimal working dilution should be determined by the end user.
Chicken anti-Peptide YY (PYY) Polyclonal Antibody (Unconjugated), suitable for ELISA.
Background Info:
Peptide YY (PYY) is secreted from endocrine cells in the lower small intestine, colon and pancreas. PYY inhibits exocrine pancreatic secretion, has a vasoconstrictory action and inhibitis jejunal and colonic mobility (Ref: SWISS-Prot).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid. PBS with 0.02% Sodium Azide
Host Animal:
Chicken
Species Reactivity:
Human,Mouse,Rat
Immunogen:
A peptide from the C-terminus of human mature Peptide YY (24-36 aa) .
Applications:
ELISA
Antibody Isotype:
IgY
Application Details:
ELISA. Suggested dilution at 1:200 to 1:1,000 (coating antibody) and 1:2,000 to 1:5,000 (detection antibody). Biosensis recommends that the optimal working dilution should be determined by the end user.
Chicken anti-Peptide YY (PYY) Polyclonal Antibody (Unconjugated), suitable for ELISA.
Background Info:
Peptide YY (PYY) is secreted from endocrine cells in the lower small intestine, colon and pancreas. PYY inhibits exocrine pancreatic secretion, has a vasoconstrictory action and inhibitis jejunal and colonic mobility (Ref: SWISS-Prot).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid. PBS with 0.02% Sodium Azide
Host Animal:
Chicken
Species Reactivity:
Human,Mouse,Rat
Immunogen:
A peptide from the C-terminus of human mature Peptide YY (24-36 aa) .
Applications:
ELISA
Antibody Isotype:
IgY
Application Details:
ELISA . Suggested dilution at 1:2,000 to 1:10,000 (detection antibody). Biosensis recommends that the optimal working dilution should be determined by the end user.
Chicken anti-Peptide YY (PYY) Polyclonal Antibody (Unconjugated), suitable for ELISA.
Background Info:
Peptide YY (PYY) is secreted from endocrine cells in the lower small intestine, colon and pancreas. PYY inhibits exocrine pancreatic secretion, has a vasoconstrictory action and inhibitis jejunal and colonic mobility (Ref: SWISS-Prot).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid. PBS with 0.02% Sodium Azide
Host Animal:
Chicken
Species Reactivity:
Human,Mouse,Rat
Immunogen:
A peptide from the N-terminus of human mature Peptide YY (3-18 aa).
Applications:
ELISA
Antibody Isotype:
IgY
Application Details:
ELISA . Suggested dilution at 1:200 to 1:1,000 (coating antibody) and 1:2,000 to 1:5,000 (detection antibody) .
Chicken anti-Peptide YY (PYY) Polyclonal Antibody (Unconjugated), suitable for ELISA.
Background Info:
Peptide YY (PYY) is secreted from endocrine cells in the lower small intestine, colon and pancreas. PYY inhibits exocrine pancreatic secretion, has a vasoconstrictory action and inhibitis jejunal and colonic mobility (Ref: SWISS-Prot).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid. PBS with 0.02% Sodium Azide
Host Animal:
Chicken
Species Reactivity:
Human,Mouse,Rat
Immunogen:
A peptide from the N-terminus of human mature Peptide YY (3-18 aa).
Applications:
ELISA
Antibody Isotype:
IgY
Application Details:
ELISA . Suggested dilution at 1:2,000 to 1:10,000 (detection antibody). Biosensis recommends that the optimal working dilution should be determined by the end user.
Chicken anti-C-reactive protein (CRP) Polyclonal Antibody (Unconjugated), suitable for WB, ELISA.
Background Info:
C-reactive protein has several roles associated with host defence such as; promoting agglutination, bacterial capsular swelling, phagocytosis and complement fixation through its calcium-dependent binding to phosphorylcholine. It can interact with DNA and histones and may scavenge nuclear material released from damaged circulating cells. COFACTOR: Binds 2 calcium ions per subunit. C-reactive protein exists as a homopentamer. There are 2 alternatively spliced isoforms. C-reactive protein is found in plasma and its concentration increases greatly during acute phase response to tissue injury, infection or other inflammatory stimuli. It is induced by IL-1 and IL-6.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid. PBS with 0.02% Sodium Azide
Host Animal:
Chicken
Species Reactivity:
Rat
Immunogen:
A peptide from rat C-reactive protein (108-121 aa).
Applications:
ELISA,WB
Antibody Isotype:
IgY
Application Details:
WB and ELISA. Suggested dilution of 1:2,000-1:5,000. Biosensis recommends that the optimal working dilution should be determined by the end user.
Alternative Names:
CRP; PTX1;
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Specificity:
Rat C-reactive protein
Storage:
Short term storage at 2-8°C for one week. At -20°C as an undiluted liquid for up to 12 months.
Transforming growth factor beta-1 (TGFB1) is a multi-functional cytokine with roles in proliferation, differentiation and other functions in many cell types. The secreted TGFB1 protein is cleaved into a latency-associated peptide (LAP) and a mature TGFB1 peptide (Ref: SWISS-Prot).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid. PBS with 0.02% Sodium Azide
Host Animal:
Chicken
Species Reactivity:
Human,Mouse,Pig,Rat
Immunogen:
A peptide from human and mouse Transforming growth factor beta-1 (372-386 aa).
Applications:
ELISA,WB
Antibody Isotype:
IgY
Application Details:
WB and ELISA. Suggested dilution of 1:2,000-1:5,000. Biosensis recommends that the optimal working dilution should be determined by the end user.
Alternative Names:
TGFB1; TGFB; TGF-beta-1;
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Specificity:
TGF beta 1, cross reactivity to other species is expected
Storage:
Short term storage at 2-8°C for one week. At -20°C as an undiluted liquid for up to 12 months.
Chicken anti-Mitochondrial uncoupling protein 3 (UCP 3) Polyclonal Antibody (Unconjugated), suitable for WB.
Background Info:
Uncoupling Protein 3 (UCP3) belongs to the mitochondrial carrier family. Located in the mitochondrion inner membrane, UCP3 creates proton leaks across the membrane thus uncoupling oxidative phosphorylation (Ref: SWISSPROT).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid. PBS with 0.02% Sodium Azide
Host Animal:
Chicken
Species Reactivity:
Human,Mouse,Pig,Rat
Immunogen:
A peptide from the C-terminus of human Uncoupling Protein 3 (298-312 aa).
Applications:
WB
Antibody Isotype:
IgY
Application Details:
WB. Suggested dilution at 1:1,000 to 1:5,000. Biosensis recommends that the optimal working dilution should be determined by the end user.
Alternative Names:
UCP3; Mitochondrial uncoupling protein 3; UCP 3; Solute carrier family 25 member 9; SLC25A9;
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Specificity:
This antibody detects UCP3 at approx 35 kDa. Human, Mouse, Rat, Porcine
Storage:
Short term storage at 2-8°C for one week. At -20°C as an undiluted liquid for up to 12 months.
Dicer is the rate limiting enzyme in the formation of mature microRNAs.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized from PBS, 0.02% sodium azide
Host Animal:
Chicken
Species Reactivity:
Mouse,Rat
Immunogen:
A synthetic peptide from mouse Dicer protein (1388-1405 aa) conjugated to KLH.
Applications:
ICC,IHC-Frozen,WB
Antibody Isotype:
IgY
Application Details:
Western Blotting (WB), Immunohistochemistry (IHC) and Immunoprecipitation (IP). The recommended concentration for IHC in formalin fixed and paraffin embedded tissues and formalin/acetone fixed tissues is 1:200-1:500. For WB, the recommended concentration is 1:1,000 to 1:3,000. Mouse Dicer Protein has a predicted length of 1916 residues and the MW of the monomer is 218 kDa. Biosensis recommends optimal dilutions/concentrations should be determined by the end user.
Lugli G. et al (2008) Expression of microRNAs and their precursors in synaptic fractions of adult mouse forebrain. J Neurochem. Jul;106(2):650-61. Lugli G. et al (2005) Dicer and eIF2c are enriched at postsynaptic densities in adult mouse brain and are modified by neuronal activity in a calpain-dependent manner. J Neurochem. Aug;94(4):896-905.
Specificity:
Specificity confirmed by IHC and WB in mouse brain. Mouse; Rat;
Storage:
At least 12 months after purchase at 2-8°C (lyophilized formulations). After reconstitution, aliquot and store at -20°C for a higher stability and at 2-8°C with an appropriate antibacterial agent. Avoid freeze-thaw cycles.
FUNCTION: Nerve growth factor is important for the development and maintenance of the sympathetic and sensory nervous systems. It stimulates division and differentiation of sympathetic and embryonic sensory neurons. SUBUNIT: Homodimer, associated by noncovalent forces. SUBCELLULAR LOCATION: Secreted protein. SIMILARITY: Belongs to the NGF-beta family.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid. PBS with 0.02% Sodium Azide
Host Animal:
Chicken
Species Reactivity:
Human,Mouse,Rat
Immunogen:
Mixture of two mouse beta NGF peptides (74-85 and 113-124 aa).
Applications:
ELISA,IHC-Frozen,WB
Antibody Isotype:
IgY
Application Details:
ELISA, WB and IHC. WB suggested dilution of 1:500-1:2,000. IHC suggested dilution of 1:50-1:1,000. Biosensis recommends that the optimal working dilution should be determined by the end user.
Alternative Names:
Beta-nerve growth factor; Beta-NGF; NGF; NGFB;
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Specificity:
Human beta NGF, cross reactivity to other species NGF is expected
Storage:
Short term storage at 2-8°C for one week. At -20°C as an undiluted liquid for up to 12 months.
Chicken anti-Growth associated protein 43 (GAP-43) Polyclonal Antibody (Unconjugated), suitable for WB, ICC.
Background Info:
GAP43 is very abundant protein which is found concentrated in neurons. One group discovered it as one of three proteins which becomes unregulated during the regeneration of the toad optic nerve (1). Three GAPs (Growth associated proteins) were discovered, and the number 43 comes from the apparent SDS-PAGE molecular weight of the one named GAP43. The HGNC name for this protein is, not surprisingly, GAP43. Later work showed that GAP43 does not run on SDS-PAGE in a fashion which accurately reflects its molecular weight, and that GAP43 proteins from different species may run at different apparent molecular weights. Partly due to these features GAP43 were independently discovered by several different groups and therefore has several alternate names, such as protein F1, pp46, neuromodulin, neural phosphoprotein B-50 and calmodulin-binding protein P-57. In each case the number reflects the apparent SDS-PAGE molecular weight, and underlines the unusual properties of this molecule. Mammalian GAP43 proteins contains only 226-243 amino acids, and so the real molecular weight is 23.61-25.14 kDa. GAP43 has been extensively studied and is known to be a major protein kinase C substrate and to bind calmodulin avidly. GAP43 is anchored to the plasma membrane by palmitoylation modifications.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized from PBS buffer pH 7.2-7.6 with 0.1% trehalose, without preservatives
Host Animal:
Chicken
Species Reactivity:
Bovine,Human,Other Mammals (Predicted),Rat
Immunogen:
C-terminal peptide 217-227 of rat and mouse GAP43, which is KEDPEADQEHA, to which an N terminal Cysteine residue was added to allow chemical coupling to Keyhole Limpet Hemocyanin carrier protein.
Applications:
ICC,WB
Antibody Isotype:
IgY
Application Details:
Western Blotting (WB) and Immunocytochemistry (ICC). A dilution of 1:1,000 - 1:5,000 is recommended for WB. A dilution of 1:500-1,000 is recommended for ICC. Biosensis recommends optimal dilutions/concentrations should be determined by the end user.
Alternative Names:
neuron growth-associated protein 43; neuromodulin; nerve growth-related peptide GAP43; axonal membrane protein GAP-43; protein F1; calmodulin-binding protein P-57; neural phosphoprotein B-50; Growth Associated Protein 43; GAP43;
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Specificity:
The antibody reacts with a 43 kDa band by Western blot on bovine hippocampus lysate. It has also been used successfully for immunocytochemistry. Human, rat and bovine. It is expected that it will work on other mammal tissues due to amino acid sequence similarity.
Storage:
Store lyophilized, unopened vial at 2-8°C or lower. After reconstitution, prepare aliquots and store at -20°C to -80°C for a higher stability. Avoid freeze-thaw cycles.
Chicken anti-mCherry Polyclonal Antibody (Unconjugated), suitable for WB, ICC.
Background Info:
mCherry is an engineered derivative of one of a family of proteins originally isolated from Cnidarians (jelly fish, sea anemones and corals). The mCherry protein was derived from DsRed, a red fluorescent protein from so-called disc corals of the genus Discosoma. DsRed is a 223 amino acid ~28 kDa protein similar in size and properties to GFP, but, obviously, produces a red rather than a green fluorochrome. The original DsRed was engineered extensively in the Tsien lab to prevent it from forming tetramers and dimers and to modify and improve the spectral properties (1-3). The resulting monomeric protein is useful for applications such as Foerster Resonance Energy Transfer (FRET, also known as Fluorescence Resonance Energy Transfer). Several further cycles of mutation, directed modification and evolutionary selection produced mCherry, which is monomeric and has an excitation maximum at 587 nm and and emission maximum at 610 nm (4).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized from PBS buffer pH 7.2-7.6 with 0.1% trehalose, without preservatives
Host Animal:
Chicken
Species Reactivity:
Species Independent
Immunogen:
Recombinant full length mCherry.
Applications:
ICC,WB
Antibody Isotype:
IgY
Application Details:
Western Blotting (WB) and Immunocytochemistry (ICC). A dilution of 1:2,000 - 1:5,000 isC recommended for WB. A dilution of 1:500-1,000 is recommended for IC. Biosensis recommends optimal dilutions/concentrations should be determined by the end user.
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Specificity:
The antibody reacts with a band at ~28-30 kDa corresponding to intact full-length mCherry by Western blot on HEK293 cells transfected with mCherry vector. It has also been used successfully for immunocytochemistry.
Storage:
Store lyophilized, unopened vial at 2-8°C or lower. After reconstitution, prepare aliquots and store at -20°C to -80°C for a higher stability. Avoid freeze-thaw cycles.
Chicken anti-GDNF family receptor alpha-1 (GFR alpha-1) Polyclonal Antibody (Unconjugated), suitable for WB, ICC.
Background Info:
Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. The GFR_-1 is a member of the GDNF receptor family. It is a glycosylphosphatidylinositol (GPI)-linked cell surface receptor for both GDNF and NTN, and mediates activation of the RET tyrosine kinase receptor (www.ncbi.nlm.nih.gov/gene/2674).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Concentrated ammonium sulphate in PBS pH 7.4 containing no preservatives.
Host Animal:
Chicken
Species Reactivity:
Human
Immunogen:
Recombinant His-tagged human GFR alpha-1 protein produced using CHO-based cell line. For production of hGFR alpha-1, glycosylphosphatidyl-inositol GPI-anchor was removed and protein was secreted to the cell culture supernatant. Protein was purified by Ni-affinity chromatography following gel-filtration from cell culture supernatant.
Applications:
ICC,WB
Antibody Isotype:
IgY
Application Details:
WB, ICC. A dilution of 1:5,000 to 1:10,000 is recommended for Western blot and 1:1,000 to 1:2,000 for Immunocytochemistry. Biosensis recommends optimal dilutions/concentrations should be determined by the end user.
Alternative Names:
RET ligand 1;TGF-beta related neurotrophic factor receptor 1; GDNFR-alpha-1; GFR-alpha-1; TRNR1; RETL1; GFRA1;
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Specificity:
Human GFR alpha-1. No cross reaction with hGFR alpha-2, hGFR alpha-3, hGFR alpha-4
Storage:
Store at 2-8°C upon receipt; DO NOT FREEZE. As product is (NH4)2SO4 (ammonium sulfate) precipitate, mix well by pipetting or vortexing prior to use. See reconstitution instructions for more information.
Chicken anti-GDNF family receptor alpha-2 (GFR alpha-2) Polyclonal Antibody (Unconjugated), suitable for WB, ICC.
Background Info:
Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. GFR_-2 is a member of the GDNF receptor family. It is a glycosylphosphatidyl-inositol(GPI)-linked cell surface receptor for both GDNF and NTN, and mediates activation of the RET tyrosine kinase receptor. This encoded protein acts preferentially as a receptor for NRTN compared to its other family member, GDNF family receptor alpha 1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Concentrated ammonium sulphate in PBS pH 7.4 containing no preservatives.
Host Animal:
Chicken
Species Reactivity:
Human
Immunogen:
Recombinant His-tagged human GFR alpha-2 protein produced using CHO-based cell line. For production of hGFR alpha-2, glycosylphosphatidyl-inositol GPI-anchor was removed and protein was secreted to the cell culture supernatant. Protein was purified by Ni-affinity chromatography following gel-filtration from cell culture supernatant.
Applications:
ICC,WB
Antibody Isotype:
IgY
Application Details:
WB, ICC. A dilution of 1:5,000 to 1:10,000 is recommended for Western blot and 1:500 to 1:1,000 for Immunocytochemistry. Biosensis recommends optimal dilutions/concentrations should be determined by the end user.
human GFR alpha-2. No cross reaction with hGFR alpha-1, hGFR alpha-3, hGFR alpha-4
Storage:
Store at 2-8°C upon receipt; DO NOT FREEZE. As product is (NH4)2SO4 (ammonium sulfate) precipitate, mix well by pipetting or vortexing prior to use. See reconstitution instructions for more information.
Chicken anti-GDNF family receptor alpha-3 (GFR alpha-3) Polyclonal Antibody (Unconjugated), suitable for WB, ICC.
Background Info:
The GFRa-3 is a glycosylphosphatidylinositol(GPI)-linked cell surface receptor and a member of the GDNF receptor family. It forms a signaling receptor complex with RET tyrosine kinase receptor and binds the ligand, artemin.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Concentrated ammonium sulphate in PBS pH 7.4 contain no preservatives
Host Animal:
Chicken
Species Reactivity:
Human
Immunogen:
Recombinant His-tagged human GFRa-3 protein produced using CHO-based cell line. For production of hGFRa-3, glycosylphosphatidyl-inositol GPI-anchor was removed and protein was secreted to the cell culture supernatant. Protein was purified by Ni-affinity chromatography following gel-filtration from cell culture supernatant.
Applications:
ICC,WB
Antibody Isotype:
IgY
Application Details:
WB, ICC. A dilution of 1:5 000 to 1:10 000 is recommended for Western blot and 1:1500 to1:3000 for immunocytochemistry. Biosensis recommends that optimal dilutions/concentrations should be determined by the end user.
Human GFRa-3. No cross-reactivity with hGFRa-1, hGFRa-2, hGFRa-4.
Storage:
Store at 2-8°C upon receipt; DO NOT FREEZE. As product is (NH4)2SO4 (ammonium sulfate) precipitate, mix well by pipetting or vortexing prior to use. See reconstitution instructions for more information.
Chicken anti-GDNF family receptor alpha-4 (GFR alpha-4) Polyclonal Antibody (Unconjugated), suitable for WB, IHC-Frozen.
Background Info:
GFR_-4 belongs to the GDNF receptor family. It is a glycosyl-phosphatidylinositol (GPI)-linked cell surface receptor for persephin, and mediates activation of the RET tyrosine kinase receptor.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7.4 containing no preservatives
Host Animal:
Chicken
Species Reactivity:
Human
Immunogen:
Recombinant His-tagged human GFRa-4 protein produced using CHO-based cell line. For production of hGFRa-4, glycosylphosphatidyl-inositol GPI-anchor was removed and protein was secreted to the cell culture supernatant. Protein was purified by Ni-affinity chromatography following gel-filtration from cell culture supernatant.
Applications:
IHC-Frozen,WB
Antibody Isotype:
IgY
Application Details:
WB, IHC. A dilution of 1:5 000-1:10 000 is recommended for Western blots and 1:1 000 to 1:3 000 for immunocytochemistry. Biosensis recommends optimal dilutions/concentrations should be determined by the end user.
Chicken anti-Proto-oncogene tyrosine-protein kinase receptor Ret (RET) Polyclonal Antibody (Unconjugated), suitable for WB, ICC.
Background Info:
The RET proto-oncogene is a receptor tyrosine kinase for members of the glial cell line-derived neurotrophic factor family of extracellular signalling molecules
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid: Concentrated ammonium sulphate in PBS pH 7.4
Host Animal:
Chicken
Species Reactivity:
Human
Immunogen:
Recombinant His-tagged extracellular fragment of human RET protein produced using CHO cell line. The extracellular fragment of hRET was expressed and secreted to the cell culture supernatant. Protein was purified by Ni-affinity chromatography following gel-filtration from cell culture supernatant.
Applications:
ICC,WB
Antibody Isotype:
IgY
Application Details:
WB, ICC. A dilution of 1:5 000 to 1:10 000 is recommended for Western blot and 1:250 to 1:500 for immunocytochemistry. Biosensis recommends optimal dilutions/concentrations should be determined by the end user.
Alternative Names:
Cadherin family member 12; Ret;
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Specificity:
Human RET
Storage:
Store at 2-8°C upon receipt; DO NOT FREEZE. As product is (NH4)2SO4 (ammonium sulfate) precipitate, mix well by pipetting or vortexing prior to use. See reconstitution instructions for more information.
Purification:
Affinity purified
Target:
Proto-oncogene tyrosine-protein kinase receptor Ret (RET)
Chicken anti-Microtubule-associated protein tau (MAPT) Polyclonal Antibody (Unconjugated), suitable for WB, ICC.
Background Info:
FUNCTION: Promotes microtubule assembly and stability, and might be involved in the establishment and maintenance of neuronal polarity. The C-terminus binds axonal microtubules while the N-terminus binds neural plasma membrane components, suggesting that tau functions as a linker protein between both. Axonal polarity is predetermined by tau localization (in the neuronal cell) in the domain of the cell body defined by the centrosome. The short isoforms allow plasticity of the cytoskeleton whereas the longer isoforms may preferentially play a role in its stabilization. SUBCELLULAR LOCATION: Cytoplasm; cytosol. Cell membrane. Mostly found in the axons of neurons, in the cytosol and in association with plasma membrane components. ALTERNATIVE PRODUCTS: 8 named isoforms produced by alternative splicing. Additional isoforms seem to exist. Isoforms differ from each other by the presence or absence of up to 5 of the 15 exons. One of these optional exons contains the additional tau/MAP repeat. TISSUE SPECIFICITY: Expressed in neurons. Isoform PNS-tau is expressed in the peripheral nervous system while the others are expressed in the central nervous system. DEVELOPMENTAL STAGE: Four-repeat (type II) tau is expressed in an adult-specific manner and is not found in fetal brain, whereas three-repeat (type I) tau is found in both adult and fetal brain. DOMAIN: The tau/MAP repeat binds to tubulin. In Alzheimer disease, the neuronal cytoskeleton in the brain is progressively disrupted and replaced by tangles of paired helical filaments and straight filaments, mainly composed of hyperphosphorylated forms of Microtubule-associated protein Tau. Defects in Microtubule-associated protein Tau are a cause of frontotemporal dementia and parkinsonism linked to chromosome 17, as well as a number of other neurodegenerative diseases.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized from PBS buffer pH 7.2-7.6 with 0.1% trehalose, without preservatives
Recombinant full length version of the shortest human tau isoform purified from E. coli.
Applications:
ICC,WB
Antibody Isotype:
IgY
Application Details:
Western Blotting (WB) and Immunocytochemistry (ICC). A dilution of 1:5,000 - 1:10,000 is recommended for WB. A dilution of 1:500-1,000 is recommended for IC. Biosensis recommends optimal dilutions/concentrations should be determined by the end user.
The antibody reacts with multiple closely spaced bands covering the region of the blot from 48 kDa to 67 kDa, with an additional band at 100 kDa. It has also been used successfully for immunocytochemistry. Expected to react with horse, cow, pig, chicken, rat and mouse.
Storage:
Store lyophilized, unopened vial at 2-8°C or lower. After reconstitution, prepare aliquots and store at -20°C to -80°C for a higher stability. Avoid freeze-thaw cycles.
Chicken anti-Lamin A/C Polyclonal Antibody (Unconjugated), suitable for WB, ICC.
Background Info:
The Lamin proteins are members of the intermediate filament protein family but are located inside the nucleus rather than in the cytoplasm (1). The lamins function as skeletal components tightly associated with the inner nuclear membrane. Originally the proteins of the nuclear cytoskeleton were named Lamin A, B and C, from top to bottom as visualized on SDS-PAGE gels. Subsequently it was found that Lamins A and C were coded for by a single gene (2), while the Lamin B band may contain two proteins encoded by two genes now called Lamin B1 and Lamin B2. Lamin A has a mass of about 74 kDa while Lamin C is 65 kDa. The Lamin A protein includes 98 amino acids missing from Lamin C, while Lamin C has a C-terminal 6 amino acid peptide not present in Lamin A. Apart from these regions Lamin A and C are identical so that antibodies raised against either protein are likely to cross react with the other, as is the case with this monoclonal. Lamin polymerization and depolymerization is regulated by phosphorylation by cyclin dependent protein kinase 1 (CDK1), the key component of "maturation promoting factor", the central regulator of cell division. Activity of this kinase increases during cell division and is responsible for the breakdown of the nuclear lamina. Mutations in the LMNA gene are associated with several serious human diseases, including Emery-Dreifuss muscular dystrophy, familial partial lipodystrophy, limb girdle muscular dystrophy, dilated cardiomyopathy, Charcot-Marie-Tooth disease type 2B1, and Hutchinson-Gilford progeria syndrome. This family of diseases belong to a larger group which are often referred to as Laminopathies, though some laminopathies are associated in defects in Lamin B1, B2 or one or other of the numerous nuclear lamina binding proteins. A truncated version of lamin A, commonly known as progerin, causes Hutchinson-Gilford progeria syndrome, a form of premature aging (3).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized from PBS buffer pH 7.2-7.6 with 0.1% trehalose, without preservatives
Host Animal:
Chicken
Species Reactivity:
Human
Immunogen:
Full length recombinant human Lamin C
Applications:
ICC,WB
Antibody Isotype:
IgY
Application Details:
Immunocytochemistry (ICC) and Western Blotting (WB). A dilution of 1:1,000-1:2,000 is recommended for WB. A dilution of 1:500-1:1,000 is recommended for ICC. The optimal dilution should be determined by the end user.
Lamin A and Lamin C. The antibody reacts with a 74 kDa and 65 kDa band by Western blot on HeLa cell extract. It has also been used successfully for immunocytochemistry on HeLa cell cultures.
Storage:
After reconstitution of lyophilized antibody, aliquot and store at -20°C for a higher stability. Avoid freeze-thaw cycles.
Chicken anti-Heat shock protein 27 (HSP-27) Polyclonal Antibody (Unconjugated), suitable for WB, ICC.
Background Info:
The heat shock proteins were discovered, as the name suggests, since they are heavily upregulated when cells are stressed by temperatures above the normal physiological range. They are expressed in unstressed cells also and have a normal function as chaperones, helping other proteins to fold correctly, and are required in much greater amounts if the cell or tissue is stressed by heat. The increased levels are generated transcriptionally under the influence of a powerful transcription factor, the heat shock factor 1 (HSF1). The different heat shock proteins were originally named based on their SDS-PAGE mobility, so HSP27 has an apparent molecular weight of 27 kDa. It is an abundant protein even under non-stress conditions and frequently shows up as a major spot on 2 dimensional gels of cells or tissues. It is known to associate with a variety of other proteins such as actin, intermediate filament subunits and ubiquitin and is found both in the cytoplasm and the nucleus of cells. HSP27 can become heavily phosphorylated under the influence of multiple protein kinases particularly as a result of activation of the p38/SAPK pathway. Upregulation of this protein is protective against neurodegenerative diseases at least in certain mouse models (1). Point mutations in the HSP27 gene are associated with two neurological diseases, Charcot-Marie-Tooth disease type 2F and distal hereditary motor neuropathy IIB (2). These diseases are associated with axonal loss apparently following defects in the transport of neurofilaments.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized from PBS buffer pH 7.2-7.6 with 0.1% trehalose, without preservatives
Host Animal:
Chicken
Species Reactivity:
Human
Immunogen:
Recombinant full length purified HSP27 from E. coli.
Applications:
ICC,WB
Antibody Isotype:
IgY
Application Details:
Western Blotting (WB) and Immunocytochemistry (ICC). A dilution of 1:2,000 - 1:5,000 is recommended for WB. A dilution of 1:1,000 - 1:2,000 is recommended for ICC. Biosensis recommends optimal dilutions/concentrations should be determined by the end user.
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Specificity:
The antibody reacts with a 27 kDa band by Western blot on a crude extract from HeLa cells. It has also been used successfully for immunocytochemistry.
Storage:
After reconstitution of lyophilized antibody, aliquot and store at -20°C for a higher stability. Avoid freeze-thaw cycles.
Bovine milk contains two types of beta-casein protein, A2 or A1. Recent studies have shown that milk containing the A1 beta casein protein can contribute to issues including gastrointestinal discomfort after ingestion. There is some evidence of a link between ingestion of A1 beta casein protein and the development of Type 1 diabetes.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS, pH 7.4, containing 0.02% sodium azide as preservative. Refer to the product label for antibody concentration.
Host Animal:
Chicken
Species Reactivity:
Bovine
Immunogen:
A synthetic peptide (PGPIPNSLP, aa: 78-86) conjugated to KLH has been used as immunogen. Bovine A1 beta casein differs from bovine A2 beta casein by one amino acid (H82 -> P82)
Applications:
ELISA,WB
Antibody Isotype:
IgY
Application Details:
Western blot and ELISA. Suggested working dilution for western blot is 1:200-1:1,000. The amount of milk per lane can be 0.05 µL-0.1 µL for Western blot. Sample Preparation: Milk should be diluted 1:10 in 0.1M NaOH. The reason for diluting (1:10) in 0.1M NaOH is because the milk protein is easier to dissolve in NaOH. The sample is then further diluted with PBS or other buffer and mixed at 1:1 ratio, to prepare for loading. For example, one can take the 1:10 dilution milk (0.5 µL-1 µL) and add into 9.5 µL or 9 µL PBS and mix with 10 µL SDS-PAGE Sample buffer, boil for 5 minutes, quick spin, and load on the gel. Recommended blocking buffer: TBS with 5% BSA. Recommended antibody dilution buffer: TBST containing 3% BSA. Biosensis recommends that optimal working dilutions should be determined by the end user.
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Specificity:
The antibody is specific to A2 beta casein by western blot. No cross-reactivity with A1 beta casein is seen. Species cross-reactivity not tested.
Storage:
Maintain unopened vial at -20°C for up to 12 months after date of receipt. After opening maintain at -20°C in undiluted aliquots for up to 6 months. For short-term storage, keep aliquot at 2-8°C for up to one week. Avoid repeated freeze-thaw cycles.
Bovine milk contains two types of beta-casein protein, A2 or A1. Recent studies have shown that milk containing the A1 beta casein protein can contribute to issues including gastrointestinal discomfort after ingestion. There is some evidence of a link between ingestion of A1 beta casein protein and the development of Type 1 diabetes.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS, pH 7.4, containing 0.02% sodium azide as preservative. Refer to the product label for antibody concentration.
Host Animal:
Chicken
Species Reactivity:
Bovine
Immunogen:
A synthetic peptide (PGPIHNSLP, aa: 78-86) conjugated to KLH has been used as immunogen. Bovine A2 beta casein differs from bovine A1 beta casein by one amino acid (P82 -> H82)
Applications:
ELISA,WB
Antibody Isotype:
IgY
Application Details:
Western blot and ELISA. Suggested working dilution for western blot is 1:1,000-1:5,000. The amount of milk per lane can be 0.05 µL-0.1 µL for Western blot. Sample Preparation: Milk should be diluted 1:10 in 0.1M NaOH. The reason for diluting (1:10) in 0.1M NaOH is because the milk protein is easier to dissolve in NaOH. The sample is then further diluted with PBS or other buffer and mixed at 1:1 ratio, to prepare for loading. For example, one can take the 1:10 dilution milk (0.5 µL-1 µL) and add into 9.5 µL or 9 µL PBS and mix with 10 µL SDS-PAGE Sample buffer, boil for 5 minutes, quick spin, and load on the gel. Recommended blocking buffer: TBS with 5% BSA. Recommended antibody dilution buffer: TBST containing 3% BSA. Biosensis recommends that optimal working dilutions should be determined by the end user.
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Specificity:
The antibody is specific to A1 beta casein by western blot. No cross-reactivity with A2 beta casein is seen. Species cross-reactivity not tested.
Storage:
Maintain unopened vial at -20°C for up to 12 months after date of receipt. After opening maintain at -20°C in undiluted aliquots for up to 6 months. For short-term storage, keep aliquot at 2-8°C for up to one week. Avoid repeated freeze-thaw cycles.
May be involved in the regulation of dopamine release and transport. Induces fibrillization of microtubule-associated protein tau. Reduces neuronal responsiveness to various apoptotic stimuli, leading to a decreased caspase-3 activation. Ref: uniprot.org.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized from PBS buffer pH 7.2-7.6 with 0.1% trehalose, without preservatives
Host Animal:
Chicken
Species Reactivity:
Bovine,Chicken,Horse,Human,Mouse,Pig,Rat
Immunogen:
Full length human protein with the epitope from amino acids 61-95
Applications:
ICC,IHC-Frozen,WB
Antibody Isotype:
IgY
Application Details:
Western blotting (1:1,000 - 1:2,000), Immunocytochemistry (1:1,000 - 1:2,000) and Immunohistochemistry (1:1,000 1: 2,000). Biosensis recommends optimal dilutions/concentrations should be determined by the end user.
Alternative Names:
Non-A beta component of AD amyloid; Non-A4 component of amyloid precursor; NACP; SNCA; PARK1;
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Specificity:
Human, reacts with human, horse, cow, pig, chicken, rat, mouse.
Storage:
Store lyophilized antibody at 2-8°C. After reconstitution divide into aliquots and store at -20°C for long-term storage. Store at 2-8°C short-term (up to 4 weeks) with an appropriate antibacterial agent. Avoid repetitive freeze/thaw cycles.
Chicken anti-Calbindin Polyclonal Antibody (Unconjugated), suitable for WB, IHC-Frozen.
Background Info:
Buffers cytosolic calcium. May stimulate a membrane Ca<sup>2+</sup>-ATPase and a 3',5'-cyclic nucleotide phosphodiesterase. Ref: uniprot.org
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized from PBS buffer pH 7.2-7.6 with 0.1% trehalose, without preservatives
Host Animal:
Chicken
Species Reactivity:
Bovine,Human,Mouse,Rat
Immunogen:
Full-length recombinant human protein
Applications:
IHC-Frozen,WB
Antibody Isotype:
IgY
Application Details:
Western blotting (1:1,000-1:5,000) and Immunohistochemistry (1:1,000-1:5,000). Biosensis recommends optimal dilutions/concentrations should be determined by the end user.
Human, reacts with human, cow, rat, mouse. Antibody is specific for calbindin and does not recognize closely related proteins parvalbumin and calretinin as determined by Western Blotting.
Storage:
Store lyophilized antibody at 2-8°C. After reconstitution divide into aliquots and store at -20°C for long-term storage. Store at 2-8°C short-term (up to 4 weeks) with an appropriate antibacterial agent. Avoid repetitive freeze/thaw cycles.
Chicken anti-Calretinin (CR) Polyclonal Antibody (Unconjugated), suitable for WB, ICC.
Background Info:
Calretinin is a calcium-binding protein which is abundant in auditory neurons. Ref: uniprot.org
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized from PBS buffer pH 7.2-7.6 with 0.1% trehalose, without preservatives
Host Animal:
Chicken
Species Reactivity:
Bovine,Human,Mouse,Rat
Immunogen:
Full-length recombinant human protein
Applications:
ICC,WB
Antibody Isotype:
IgY
Application Details:
Western blotting (1:1,000-1:5,000) and Immunohistochemistry (1:1,000-1:5,000). Biosensis recommends optimal dilutions/concentrations should be determined by the end user.
Alternative Names:
CR; 29 kDa calbindin;
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Specificity:
Human, reacts with human, cow, rat, mouse. Antibody is specific for calretinin and does not recognize closely related proteins parvalbumin and calbindin as determined by Western Blotting.
Storage:
Store lyophilized antibody at 2-8°C. After reconstitution divide into aliquots and store at -20°C for long-term storage. Store at 2-8°C short-term (up to 4 weeks) with an appropriate antibacterial agent. Avoid repetitive freeze/thaw cycles.
May participate in RNA metabolism in the myelinating cell, CNP is the third most abundant protein in central nervous system myelin. Ref: uniprot.org
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized from PBS buffer pH 7.2-7.6 with 0.1% trehalose, without preservatives
Host Animal:
Chicken
Species Reactivity:
Human,Mouse,Rat
Immunogen:
Full-length recombinant human protein
Applications:
ICC,WB
Antibody Isotype:
IgY
Application Details:
Western blotting (1:5,000-1:10,000), Immunocytochemistry (1:5,000-1:10,000) and Immunohistochemistry (1:5,000-1:10,000). Biosensis recommends optimal dilutions/concentrations should be determined by the end user.
Alternative Names:
CNPase; CNP;
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Specificity:
Human, reacts with human, rat, mouse.
Storage:
Store lyophilized antibody at 2-8°C. After reconstitution divide into aliquots and store at -20°C for long-term storage. Store at 2-8°C short-term (up to 4 weeks) with an appropriate antibacterial agent. Avoid repetitive freeze/thaw cycles.
Chicken anti-Ki-67 Polyclonal Antibody (Unconjugated), suitable for WB, ICC.
Background Info:
Required to maintain individual mitotic chromosomes dispersed in the cytoplasm following nuclear envelope disassembly (PubMed:27362226). Associates with the surface of the mitotic chromosome, the perichromosomal layer, and covers a substantial fraction of the chromosome surface (PubMed:27362226). Prevents chromosomes from collapsing into a single chromatin mass by forming a steric and electrostatic charge barrier: the protein has a high net electrical charge and acts as a surfactant, dispersing chromosomes and enabling independent chromosome motility (PubMed:27362226). Binds DNA, with a preference for supercoiled DNA and AT-rich DNA (PubMed:10878551). Does not contribute to the internal structure of mitotic chromosomes (By similarity). May play a role in chromatin organization (PubMed:24867636). It is however unclear whether it plays a direct role in chromatin organization or whether it is an indirect consequence of its function in maintaining mitotic chromosomes dispersed (Probable). Ref: uniprot.org
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized from PBS buffer pH 7.2-7.6 with 0.1% trehalose, without preservatives
Host Animal:
Chicken
Species Reactivity:
Human
Immunogen:
Recombinant human Ki-67 protein (mixture of amino acids 1-300 and 1,111-1,490) expressed in and purified from <i>E. coli.</i>
Applications:
ICC,WB
Antibody Isotype:
IgY
Application Details:
Western blotting (1:2,000-1:5,000) and Immunocytochemistry (1:1,000-1:5,000). Biosensis recommends optimal dilutions/concentrations should be determined by the end user.
Alternative Names:
Proliferation marker protein Ki-67; Antigen identified by monoclonal antibody Ki-67; Antigen KI-67; Antigen Ki67
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Specificity:
Human, reacts with human only. Does not react with mouse or rat.
Storage:
Store lyophilized antibody at 2-8°C. After reconstitution divide into aliquots and store at -20°C for long-term storage. Store at 2-8°C short-term (up to 4 weeks) with an appropriate antibacterial agent. Avoid repetitive freeze/thaw cycles.
Chicken anti-Nestin Polyclonal Antibody (Unconjugated), suitable for WB, ICC.
Background Info:
Required for brain and eye development. Promotes the disassembly of phosphorylated vimentin intermediate filaments (IF) during mitosis and may play a role in the trafficking and distribution of IF proteins and other cellular factors to daughter cells during progenitor cell division. Required for survival, renewal and mitogen-stimulated proliferation of neural progenitor cells (By similarity). Ref: uniprot.org
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized from PBS buffer pH 7.2-7.6 with 0.1% trehalose, without preservatives
Host Animal:
Chicken
Species Reactivity:
Human,Rat
Immunogen:
Part of recombinant human protein (amino acids 315-630).
Applications:
ICC,WB
Antibody Isotype:
IgY
Application Details:
Western blotting (1:1,000-1:5,000) and Immunocytochemistry (1:2,000-1:5,000). Biosensis recommends optimal dilutions/concentrations should be determined by the end user.
Alternative Names:
NES;
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Specificity:
Human,reacts with human and rat. Other species not tested.
Storage:
Store lyophilized antibody at 2-8°C. After reconstitution divide into aliquots and store at -20°C for long-term storage. Store at 2-8°C short-term (up to 4 weeks) with an appropriate antibacterial agent. Avoid repetitive freeze/thaw cycles.
Chicken anti-Parvalbumin Polyclonal Antibody (Unconjugated), suitable for WB, IHC-Frozen.
Background Info:
In muscle, parvalbumin is thought to be involved in relaxation after contraction. It binds two calcium ions. Ref: uniprot.org
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized from PBS buffer pH 7.2-7.6 with 0.1% trehalose, without preservatives
Host Animal:
Chicken
Species Reactivity:
Human,Mouse,Rat
Immunogen:
Full-length recombinant human protein
Applications:
IHC-Frozen,WB
Antibody Isotype:
IgY
Application Details:
Western blotting (1:1,000-1:5,000) and Immunohistochemistry (1:1,000-1:5,000). Note that this antibody does not recognize parvalbumin in rat or mouse brain homogenates on western blots. Biosensis recommends optimal dilutions/concentrations should be determined by the end user.
Alternative Names:
PVALB; Parvalbumin;
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Specificity:
Human, reacts with Human, Rat, Mouse. Antibody is specific for parvalbumin and does not recognize closely related proteins calretinin and calbindin as determined by Western Blotting.
Storage:
Store lyophilized antibody at 2-8°C. After reconstitution divide into aliquots and store at -20°C for long-term storage. Store at 2-8°C short-term (up to 4 weeks) with an appropriate antibacterial agent. Avoid repetitive freeze/thaw cycles.
Chicken anti-Green fluorescent protein (GFP) Polyclonal Antibody (Unconjugated), suitable for WB, ICC.
Background Info:
The green fluorescent protein (GFP) is a 27 kDa protein isolated originally from the jellyfish Aequoria victoria. It has an endogenous fluorochrome activity with excitation maximum at 395 nm and emission maximum at 509 nm, which is similar to that of fluorescein. GFP can be expressed in fluorescent form in essentially any prokaryotic or eukaryotic cell.<br> This GFP rabbit antibody was made against a recombinant GFP construct originating from an Aequoria species which was engineered to improve spectral properties and prevent oligomerization. This form of GFP, referred to as AcGFP, is 94% identical to the eGFP developed by Tsien and co-workers. The antibody can be used to verify the expression, size and stability of both AcGFP and eGFP fusion proteins in western blotting experiments and to amplify GFP signals in tissues of transgenic animals.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized from PBS buffer pH 7.2-7.6 with 0.1% trehalose, without preservatives
Host Animal:
Chicken
Species Reactivity:
Species Independent
Immunogen:
Recombinant AcGFP protein expressed in and purified from E. Coli.
Applications:
ICC,WB
Antibody Isotype:
IgY
Application Details:
Western blotting (1:1,000-1:5,000) and Immunocytochemistry (1:1,000-1:5,000). Biosensis recommends optimal dilutions/concentrations should be determined by the end user.
Alternative Names:
Green fluorescent protein, GFP
Biosensis Brand:
Biosensis®
Cellular Localisation:
Intracellular, cytosolic.
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Immunogen length:
Full-length recombinant protein.
Negative Control:
Non-transfected HEK293 cells.
Physical State:
Solid.
Positive Control:
GFP-transfected HEK293 cells.
Specificity:
Specific for GFP, does not cross-react with mCherry.
Storage:
Store lyophilized antibody at 2-8°C. After reconstitution divide into aliquots and store at -20°C for long-term storage. Store at 2-8°C short-term (up to 4 weeks). Avoid repetitive freeze/thaw cycles.
Product Validation Info:
Antibody recognizes GFP protein in GFP-transfected HEK293 cells, but not in non-transfected control cells.
Actin-binding protein that enhances membrane ruffling and RAC activation. Enhances the actin-bundling activity of LCP1. Binds calcium. Plays a role in RAC signaling and in phagocytosis. May play a role in macrophage activation and function. Promotes the proliferation of vascular smooth muscle cells and of T-lymphocytes. Enhances lymphocyte migration. Plays a role in vascular inflammation. Ref: uniprot.org
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized, without preservatives.
Host Animal:
Chicken
Species Reactivity:
Human, Mouse, Rat
Immunogen:
C-terminal peptide of human IBA1. The antibody has been made against the C-terminal peptide of human IBA1 coupled to keyhole limpet hemocyanin (KLH).
Applications:
ICC, IHC-Frozen, WB
Application Details:
Western Blotting (WB), Immunocytochemistry (ICC), Immunohistochemistry (IHC). A dilution of 1:5,000 - 1:10,000 is recommended for WB. A dilution of 1:100 - 1:500 is recommended for IC and IH. Biosensis recommends optimal dilutions/concentrations should be determined by the end user.
Dissolve entire packet in 1L of deionized water and mix thoroughly for 5 minutes.
Storage:
Store dry chemical at 18-25C. Store prepared buffer at 2-8C.
Shelf Life:
Chemical-12 months. Prepared buffer-3 months.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Country Of Origin:
Normal Chicken serum was obtained from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Goat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Goat IgG, whole molecule
Buffer:
30 mM Triethanolamine, pH 7.2, 5 mM Magnesium Chloride, 0.1 mM Zinc Chloride, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
Store undiluted liquid at 2-8 °C. For storage at -20 °C, dilute with an equal volume of glycerol to prevent loss of enzymatic activity. Prepare working dilutions prior to use and then discard.
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Goat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Goat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.8, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Goat IgG, whole molecule
Buffer:
PBS, 1% BSA & 0.1% proclin 150
Preservative:
0.1% (v/v) Kathon CG
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, dilute with 50% glycerol and store at -20 °C as a liquid.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Goat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins · IgG/serum proteins from human, mouse or rabbit
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Goat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 0.55 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins · IgG/serum proteins from human, mouse or rabbit
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Goat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 0.55 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins · IgG/serum proteins from human, mouse or rabbit
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Goat IgG, whole molecule
Buffer:
30 mM Triethanolamine, pH 7.2, 5 mM Magnesium Chloride, 0.1 mM Zinc Chloride, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
Store undiluted liquid at 2-8 °C. For storage at -20 °C, dilute with an equal volume of glycerol to prevent loss of enzymatic activity. Prepare working dilutions prior to use and then discard.
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins · IgG/serum proteins from human, mouse or rabbit
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Goat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins · IgG/serum proteins from human, mouse or rabbit
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Goat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.8, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins · IgG/serum proteins from human, mouse or rabbit
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Goat IgG, whole molecule
Buffer:
PBS, 1% BSA & 0.1% proclin 150
Preservative:
0.1% (v/v) Kathon CG
Reconstitution:
Rehydrate with 0.55 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, dilute with 50% glycerol and store at -20 °C as a liquid.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins · IgG/serum proteins from human, mouse or rabbit
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Goat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 0.55 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins · IgG/serum proteins from human, mouse or rabbit
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Accession Number:
AAA51107
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
30 mM Triethanolamine, pH 7.2, 5 mM Magnesium Chloride, 0.1 mM Zinc Chloride, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
Store undiluted liquid at 2-8 °C. For storage at -20 °C, dilute with an equal volume of glycerol to prevent loss of enzymatic activity. Prepare working dilutions prior to use and then discard.
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
PBS, 1% BSA & 0.1% proclin 150
Preservative:
0.1% (v/v) Kathon CG
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, dilute with 50% glycerol and store at -20 °C as a liquid.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins · IgG/serum from human or rabbit
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 0.55 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins · IgG/serum from human or rabbit
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Accession Number:
AAA51107
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins · IgG/serum from human or rabbit
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
PBS, 1% BSA & 0.1% proclin 150
Preservative:
0.1% (v/v) Kathon CG
Reconstitution:
Rehydrate with 0.55 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, dilute with 50% glycerol and store at -20 °C as a liquid.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins · IgG/serum from human or rabbit
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 0.55 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins · IgG/serum from human or rabbit
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
30 mM Triethanolamine, pH 7.2, 5 mM Magnesium Chloride, 0.1 mM Zinc Chloride, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
Store undiluted liquid at 2-8 °C. For storage at -20 °C, dilute with an equal volume of glycerol to prevent loss of enzymatic activity. Prepare working dilutions prior to use and then discard.
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
PBS, 1% BSA & 0.1% proclin 150
Preservative:
0.1% (v/v) Kathon CG
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, dilute with 50% glycerol and store at -20 °C as a liquid.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, prepare small aliquots and store at -20 °C . For storage at 2-8 °C, add a preservative to prevent growth of bacteria.
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins · IgG from human or mouse
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
30 mM Triethanolamine, pH 7.2, 5 mM Magnesium Chloride, 0.1 mM Zinc Chloride, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
Store undiluted liquid at 2-8 °C. For storage at -20 °C, dilute with an equal volume of glycerol to prevent loss of enzymatic activity. Prepare working dilutions prior to use and then discard.
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins · IgG from human or mouse
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins · IgG from human or mouse
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.8, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins · IgG from human or mouse
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
PBS, 1% BSA & 0.1% proclin 150
Preservative:
0.1% (v/v) Kathon CG
Reconstitution:
Rehydrate with 0.55 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, dilute with 50% glycerol and store at -20 °C as a liquid.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins · IgG from human or mouse
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 0.55 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins · IgG from human or mouse
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Rat IgG, whole molecule
Buffer:
PBS, 1% BSA & 0.1% proclin 150
Preservative:
0.1% (v/v) Kathon CG
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, dilute with 50% glycerol and store at -20 °C as a liquid.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins · serum proteins from human or rabbit · IgG from human or rabbit
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Rat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 0.55 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins · serum proteins from human or rabbit · IgG from human or rabbit
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
30 mM Triethanolamine, pH 7.2, 5 mM Magnesium Chloride, 0.1 mM Zinc Chloride, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
Store undiluted liquid at 2-8 °C. For storage at -20 °C, dilute with an equal volume of glycerol to prevent loss of enzymatic activity. Prepare working dilutions prior to use and then discard.
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins · serum proteins from human or rabbit · IgG from human or rabbit
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Rat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins · serum proteins from human or rabbit · IgG from human or rabbit
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Chicken
Immunogen:
Purified Rat IgG, whole molecule
Buffer:
PBS, 1% BSA & 0.1% proclin 150
Preservative:
0.1% (v/v) Kathon CG
Reconstitution:
Rehydrate with 0.55 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, dilute with 50% glycerol and store at -20 °C as a liquid.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins · serum proteins from human or rabbit · IgG from human or rabbit
Country Of Origin:
Chicken Ig fraction was prepared using serum from healthy hens of US origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
This cell lysate is suitable as positive control for Western Blotting, to confirm TrkB phosphorylation at amino acid S478 (rat/mouse) or S479 (human), respectively, using TrkB (pS478/479) rabbit antibody R-1718-50. It is particular useful for complex Western Blotting samples to identify TrkB (pS478/479) immunoreactive bands. This lysate has been prepared by triggering TrkB phosphorylation in retinoic acid-treated mouse NSC34 cells with mature BDNF, and subsequent processing with RIPA buffer. The cell lysate is provided lyophilised for extended stability.
Background Info:
Receptor tyrosine kinase involved in the development and the maturation of the central and the peripheral nervous systems through regulation of neuron survival, proliferation, migration, differentiation, and synapse formation and plasticity (By similarity). Receptor for BDNF/brain-derived neurotrophic factor and NTF4/neurotrophin-4. Alternatively can also bind NTF3/neurotrophin-3 which is less efficient in activating the receptor but regulates neuron survival through NTRK2. Upon ligand-binding, undergoes homodimerization, autophosphorylation and activation. Recruits, phosphorylates and/or activates several downstream effectors including SHC1, FRS2, SH2B1, SH2B2 and PLCG1 that regulate distinct overlapping signaling cascades. Through SHC1, FRS2, SH2B1, SH2B2 activates the GRB2-Ras-MAPK cascade that regulates for instance neuronal differentiation including neurite outgrowth. Through the same effectors controls the Ras-PI3 kinase-AKT1 signaling cascade that mainly regulates growth and survival. Through PLCG1 and the downstream protein kinase C-regulated pathways controls synaptic plasticity. Thereby, plays a role in learning and memory by regulating both short term synaptic function and long-term potentiation. PLCG1 also leads to NF-Kappa-B activation and the transcription of genes involved in cell survival. Hence, it is able to suppress anoikis, the apoptosis resulting from loss of cell-matrix interactions. May also play a role in neutrophin-dependent calcium signaling in glial cells and mediate communication between neurons and glia (Ref: uniprot.org).
Product Type:
Cell Lysate
Format:
Lyophilized from a RIPA cell lysate preparation, without preservatives.
Applications:
WB
Application Details:
Western Blotting (5 - 10 µg loading per lane). Biosensis recommends optimal loading amounts should be determined by the end user.
Store lyophilized lysate at 2-8°C. After reconstitution divide into single-use aliquots and store at -80°C for long-term storage. Aliquots should be used within 1 hour after thawing. Avoid repetitive freeze/thaw cycles.
Product Validation Info:
This product has been validated for TrkB (S478/479) phosphorylation by Western Blotting, using rabbit antibody R-1718-50 to TrkB (pS478/479). Treatment of blotting membrane with lambda-phosphatase obliterates TrkB pS478/479 immunoreactivity.
Purification:
This lysate has been prepared in RIPA buffer as crude cell lysate.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Country Of Origin:
Normal Cat Serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Country Of Origin:
Normal Cat Serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Country Of Origin:
Normal Cat Serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Detection Buffer for Europium Labeled Antibodies in TR-FRET Assays
Concentration:
Ready to Use
Form:
Liquid
Purification:
N/A
Buffer:
Not Applicable
Storage:
2-8 °C
Country Of Origin:
US Origin
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Country Of Origin:
Normal Dog Serum was obtained from healthy animals of Chinese origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Country Of Origin:
Normal Dog Serum was obtained from healthy animals of Chinese origin.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Goat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Goat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Goat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Goat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Goat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Goat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Goat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Goat IgG, whole molecule
Buffer:
30 mM Triethanolamine, pH 7.2, 5 mM Magnesium Chloride, 0.1 mM Zinc Chloride, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
Store undiluted liquid at 2-8 °C. For storage at -20 °C, dilute with an equal volume of glycerol to prevent loss of enzymatic activity. Prepare working dilutions prior to use and then discard.
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: non-immunoglobulin goat serum immunoglobulins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Goat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Goat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.8, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Goat IgG, whole molecule
Buffer:
PBS, 1% BSA & 0.1% proclin 150
Preservative:
0.1% (v/v) Kathon CG
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, dilute with 50% glycerol and store at -20 °C as a liquid.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Goat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins · IgG from human, mouse, rabbit or rat
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Goat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins · IgG from human, mouse, rabbit or rat
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Goat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins · IgG from human, mouse, rabbit or rat
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Goat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins · IgG from human, mouse, rabbit or rat
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Goat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins · IgG from human, mouse, rabbit or rat
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Goat IgG, whole molecule
Buffer:
30 mM Triethanolamine, pH 7.2, 5 mM Magnesium Chloride, 0.1 mM Zinc Chloride, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
Store undiluted liquid at 2-8 °C. For storage at -20 °C, dilute with an equal volume of glycerol to prevent loss of enzymatic activity. Prepare working dilutions prior to use and then discard.
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins · IgG from human, mouse, rabbit or rat
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Goat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins · IgG from human, mouse, rabbit or rat
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Goat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.8, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins · IgG from human, mouse, rabbit or rat
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Goat IgG, whole molecule
Buffer:
PBS, 1% BSA & 0.1% proclin 150
Preservative:
0.1% (v/v) Kathon CG
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, dilute with 50% glycerol and store at -20 °C as a liquid.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins · IgG from human, mouse, rabbit or rat
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins · IgG from human, mouse, rabbit or rat
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on goat IgG · light chains on all goat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin goat serum immunoglobulins · IgG from human, mouse, rabbit, rat, chicken, guinea pig, hamster, horse
Country Of Origin:
Goat serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Accession Number:
AAA51107
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Accession Number:
AAA51107
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Accession Number:
AAA51107
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Accession Number:
AAA51107
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Accession Number:
AAA51107
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Accession Number:
AAA51107
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
30 mM Triethanolamine, pH 7.2, 5 mM Magnesium Chloride, 0.1 mM Zinc Chloride, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
Store undiluted liquid at 2-8 °C. For storage at -20 °C, dilute with an equal volume of glycerol to prevent loss of enzymatic activity. Prepare working dilutions prior to use and then discard.
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.8, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
PBS, 1% BSA & 0.1% proclin 150
Preservative:
0.1% (v/v) Kathon CG
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, dilute with 50% glycerol and store at -20 °C as a liquid.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum proteins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, rabbit, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, rabbit, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Accession Number:
AAA51107
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, rabbit, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Accession Number:
AAA51107
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, rabbit, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Accession Number:
AAA51107
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, rabbit, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Accession Number:
AAA51107
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, rabbit, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Accession Number:
AAA51107
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
30 mM Triethanolamine, pH 7.2, 5 mM Magnesium Chloride, 0.1 mM Zinc Chloride, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
Store undiluted liquid at 2-8 °C. For storage at -20 °C, dilute with an equal volume of glycerol to prevent loss of enzymatic activity. Prepare working dilutions prior to use and then discard.
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, rabbit, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, rabbit, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.8, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, rabbit, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
PBS, 1% BSA & 0.1% proclin 150
Preservative:
0.1% (v/v) Kathon CG
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, dilute with 50% glycerol and store at -20 °C as a liquid.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, rabbit, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, rabbit, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
> 90% based on SDS-PAGE Small amounts of intact IgG may be present.
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
> 90% based on SDS-PAGE Small amounts of intact IgG may be present.
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 0.55 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
> 90% based on SDS-PAGE Small amounts of intact IgG may be present.
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 0.55 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
> 90% based on SDS-PAGE Small amounts of intact IgG may be present.
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.8, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
> 90% based on SDS-PAGE Small amounts of intact IgG may be present.
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
PBS, 1% BSA & 0.1% proclin 150
Preservative:
0.1% (v/v) Kathon CG
Reconstitution:
Rehydrate with 0.55 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, dilute with 50% glycerol and store at -20 °C as a liquid.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
> 90% based on SDS-PAGE Small amounts of intact IgG may be present.
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 0.55 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
> 90% based on SDS-PAGE Small amounts of intact IgG may be present.
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, rabbit, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
> 90% based on SDS-PAGE Small amounts of intact IgG may be present.
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 0.55 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, rabbit, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
> 90% based on SDS-PAGE Small amounts of intact IgG may be present.
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
30 mM Triethanolamine, pH 7.2, 5 mM Magnesium Chloride, 0.1 mM Zinc Chloride, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
Store undiluted liquid at 2-8 °C. For storage at -20 °C, dilute with an equal volume of glycerol to prevent loss of enzymatic activity. Prepare working dilutions prior to use and then discard.
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, rabbit, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
> 90% based on SDS-PAGE Small amounts of intact IgG may be present.
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, rabbit, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
> 90% based on SDS-PAGE Small amounts of intact IgG may be present.
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.8, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, rabbit, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
> 90% based on SDS-PAGE Small amounts of intact IgG may be present.
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
PBS, 1% BSA & 0.1% proclin 150
Preservative:
0.1% (v/v) Kathon CG
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, dilute with 50% glycerol and store at -20 °C as a liquid.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, rabbit, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
> 90% based on SDS-PAGE Small amounts of intact IgG may be present.
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 0.55 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, rabbit, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
30 mM Triethanolamine, pH 7.2, 5 mM Magnesium Chloride, 0.1 mM Zinc Chloride, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
Store undiluted liquid at 2-8 °C. For storage at -20 °C, dilute with an equal volume of glycerol to prevent loss of enzymatic activity. Prepare working dilutions prior to use and then discard.
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.8, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
PBS, 1% BSA & 0.1% proclin 150
Preservative:
0.1% (v/v) Kathon CG
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, dilute with 50% glycerol and store at -20 °C as a liquid.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins · mouse IgG or serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins · mouse IgG or serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins · mouse IgG or serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins · mouse IgG or serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins · mouse IgG or serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins · mouse IgG or serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins · mouse IgG or serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.8, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins · mouse IgG or serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
PBS, 1% BSA & 0.1% proclin 150
Preservative:
0.1% (v/v) Kathon CG
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, dilute with 50% glycerol and store at -20 °C as a liquid.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins · mouse IgG or serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins · mouse IgG or serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, mouse, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, mouse, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, mouse, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, mouse, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, mouse, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, mouse, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, mouse, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, mouse, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, mouse, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
30 mM Triethanolamine, pH 7.2, 5 mM Magnesium Chloride, 0.1 mM Zinc Chloride, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
Store undiluted liquid at 2-8 °C. For storage at -20 °C, dilute with an equal volume of glycerol to prevent loss of enzymatic activity. Prepare working dilutions prior to use and then discard.
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, mouse, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, mouse, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.8, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, mouse, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
PBS, 1% BSA & 0.1% proclin 150
Preservative:
0.1% (v/v) Kathon CG
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, dilute with 50% glycerol and store at -20 °C as a liquid.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, mouse, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, mouse, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
> 90% based on SDS-PAGE Small amounts of intact IgG may be present.
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
> 90% based on SDS-PAGE Small amounts of intact IgG may be present.
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 0.55 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rabbit IgG · light chains on all rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
> 90% based on SDS-PAGE Small amounts of intact IgG may be present.
Host:
Donkey
Immunogen:
Purified Rabbit IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on Rabbit IgG · light chains on all Rabbit immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin Rabbit serum immunoglobulins · IgG from Bovine, Chicken, Goat, Guinea Pig, Hamster, Horse, Human, Mouse, Rat or Sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rat IgG, whole molecule
Buffer:
30 mM Triethanolamine, pH 7.2, 5 mM Magnesium Chloride, 0.1 mM Zinc Chloride, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
Store undiluted liquid at 2-8 °C. For storage at -20 °C, dilute with an equal volume of glycerol to prevent loss of enzymatic activity. Prepare working dilutions prior to use and then discard.
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.8, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rat IgG, whole molecule
Buffer:
PBS, 1% BSA & 0.1% proclin 150
Preservative:
0.1% (v/v) Kathon CG
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, dilute with 50% glycerol and store at -20 °C as a liquid.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, mouse, rabbit or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, mouse, rabbit or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, mouse, rabbit or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, mouse, rabbit or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, mouse, rabbit or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rat IgG, whole molecule
Buffer:
30 mM Triethanolamine, pH 7.2, 5 mM Magnesium Chloride, 0.1 mM Zinc Chloride, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
Store undiluted liquid at 2-8 °C. For storage at -20 °C, dilute with an equal volume of glycerol to prevent loss of enzymatic activity. Prepare working dilutions prior to use and then discard.
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, mouse, rabbit or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, mouse, rabbit or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.8, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, mouse, rabbit or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rat IgG, whole molecule
Buffer:
PBS, 1% BSA & 0.1% proclin 150
Preservative:
0.1% (v/v) Kathon CG
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, dilute with 50% glycerol and store at -20 °C as a liquid.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, mouse, rabbit or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Rat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, mouse, rabbit or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
> 90% based on SDS-PAGE Small amounts of intact IgG may be present.
Host:
Donkey
Immunogen:
Purified Rat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, mouse, rabbit or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
> 90% based on SDS-PAGE Small amounts of intact IgG may be present.
Host:
Donkey
Immunogen:
Purified Rat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.8, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, mouse, rabbit or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
> 90% based on SDS-PAGE Small amounts of intact IgG may be present.
Host:
Donkey
Immunogen:
Purified Rat IgG, whole molecule
Buffer:
PBS, 1% BSA & 0.1% proclin 150
Preservative:
0.1% (v/v) Kathon CG
Reconstitution:
Rehydrate with 0.55 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, dilute with 50% glycerol and store at -20 °C as a liquid.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, mouse, rabbit or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
> 90% based on SDS-PAGE Small amounts of intact IgG may be present.
Host:
Donkey
Immunogen:
Purified Rat IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 0.55 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, mouse, rabbit or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Storage:
Store freeze-dried powder at 2-8 °C.
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rabbit serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
30 mM Triethanolamine, pH 7.2, 5 mM Magnesium Chloride, 0.1 mM Zinc Chloride, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
Store undiluted liquid at 2-8 °C. For storage at -20 °C, dilute with an equal volume of glycerol to prevent loss of enzymatic activity. Prepare working dilutions prior to use and then discard.
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.8, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
PBS, 1% BSA & 0.1% proclin 150
Preservative:
0.1% (v/v) Kathon CG
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, dilute with 50% glycerol and store at -20 °C as a liquid.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins · IgG from human or rabbit · serum proteins from human or rabbit
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins · IgG from human or rabbit · serum proteins from human or rabbit
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins · IgG from human or rabbit · serum proteins from human or rabbit
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins · IgG from human or rabbit · serum proteins from human or rabbit
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins · IgG from human or rabbit · serum proteins from human or rabbit
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins · IgG from human or rabbit · serum proteins from human or rabbit
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.8, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins · IgG from human or rabbit · serum proteins from human or rabbit
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
PBS, 1% BSA & 0.1% proclin 150
Preservative:
0.1% (v/v) Kathon CG
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, dilute with 50% glycerol and store at -20 °C as a liquid.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins · IgG from human or rabbit · serum proteins from human or rabbit
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins · IgG from human or rabbit · serum proteins from human or rabbit
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins · IgG from human, mouse or rabbit
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins · IgG from human, mouse or rabbit
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins · IgG from human, mouse or rabbit
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins · IgG from human, mouse or rabbit
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins · IgG from human, mouse or rabbit
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins · IgG from human, mouse or rabbit
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
30 mM Triethanolamine, pH 7.2, 5 mM Magnesium Chloride, 0.1 mM Zinc Chloride, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
Store undiluted liquid at 2-8 °C. For storage at -20 °C, dilute with an equal volume of glycerol to prevent loss of enzymatic activity. Prepare working dilutions prior to use and then discard.
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins · IgG from human, mouse or rabbit
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins · IgG from human, mouse or rabbit
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.8, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins · IgG from human, mouse or rabbit
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
PBS, 1% BSA & 0.1% proclin 150
Preservative:
0.1% (v/v) Kathon CG
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, dilute with 50% glycerol and store at -20 °C as a liquid.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins · IgG from human, mouse or rabbit
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins · IgG from human, mouse or rabbit
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
> 90% based on SDS-PAGE Small amounts of intact IgG may be present.
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
> 90% based on SDS-PAGE Small amounts of intact IgG may be present.
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
30 mM Triethanolamine, pH 7.2, 5 mM Magnesium Chloride, 0.1 mM Zinc Chloride, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
Store undiluted liquid at 2-8 °C. For storage at -20 °C, dilute with an equal volume of glycerol to prevent loss of enzymatic activity. Prepare working dilutions prior to use and then discard.
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
> 90% based on SDS-PAGE Small amounts of intact IgG may be present.
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
> 90% based on SDS-PAGE Small amounts of intact IgG may be present.
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.8, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
> 90% based on SDS-PAGE Small amounts of intact IgG may be present.
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
PBS, 1% BSA & 0.1% proclin 150
Preservative:
0.1% (v/v) Kathon CG
Reconstitution:
Rehydrate with 0.55 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, dilute with 50% glycerol and store at -20 °C as a liquid.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
> 90% based on SDS-PAGE Small amounts of intact IgG may be present.
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 0.55 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on sheep IgG · light chains on all sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin sheep serum proteins
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
> 90% based on SDS-PAGE Small amounts of intact IgG may be present.
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on Sheep IgG · light chains on all Sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin Sheep serum proteins · IgG from Human, Mouse, or Rabbit
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
> 90% based on SDS-PAGE Small amounts of intact IgG may be present.
Host:
Donkey
Immunogen:
Purified Sheep IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on Sheep IgG · light chains on all Sheep immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin Sheep serum proteins · IgG from Human, Mouse, or Rabbit
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
100 Gel lanes. An unique combination of a number of proprietary plasmids digested with appropriate restriction enzymes and PCR products to yield 12 fragments, suitable for use as molecular weight standards for agarose gel electrophoresis. The DNA includes fragments ranging from 100-3,000 base pairs. The 500 and 1,500 base pair bands have increased intensity to serve as reference points. The approximate mass of DNA in each band is provided (0.5 ug a load) for approximating the mass of DNA in comparably intense samples of similar size. PLEASE COMPLETE OUR CONTACT FORM TO REQUEST A FREE SAMPLE Arrange for our GeneDirex DNA ladders to be in your stores and receive any 5 vials of our DNA ladders for free. Email us for more details - tech@nktscientific.com.
Background Info:
Ready to Use. Containing orange G & xylene cyanol FF as tracking dyes.
100 Gel lanes. An unique combination of a number of proprietary plasmids digested with appropriate restriction enzymes and PCR products to yield 19 fragments, suitable for use as molecular weight standards for agarose gel electrophoresis. The DNA includes fragments ranging from 100-10,000 base pairs. The 500, 1.5K and 3K bands have increased intensity to serve as reference points. The approximate mass of DNA in each band is provided (0.5 ug a load) for approximating the mass of DNA in comparably intense samples of similar size. PLEASE COMPLETE OUR CONTACT FORM TO REQUEST A FREE SAMPLE. Arrange for our GeneDirex DNA ladders to be in your stores and receive any 5 vials of our DNA ladders for free. Email us for more details - tech@nktscientific.com.
Background Info:
Ready to Use. Containing bromophenol blue as the tracking dye.
100 Gel lanes. An unique combination of a number of proprietary plasmids digested with appropriate restriction enzymes and PCR products to yield 9 fragments, suitable for use as molecular weight standards for agarose gel electrophoresis. The DNA includes fragments ranging from 2,000-25,000 base pairs. The 3K and 5K bands have increased intensity to serve as reference points. The approximate mass of DNA in each band is provided (0.5 ug a load) for approximating the mass of DNA in comparably intense samples of similar size. PLEASE COMPLETE OUR CONTACT FORM TO REQUEST A FREE SAMPLE. Arrange for our GeneDirex DNA ladders to be in your stores and receive any 5 vials of our DNA ladders for free. Email us for more details - tech@nktscientific.com.
Background Info:
Ready to Use. Containing orange G & xylene cyanol FF as tracking dyes.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
36 Months
Country Of Origin:
Normal Duck Serum was obtained from China.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
X
We use cookies to help personalise and improve your web experience.
By using our website you consent to our use of cookies, some of which may have already been set on your device.
View our Cookie Policy to learn more.
