The antibody is specific to extradomain A (EDA) sequence of a cellular fibronectin and recognizes thus only the cellular fibronectin. It has been shown that it specifically block chondrocyte condensation in chicken embryos
Permanent AP Red Kit is developed for immunohistochemical and in situ-hybridisation staining procedures with alkaline phosphatase. Permanent AP Red leads to the formation of a magenta-red precipitate at the location of the target antigen or target nucleic acid. The precipitate is insoluble in aqueous and organic solvents and can be observed by light or fluorescence microscopy.
125 ml Permanent AP Red Buffer 2 ml Permanent AP Red Chromogen 1 Dilution Vial
Storage and handling:
The solutions should be stored at 2-8°C without further dilution. Please store the reagents in a dark place and do not freeze them. Under these conditions the solutions are stable up to the expiry date indicated on the label. Do not use product after the expiry date. The working solution prepared is stable for about 60 minutes and should therefore be used directly after preparation. Excess working solution should be discarded. A positive and a negative control have to be carried out in parallel to the test material. If you observe unusual staining or other deviations from the expected results which could possibly be caused by the kit reagents please contact our technical support.
Reagent preparation:
Reagent preparation (Preparation of the working solution) 1) Pipette 2.5 ml AP Red Buffer into the provided dilution vial and let it come to room temperature. The chromogen should still be kept cool. 2) Directly prior to use add 1 drop of Permanent AP Red Chromogen into the buffer. Mix thoroughly. 3) The solution is stable for about 60 minutes. Preparation should be done directly before use. Make sure to pipet the chromogen/substrate mix on the last slide of the staining run within 40 min after mixing. If you want to prepare other quantities of the working solution, please use same ratio AP Red Buffer and Chromogen
Procedure:
1) Rinse the slide with wash buffer after the previous incubation step. 2) Apply freshly prepared Permanent AP Red working solution onto the slide. Incubate for 10 minutes. 3) Rinse with distilled H2O. 4) Counterstain with haematoxylin for about 30 seconds up to 5 minutes (depending on the desired staining intensity). 5) Rinse with distilled H2O. 6) Blueing in tap water for at least 5 minutes. 7) Dehydrate through a graded series of ethanol and clear in xylene. Mount with a permanent mounting medium. Note: It is also possible to mount Permanent AP Red with aqueous mounting media.
Expected results:
During the reaction of the substrate with alkaline phosphatase in presence of the chromogen Permanent AP Red, a magenta-red precipitate is formed at the location of the target antigen or nucleic acid. The precipitate is insoluble in aqueous and organic solvents and can be observed by light or fluorescence microscopy (Texas Red filter).
Trouble shooting:
If you observe unusual staining or other deviations from the expected results please read these instructions carefully, or contact our technical support. Also refer to the instructions of the detection systems for guidance on general troubleshooting.
Quality Control:
We recommend carrying out a positive and a negative control with every staining run. The positive control permits the validation of appropriate processing of the sample. If the negative control has a positive result, this points to unspecific staining. Please refer to the instructions of the detection system for guidance on general quality control procedures.
Performance characteristics:
Studies have been conducted to evaluate the performance of the kit reagents. The product has been found to be suitable for the intended use
Limitations of procedure:
Immunohistochemistry is a complex method in which histological as well as immunological detection methods are combined. Tissue processing and handling prior to immunostaining, for example variations in fixation and embedding or the inherent nature of the tissue can cause inconsistent results (Nadji and Morales, 1983). In some tissues endogenous alkaline phosphatase activity may cause non-specific staining. However, neither intestinal nor placental alkaline phosphatase can be blocked with levamisole. Therefore, tissues of this origin should be stained with peroxidase detection systems. A higher sensitivity can be obtained when a second chromogenic substrate step is used (i. e. 2 x 10 min Permanent AP Red). Background staining due to endogenous biotin can be blocked through an avidin-biotin blocking step prior to the primary antibody incubation step. Inadequate counterstaining and mounting can influence the interpretation of the results. A longer exposure to absolute ethanol can result in decreasing staining intensity. Sanbio guarantees that the product will meet all requirements described from its shipping date until its expiry date, as long as the product is correctly stored and utilized. No additional guarantees can be given. Under no circumstances shall Sanbio be liable for any damages arising out of the use of the reagent provided.
Precautions:
Use by qualified personnel only. Wear protective clothing to avoid contact of reagents or specimen with eye, skin or mucous membrane. In case of a reagent or specimen coming into contact with a sensitive area, wash the area with large amounts of water. Microbial contamination of the reagents must be avoided, since otherwise non-specific staining might appear. A material safety data sheet (MSDS) is available upon request.
The chloroplast ATP synthase belongs to the family of F1-type ATPases, which are also present in bacteria and mitochondria. ATP synthase generates ATP from ADP and inorganic phosphate using energy derived from a trans-thylakoidal electrochemical proton gradient.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at short-term 4 C, Long-term -20 . Repeated freezing and thawing is not recommended. It ontains 0,01% sodium azide.
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii
Expected Species:
Ostreococcus lucimarinusm, Spinacia oleracea, Sorghum bicolor, Volvox carteri Species of your interest not listed? Contact us
Immunogen:
isolated CF1 subunit of the chloroplast ATP synthase complex from Chlamydomonas reinhardtii Q42687.1
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Perlaza (2021). Organelle Size and Quality Control in Chlamydomonas Reinhardtii. UCSF. ProQuest ID: Perlaza_ucsf_0034D_12217. Merritt ID: ark:/13030/m5257z1d. Retrieved from https://escholarship.org/uc/item/1jg3874hPerlaza et al. (2019). The Mars1 kinase confers photoprotection through signaling in the chloroplast unfolded protein response. Elife. 2019 Oct 15;8. pii: e49577. doi: 10.7554/eLife.49577. (immunofluorescence)
The chloroplast ATP synthase belongs to the family of F1-type ATPases, which are also present in bacteria and mitochondria. ATP synthase generates ATP from ADP and inorganic phosphate using energy derived from a trans-thylakoidal electrochemical proton gradient.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at at Store short-term 4 C, Long-term -20 . Repeated freezing and thawing is not recommended.
This product can be sold with ProClin if requested
Application Details:
1 : 2000 (WB)
Purity:
Serum
Molecular Weight:
23 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Blair et al. (2018). The Helicobacter pylori cell shape promoting protein Csd5 interacts with the cell wall, MurF, and the bacterial cytoskeleton. Mol Microbiol. 2018 Jul 24. doi: 10.1111/mmi.14087.Fristedt et al. (2015). The thylakoid membrane protein CGL160 supports CF1CF0 ATP synthase accumulation in Arabidopsis thaliana. PLoS One. 2015 Apr 2;10(4):e0121658. doi: 10.1371/journal.pone.0121658.
Polyphenol oxidase participates in the response of plants to wounding and herbivore attack, mediated by the octadecanoid wound-signalling pathway. Chloroplast polyphenol oxidase is a nuclear-encoded protein that is targeted to the thylakoid lumen. It was found that polyphenol oxidase is one of the most strongly phosphorylated protein in thylakoid lumen although the role of this protein modification is not known. Alternative name: catechol oxidase.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at short-term 4 C, Long-term -20 . Repeated freezing and thawing is not recommended. It ontains 0,01% sodium azide.
Host Animal:
Rabbit
Species Reactivity:
Spinacia oleracea
Expected Species:
Spinacia oleracea
Immunogen:
recombinant lumenal polyphenol oxidase of Spinacia oleracea UniProt: P43310
The chloroplast ATP synthase belongs to the family of F1-type ATPases, which are also present in bacteria and mitochondria. ATP synthase generates ATP from ADP and inorganic phosphate using energy derived from a trans-thylakoidal electrochemical proton gradient. The transmembrane CF0IV subunit of appr. 25 kDa belongs to a stator part of ATP synthase and is involved in the proton translocation.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at short-term 4 C, Long-term -20 . Repeated freezing and thawing is not recommended. It ontains 0,01% sodium azide.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Fristedt et al. (2015). The thylakoid membrane protein CGL160 supports CF1CF0 ATP synthase accumulation in Arabidopsis thaliana. PLoS One. 2015 Apr 2;10(4):e0121658. doi: 10.1371/journal.pone.0121658.
Deoxynivalenol (DON) is a mycotoxin occuring in grains such as barley, maize, oats, rye, and wheat. It occurs less often in rice, sorghum, and triticale. The plant pathogens Fusarium graminearum (Gibberella zeae) and F. culmorum, which are causing Gibberella ear rot in maize and Fusarium head blight in wheat, are associated with the occurence of Deoxynivalenol. DON is a type B trichothecene, an epoxy-sesquiterpeneoid.Alternative name: Vomitoxin.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cup to one month or in aliquots at -20 °C for long time storage. Avoid repeated freezing and thawing.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Ivanova et al. (2017). Role of P-glycoprotein in deoxynivalenol-mediated in vitro toxicity. Toxicol Lett. 2017 Nov 23;284:21-28. doi: 10.1016/j.toxlet.2017.11.021.
Special application note:
Antibodies are present in phosphate buffered saline, pH 7.2, 0.05% sodium azide as preservative
PEL1 (Pelota) is required for normal chromosome segregation during cell division and genomic stability. Synonymes: Eukaryotic release factor 1 (ERF1) family protein, Putative pelota (PEL1) protein
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Oryza sativa, Ostreococcus tauri, Ricinus communis, Populus canadensis, Vitis vinifera Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from known plant Pelota sequences including Arabidopsis thaliana UniProt: Q9ZT87 TAIR: At4g27650
The chloroplast ATP synthase belongs to the family of F1-type ATPases, which are also present in bacteria and mitochondria. ATP synthase generates ATP from ADP and inorganic phosphate using energy derived from a trans-thylakoidal electrochemical proton gradient.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at short-term 4 C, Long-term -20 . Repeated freezing and thawing is not recommended. It ontains 0,01% sodium azide.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Galvis et al. (2020). H+ transport by K+ EXCHANGE ANTIPORTER3 promotes photosynthesis and growth in chloroplast ATP synthase mutants. Plant Physiol. pp.01561.2019. doi: 10.1104/pp.19.01561.Koochak et al. (2019). The structural and functional domains of plant thylakoid membranes. Plant J. 2019 Feb;97(3):412-429. doi: 10.1111/tpj.14127.Lv et al. (2019). Uncoupled Expression of Nuclear and Plastid Photosynthesis-Associated Genes Contributes to Cell Death in a Lesion Mimic Mutant. Plant Cell. 2019 Jan;31(1):210-230. doi: 10.1105/tpc.18.00813.Gao et al. (2018). A supercomplex, approximately 720 kDa and composed of both photosystem reaction centers, dissipates excess energy by PSI in green macroalgae under salt stress. Plant Cell Physiol. 2018 Oct 8. doi: 10.1093/pcp/pcy201.Koochak et al. (2018). The structural and functional domains of plant thylakoid membranes. Plant J. 2018 Oct 12. doi: 10.1111/tpj.14127. (BN-PAGE)Rantala and Tikkanen et al. (2018). Phosphorylation‐induced lateral rearrangements of thylakoid protein complexes upon light acclimation. Plant Direct Vol. 2, Issue 2.Fristedt et al. (2015). The thylakoid membrane protein CGL160 supports CF1CF0 ATP synthase accumulation in Arabidopsis thaliana. PLoS One. 2015 Apr 2;10(4):e0121658. doi: 10.1371/journal.pone.0121658. Grieco et al. (2015). Light-harvesting II antenna trimers connect energetically the entire photosynthetic machinery - including both photosystems II and I. Biochim Biophys Acta. 2015 Jun-Jul;1847(6-7):607-19. doi: 10.1016/j.bbabio.2015.03.004. Epub 2015 Apr 3.Yap at al. (2015). AEF1/MPR25 is implicated in RNA editing of plastid atpF and mitochondrial nad5 and also promotes atpF splicing in Arabidopsis and rice. Plant J. 2015 Jan 13. doi: 10.1111/tpj.12756.
Special application note:
This product can be sold containing proClin if requested
NtcA acts as a transcriptional activator of genes subjected to nitrogen control.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Synechocystis sp. PCC6803
Expected Species:
Anabaena sp., Gleobacter sp., marine Synechococcus strains, Trichodesmium sp. Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from known cyanobacterial NtcA protein sequences including UniProt: P33779
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Ge at al. (2017). Translating Divergent Environmental Stresses into a Common Proteome Response through the Histidine Kinase 33 (Hik33) in a Model Cyanobacterium. Mol Cell Proteomics. 2017 Jul;16(7):1258-1274. doi: 10.1074/mcp.M116.068080.
The chloroplast ATP synthase belongs to the family of F1-type ATPases, which are also present in bacteria and mitochondria. ATP synthase generates ATP from ADP and inorganic phosphate using energy derived from a trans-thylakoidal electrochemical proton gradient.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at short-term 4 C, Long-term -20 . Repeated freezing and thawing is not recommended. It ontains 0,01% sodium azide.
Host Animal:
Rabbit
Species Reactivity:
dicots, Chlamydomonas reinhardtii, cyanobacteria including Synechocystis sp. PCC 6803.
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
isolated CF1 subunit of the chloroplast ATP synthase complex from Chlamydomonas reinhardtii
Phosphate acetyltransferase (PTA) - EC=2.3.1.8 is an enzyme from transferase family which participates in three metabolic pathways: taurine and hypotaurine metabolism, pyruvate metabolism and propanoate metabolism. Alternative names: acetyl-CoA:phosphate acetyltransferase, phosphotransacetylase, phosphoacylase.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii
Expected Species:
Volvox carteri Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide conjugated derived from PTA2 of Chlamydomonas reinhardtii A8IZZ9
Cytokinins (CK) belong to a class of plant growth substances (plant hormones) which promote cell deivision by means of local and long distance signalling. Zeatin is an adenine-type cytokinin synthesised in stems, leaves and roots.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Ortho-topolin riboside
Expected Species:
Ortho-topolin riboside
Immunogen:
BSA-conjugated, via ribose, ortho-topolin riboside
Cytokinins (CK) belong to a class of plant growth substances (plant hormones) which promote cell deivision by means of local and long distance signalling.Zeatin is an adenine-type cytokinin synthesised in stems, leaves and roots.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
N6-isopentenyladenosine
Expected Species:
N6-isopentenyladenosine
Immunogen:
BSA-conjugated, via ribose, N6-isopentenyladenosine
Cytokinins (CK) belong to a class of plant growth substances (plant hormones) which promote cell deivision by means of local and long distance signalling. Zeatin is an adenine-type cytokinin synthesised in stems, leaves and roots.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Cytokinins (CK) belong to a class of plant growth substances (plant hormones) which promote cell deivision by means of local and long distance signalling. Zeatin is an adenine-type cytokinin synthesised in stems, leaves and roots. Synonym: 9-(β-D-Ribofuranosyl)-trans-zeatin, N6-(trans-4-Hydroxy-3-methyl-2-buten-1-yl)adenosine
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Cytokinins (CK) belong to a class of plant growth substances (plant hormones) which promote cell deivision by means of local and long distance signalling. Zeatin is an adenine-type cytokinin synthesised in stems, leaves and roots.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Dihydrozeatin riboside
Expected Species:
Dihydrozeatin riboside
Immunogen:
BSA-conjugated, via ribose, dihydrozeatin riboside
Cytokinins (CK) belong to a class of plant growth substances (plant hormones) which promote cell deivision by means of local and long distance signalling. Zeatin is an adenine-type cytokinin synthesised in stems, leaves and roots.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Cytokinins (CK) belong to a class of plant growth substances (plant hormones) which promote cell deivision by means of local and long distance signalling. Zeatin is an adenine-type cytokinin synthesised in stems, leaves and roots.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Glutamate carboxypeptidase II (GCPII), also known as N-acetyl-alpha-linked acidic dipeptidase I (NAALADase I), folate hydrolase (FOLH1), and prostate-specific membrane antigen (PSMA), is an approximately 95-110 kDa type II transmembrane glycoprotein expressed in various tissues. In nervous system GCPII cleaves abundant N-acetylaspartylglutamate, which is released from neurons in a calcium-dependent manner, to N-acetylaspartate and glutamate. As immoderate glutamate concentration is neurotoxic, GCPII contributes to pathological conditions regarding e.g. Alzheimer´s disease, Huntington´s disease, epilepsy, schizophrenia, stroke or neuropathic pain and appears to be an interesting therapeutic target. In jejunum GCPII hydrolyzes pteroylpoly-gamma-glutamate to folate and glutamate, enabling folate to be absorbed by gastrointestinal tract. GCPII, which is present in a number of tissues at low levels, is overexpressed in neovasculature of most solid tumours and is a target enzyme for diagnosis and treatment of prostate cancer. Normal human prostate express more mRNA coding for a cytosolic GCPII form truncated at the N-terminus (PSM´) than mRNA for membrane-bound GCPII, and this ratio is reversed upon malignant transformation.SpecificityThe mouse monoclonal antibody EM-53 recognizes RLTPR / CARMIL2, an intracellular protein playing a role in actin filament elongation.Application detailsWestern blotting: Recommended dilution: 1 ?g/ml; positive control: LNCaP cell line. Sample preparation: Resuspend approx. 50 mil. cells in 1 ml cold lysis buffer (1% NP-40). Incubate 30 min on ice. Mix lysate with non-reducing/reducing Laemmli SDS-PAGE sample buffer. Both reducing and non-reducing conditions.
Antibody Isotype:
IgG1
Monosan Range:
MONOSAN
Clone:
GCP-04
Concentration:
1 mg/ml
Format:
Purified by protein-A affinity chromatography.
Storage buffer:
Phosphate buffered saline (PBS), pH 7.4, 15 mM sodium azide
GFP (Green fluorescent protein) was originally identified in photo organs on jellyfish Aequorea victoria. It is a naturally fluorescent protein which emits green light at a maximum wavelength of 509 nm when excited by blue or UV light. It is extensively used in laboratory as a reporter molecule to label and study cellular and subcellular proteins in living cells using a wide range of applications. GFP protein has molecular weight of 27 kDa.Source of GFP standard: Wild type recombinant GFP from A. victoria was expressed in E. coli.
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store in undiluted aliquots at -20 °C; to avoid repeated freeze-thaw cycles. Store up to 24 months.
GFP (Green fluorescent protein) was originally identified in photo organs on jellyfish Aequorea victoria. It is a naturally fluorescent protein which emits green light at a maximum wavelength of 509 nm when excited by blue or UV light. It is extensively used in laboratory as a reporter molecule to label and study cellular and subcellular proteins in living cells using a wide range of applications. Antibodies to GFP protein are used in immunoblotting and ELISA. GFP protein has molecular weight of 27 kDa. This antibody is directly conjugated to soyabean peroxidase.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cor in small aliquotes at -20 °C; avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Native GFP, Recombinant GFP (E,coli), all variants of GFP
Immunogen:
highly purified native GFP protein derived from Aequorea victoria, UniProt: P42212
Applications:
ELISA (ELISA), Immunogold (IG), Immunohistochemistry (IHC), Western blot (WB)
Clathrin is a submembrane protein that polymerizes into coat-like lattices, which results in membrane invagination. The basic oligomers are composed of three clathrin heavy chain (180 kDa) and three light chain (30 kDa) subunits and the process of polymerization is dynamically regulated by the light chains. Interaction of clathrin with the plasma membrane is mediated by adaptor proteins (AP1-4) specific for different cellular compartments. Another proteins, such as endophilin, epsin and amphiphysin are involved in membrane invagination and clathrin rearrangements. Finally, dynamin functions at the fission stage of clathrin-mediated endocytosis.SpecificityMouse monoclonal antibody CLIC5-02 recognizes CLIC5a, a 32 kDa intracellular protein which associates with proteins of actin complexes. Crossreactivity with CLIC5b was not determined.Application detailsFlow cytometry: Recommended dilution: 2-5 ?g/ml; positive control: human blood leukocytes. Intracellular staining.
Antibody Isotype:
IgM
Monosan Range:
MONOSAN
Clone:
BF-06
Concentration:
1 mg/ml
Format:
Purified by sequential steps of physicochemical fractionation (differential precipitation and solid-phase chromatography methods).
Storage buffer:
Stabilizing Tris buffered saline (TBS), pH 8.0, 15 mM sodium azide
Thyroglobulin (Tg) is the precursor of the iodinated thyroid hormones thyroxine (T4) and triiodothyronine (T3). Tg is a high molecular weight glycoprotein found in normal thyroid follicular cells. Thyroglobulin is useful for identifying thyroid carcinoma of papillary and follicular types and for identifying tumors of thyroid origin when working with adenocarcinoma of unknown primary.
Antibody Isotype:
IgG1-k
Monosan Range:
MONOSAN Ready To Use
Clone:
2H11+6E1
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Sellitti DF and Suzuki K. Thyroid. 2014; 24:625-38
References 2:
Bellet D, et al. J Clin Endocrinol Metab 1983; 56:530-3
References 3:
Bejarano PA, et al. Appl Immunohistochem Mol Morphol. 2000; 8:189-94
Immunoglobulin M (IgM) is produced as a 900 kDa pentamer, which is an efficient complement binder. This antibody type is produced initially in the immune response and it is the first immunoglobulin class to be synthesized by a fetus or newborn. IgM antibodies do not cross the placenta. IgM concentration in blood is 0.12 g/l and its biological survival (plasma T1/2) is 5 days.SpecificityApplication details Western blotting: Recommended dilution: 1 ?g/ml.<br>Flow cytometry: Recommended dilution: 1-4 ?g/ml, extracellular and intracellular staining.
Antibody Isotype:
IgG5
Monosan Range:
MONOSAN
Clone:
CH2
Conjugate:
HRP
Concentration:
1 mg/ml
Format:
Purified antibody is conjugated with activated horseradish peroxidase (HRP) of high specific enzyme activity under optimum conditions and unconjugated antibody and free HRP are removed by size-exclusion chromatography.
Immunoglobulin G (IgG) is a 150 kDa soluble protein that serves as a major effector molecule of the humoral immune response in man. Its concentration in blood plasma of healthy individuals is approximately 10 g/l, which accounts for about 75% of the total plasma immunoglobulins. IgG has the highest stability of blood immunoglobulins (T1/2 = 21 days) and is able of placental transfer. IgG is secreted by plasma cells at a comparably high rate as other immunoglobulins.SpecificityImmunoglobulin M (IgM) is produced as a 900 kDa pentamer, which is an efficient complement binder. This antibody type is produced initially in the immune response and it is the first immunoglobulin class to be synthesized by a fetus or newborn. IgM antibodies do not cross the placenta. IgM concentration in blood is 0.12 g/l and its biological survival (plasma T1/2) is 5 days.Application details Western blotting and ELISA: The peroxidase conjugate of this antibody is suitable for detection of human IgG Fc fragments. The antibody EM-07 does not crossreact with IgM.
Antibody Isotype:
IgG3
Monosan Range:
MONOSAN
Clone:
EM-07
Conjugate:
HRP
Concentration:
1 mg/ml
Format:
Purified antibody is conjugated with activated horseradish peroxidase (HRP) of high specific enzyme activity under optimum conditions and unconjugated antibody and free HRP are removed by size-exclusion chromatography.
Botulinum toxin is a toxin produced by the anaerobic, gram-positive, bacterium of the genus Clostridium (C. botulinum, C. butyricum, C. baratii and C. argentinense). These strains are widely distributed and can be found in soil and dust. Eight types of botulinum toxin are distinguished, named type A–H. Type A and B are capable of causing disease in humans (botulism) and have longest activity in vivo, and are also used commercially (BOTOX) and medically. Types C–G are less common; types E and F can cause disease in humans, while the other types cause disease in other animals. BotB is cleaved into two chains: heavy and light.Alternative name: Bontoxilysin-B
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
Botulinum Neurotoxin B from Clostridium botulinum
Immunogen:
Highly purified Botulinum Neurotoxin Type B (Clostridium botulinum)
Exosomes are small endosome derived lipid nanoparticles (50-120 nm) actively secreted by exocytosis by most living cells. Exosome release occurs either constitutively or upon induction, under both normal and pathological conditions, in a dynamic, regulated and functionally relevant manner. Both amount and molecular composition of released exosomes depend on the state of a parent cell. Exosomes have been isolated from diverse cell lines (hematopoietic cells, tumor lines, primary cultures, virus infected cells) as well as from biological fluids in particular blood (e.g. serum and plasma from cancer patients) and other body fluids (bronchoalveolar lavage fluid, pleural effusions, synovial fluid, urine, amniotic fluid, semen, saliva etc). Exosomes have pleiotropic physiological and pathological functions and an emerging role in diverse pathological conditions such as cancer, infectious and neurodegenerative diseases.
Affinity purified using solid phase Human Thyroid Stimulating Hormone (TSH, intact)
Purity:
> 95% based on SDS-PAGE
Host:
Goat
Immunogen:
Human TSH (intact)
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Specificity:
Based on ELISA: · Human TSH (β) · Human TSH (intact)
Cross Reactivity:
This antibody has been cross absorbed to remove antibodies to TSH, alpha subunit
Country Of Origin:
Goat serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Anti-cytokeratin, low molecular weight (AE1) antibody labels acidic keratins K10, K14, K15, K16, and K19. Anti-cytokeratin (AE1) reactivity is seen in most normal and neoplastic cells of epithelial origin. Anti-cytokeratin (AE1) is a useful immunohistochemical reagent for distinguishing between poorly differentiated carcinomas and non-epithelial neoplasms.
Antibody Isotype:
IgG1-k
Monosan Range:
MONOSAN Ready To Use
Clone:
AE1
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Tyler, CR. Arch Pathol Lab Med. 1978; 102:113-21
References 2:
Weiss RA, et al. J Cell Biol. 1984; 98:1397-406
References 3:
Lopez-Beltran A, et al. Virchows Arch. 2001; 438:552-7
References 4:
Kitazawa R, et al. Virchows Arch. 1999; 435:137-42
References 5:
Judkins AR, et al. Am J Clin Pathol. 1998; 110:641-6
INSM1 (insulinoma-associated protein 1), also known as zinc-finger protein IA-1, is a developmentally regulated zinc-finger transcription factor. It localizes to the nucleus and is expressed in embryonic tissues undergoing neuroendocrine differentiation. INSM1 is not expressed in normal adult tissues but it can be found highly expressed in neuroendocrine tumors. INSM1 contains five Cys2-His2-type zinc-finger DNA binding domains and a prohormone domain. INSM1 acts as a transcriptional repressor of the Neuro D promoter and recruits cyclin D1 as a corepressor. It plays an important role in neuroendocrine development and is required for normal differentiation of pancreatic endocrine cells. Inhibition of INSM1 results in decreased formation of glucagon and Insulin positive cells. The gene encoding INSM1 is directly regulated by Neurogenin 3 which binds chromatin in the INSM1 promoter region and induces transcription.
Antibody Isotype:
IgG1k
Monosan Range:
MONOSAN
Clone:
A-8
Concentration:
lot specific
Storage buffer:
Tissue culture supernatant with sodium azide
Storage:
2-8°C
References 1:
Li et al. Biochem Biophys Res Comm 1997;236;776-781
References 2:
Breslin et al. Nucleic Acids Res 2002;30:1038-1045
Anti-cytokeratin, high molecular weight (AE3) is capable of recognizing all basic keratins; therefore, it is a broadly reactive antibody staining most epithelia and their neoplasms. Members of the acidic and basic subfamilies are found together in pairs. Since each epithelium contains at least one acidic and one basic keratin, this antibody is used to observe the distribution of keratin-containing cells in normal epithelia and to identify neoplasms derived from such epithelium.
Antibody Isotype:
IgG1-k
Monosan Range:
MONOSAN Ready To Use
Clone:
AE3
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Tyler CR.Arch Pathol Lab Med. 1978; 102:113-21
References 2:
Weiss RA, et al. J Cell Biol. 1984; 98:1397-406
References 3:
Lopez-Beltrán A, et al. Virchows Arch. 2001; 438:552-7
Cytokeratin 14 is a member of the Type I family of cytokeratins and is generally expressed in the basal cell layer of squamous epithelium. The cytokeratin 14 protein forms a heterotetramer with homodimers of cytokeratin 5 to contribute to the structural integrity of the intracellular cytoskeletal network. Anticytokeratin 14 has immunohistochemical utility as an aid in distinguishing squamous cell carcinomas from other tumors of epithelial origin.
Antibody Isotype:
IgG3
Monosan Range:
MONOSAN Ready To Use
Clone:
LL002
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Reis-Filho JS et al. Appl Immunohistochem Mol Morphol; 11(1):1-8 (2003)
Mab 647 is useful for studying the intracellular distribution and structure of actin in the cytoskeletal system. In immunoblotting one single band is reactive corresponding to actin. Positive control: Muscle or myofibrils.
The antibody reacts with prostatic acid phosphatase in the glandular epithelium of normal and hyperplastic prostate, and adenocarcinoma of the prostate. Anti-PSAP is useful in identifying prostatic origin of tumors in the metastatic setting. PSAP complements other immunohistochemical markers in the correct clinical context.
Antibody Isotype:
IgG1
Monosan Range:
MONOSAN Ready To Use
Clone:
PASE/4LJ
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Ansari, MA, et al. Am J Clin Path 1981;76:94-98
References 2:
Kimura, N, et al. Virchows Arch A 1986;4:247-251
References 3:
Kidwai N et al. Breast Cancer Res. 2004;6(1):R18-23
References 4:
Genega EM et al. Mod Pathol. 2000 Nov;13(11):1186-91
References 5:
Gatalica Z et al. Appl Immunohistochem Mol Morphol. 2000 Jun;8(2):158-61
Gastrin-secreting cells are numerous in the antrum and a few are found in the proximal duodenum. The antibody can be used for the diagnosis of gastrin-producing tumors which are mainly found in the pancreas and occasionally in the stomach and the duodenum. <br>Absorption with 10-100 ug gastrin 1-34 and CCK 8 per ml antiserum abolishes the staining. Positive control: formalin-fixed paraffin sections of rat antrum.
Monosan Range:
MONOSAN
Concentration:
n/a
Storage buffer:
Lyophilized; reconstitute in 100 µl dist. water
Storage:
2-8°C
References 1:
Portela-Gomes, G. M.et al. Histochem. Cell Biol. 1999;111: 4954
References 2:
Portela-Gomes, G. M.et al. J. Histochem. Cytochem.1997;45: 81522
References 3:
Mulder, H. et al. Gastroenterology 1994;107: 7129
Substance P occurs in nerve fibers of the central and peripheral nervous system and in endocrine cells of the gut. It stimulates smooth muscle contraction, gives rise to vasodilation and is involved in sensory functions. Substance P-containing tumors arising in the ileum are often associated with the carcinoid syndrome, characterized by flushing of the skin, diarrhea, broncho-constriction and sudden drops in blood pressure. Substance P is commonly found in the midgut carcinoids and some of the symptoms may be related to this peptide. Absorption with 10-100 ug SP and NKA per ml diluted antiserum abolishes the staining while GRP and NKB do not. Positive control:<strong> </strong>frozen sections of rat colon.
Monosan Range:
MONOSAN
Concentration:
n/a
Storage buffer:
Lyophilized; reconstitute in 100 µl dist. water
Storage:
2-8°C
References 1:
Kressel, M.et al. J. Comp. Neurol. 1999;412: 161172
The intestinal peptide YY is related to the PP-family of peptides and occurs in the glicentin cells in the gut. They are numerous in the rectum, colon, and ileum and few in the duodenum and jejunum. PYY has hormone-like action, inhibits gut motility and pancreatic exocrine secretion and cause vasoconstriction. <br>PYY may occur in endorine tumors of the pancreas and of the rectum. Absorption with 10-100 ug immunogen per ml diluted antiserum abolishes the staining.<br>Positive control: frozen sections of rat intestine.
Anti-Cytokeratin 19 reacts with a wide variety of epithelium and epithelial malignancies including Adenocarcinomas of the Colon, stomach, pancreas, biliary tract, liver and breast. Perhaps the most useful application is the identification of Thyroid carcinoma of the Papillary type, although Follicular Carcinoma is also labeled by this antibody approximately 50-60% of the time.
Antibody Isotype:
IgG1
Monosan Range:
MONOSAN Ready To Use
Clone:
A53-B/A2.26
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Cerilli LA, et al. Am J Clin Pathol 2002;118:186-193
References 2:
Jain R, et al. Appl Immunohistochem Mol Morphol. 2010; 18:9-15
Phenylethanolamine-N-methyltransferase (PNMT) is an enzyme converting noradrenaline to adrenaline. <br>The enzyme is present in adrenomedullary cells and in the brain neurons. <br> Absorption with 10-100 ug immunogen per ml diluted antiserum abolishes the staining.<br>Positive control: DEPC-fixed paraffin sections of rat adrenal gland.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 0.11 ml of deionized water and let stand 30 minutes at room temperature to dissolve. Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Specificity:
Human Resistin
Cross Reactivity:
Not Tested Against Other Species
Country Of Origin:
US Origin
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Na/K Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
Store at 2-8°C for use within 1-3 weeks or -20°C for long term storage, avoid repeat freeze thaws.
Specificity:
Human IL6
Cross Reactivity:
Not Tested Against Other Species
Country Of Origin:
US Origin
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Specificity:
Human Omentin
Cross Reactivity:
Not Tested Against Other Species
Country Of Origin:
US Origin
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
Store at 2-8°C for use within 1-3 weeks or -20°C for long term storage, avoid repeat freeze thaws.
Specificity:
Mouse IL6
Cross Reactivity:
Not Tested Against Other Species
Country Of Origin:
US Origin
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Specificity:
Human gACRP-30
Cross Reactivity:
Not Tested Against Other Species
Country Of Origin:
US Origin
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Specificity:
Human Visfatin
Cross Reactivity:
Not
Country Of Origin:
US Origin
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Acetylated Lysine is involved in post-translational modifications of proteins which play a critical role in the regulation and function of many known biological processes. Proteins can be post-translationally modified in many different ways, and a common post-transcriptional modification of Lysine involves acetylation.This antibody is conjugated to Alkaline phosphatase (ALP).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°C.
Host Animal:
Rabbit
Species Reactivity:
Detects proteins containing acetylated lysine residues in all specias
Immunogen:
chemically modified KLH allowing acetylation of all lysines of this carrier protein
Applications:
ELISA (ELISA), Immunohistochemistry (IHC), Immunoprecipitation (IP), Western blot (WB)
Methylated Lysine is involved in post-translational modifications of proteins which play a critical role in the regulation and function of many known biological processes. Proteins can be post-translationally modified in many different ways, and a common post-transcriptional modification of Lysine involves methylation.This antibody is conjugated to FITC.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C for 1 year; make aliquots to avoid repeated freeze-thaw cycles.
Host Animal:
Rabbit
Species Reactivity:
Detects proteins containing methylated lysine residues in all specias
Immunogen:
KLH-conjugated methylated lysine
Applications:
ELISA (ELISA), Immunohistochemistry (IHC), Immunoprecipitation (IP), Western blot (WB)
Acetylated Lysine is involved in post-translational modifications of proteins which play a critical role in the regulation and function of many known biological processes. Proteins can be post-translationally modified in many different ways, and a common post-transcriptional modification of Lysine involves acetylation.This antibody is conjugated to FITC.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°C.
Host Animal:
Rabbit
Species Reactivity:
Detects proteins containing acetylated lysine residues in all specias
Immunogen:
chemically modified KLH allowing acetylation of all lysines of this carrier protein
Applications:
ELISA (ELISA), Immunohistochemistry (IHC), Immunofluorescence (IF), Western blot (WB)
GIP occurs in endocrine cells in the small intestine. GIP is released upon feeding, particularly after carbohydrate-rich food, and is known to sensitize the insulin cells to rise in blood sugar and is thus involved in the insular axis. GIP also inhibits gastric acid secretion.<br> Absorption with 10-100 ug immunogen per ml diluted antiserum abolishes the staining, while CCK-39, VIP and secretin do not.
Monosan Range:
MONOSAN
Concentration:
n/a
Storage buffer:
Lyophilized; reconstitute in 50-100 ul dist. water (final solution contains 0.09% sodium azide, 1% BSA in PBS buffer, pH 7.4)
Enkephalins are small peptides derived from large precursers (pro-enkephalin A and B) containing multiple enkephalin copies. They are the most abundant opioid peptides in the body and are widely distributed in the brain and the peripheral nervous system and occur also in the adrenal medulla. Several types of neuroendocrine tumors, incl. pheochromocytomas, neuroblastomas and bronchial and gastrointestinal endocrine tumors, produce enkephalin. <br>Absorption with 10-100 ug immunogen per ml diluted antiserum abolishes the staining, while beta-endorphin does not. Cross-reacts with leu-enkephalin. Positive control:<strong> </strong>Frozen sections of cat or pig small intestine.
Monosan Range:
MONOSAN
Concentration:
n/a
Storage buffer:
Lyophilized; reconstitute in 100 µl dist. water
Storage:
2-8°C
References 1:
Kirchgessner, A. L. et al. Neurol.1989; 285, 3853
Affinity purified using solid phase Human Fibrinogen
Purity:
> 95% based on SDS-PAGE
Host:
Goat
Immunogen:
Human Fibrinogen
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Specificity:
Human Fibrinogen
Country Of Origin:
Goat serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Specific for alpha-melanocyte stimulating hormone. Absorption with 10-100 ug immunogen per ml diluted antiserum abolishes the staining.<br>In man,<strong> </strong>alpha-MSH is found in corticotrophs of the anterior pituitary and may also occur in brain neurons.<br>Positive control: Bouin-fixed paraffin sections of pig pituitary.
Oxytocin is synthesized in nerve cell bodies in the supraoptic nucleus and paraventricular nucleus, and carried by axonal transport to the neural stalk and pars nervosa where they are stored. Oxytocin nerve terminals can also be found throughout the CNS, even reaching the lower spinal cord. <br>Absorption with 10-100 ug immunogen per ml diluted antiserum abolishes staining. Positive control: frozen sections of pig pituitary.
Neuromedin U was found in porcine spinal cord. Neuromedin U-8 is contained within a larger polypeptide form neuromedin U-25. Neuromedin U is present in central and peripheral neurons, particularly in the enteric nervous system. <br>Absorption with 10-100 ug immunogen per ml diluted antiserum abolishes the staining. Positive control: frozen sections of chicken small intestine.
Human leukocyte antigen G (HLA-G), belonging to MHC class I glycoproteins, plays important roles in both physiological and pathological immunotolerance. It gives an inhibitory signal to cytotoxic T cells, NK cells, monocytes, and some other immune cells. It also induces regulatory T cells and anti-inflammatory macrophages. HLA-G is important e.g. for maternal tolerance to the fetus, and for immunomodulation in particular adult tissues, such as in cornea, pancreatic islets, thymus and other. On the other hand, it is expressed in many solid and hematologic malignancies, where it contributes to evasion of the immune surveillance. HLA-G expression pattern in cancer is an important prognostic factor regarding a poor clinical outcome. Unlike most other MHC glycoproteins, HLA-G acts as an immune checkpoint molecule rather than as an antigen presenting molecule. It concerns both transmembrane and soluble HLA-G isoforms. Among other, HLA-G can promote Th2 immunological response and downregulate Th1 immunological response. For its benefits regarding allograft tolerance, including embryo implantation, soluble HLA-G (sHLA-G) can be used as a marker of developmental potential of embryos during the process of in vitro fertilization. Similarly, sHLA-G concentrations in maternal serum are decreased in preeclampsia. Transplanted patients with increased sHLA-G serum levels have improved allograft acceptance. On the other hand, increased sHLA-G can also indicate presence of malignant (sometimes also of benign) tumor cells. Another important topic is induction of HLA-G expression (sometimes associated with shedding of HLA-G from the cell surface) by some anti-cancer or anti-viral therapies, which can weaken the therapy effect. Monitoring of HLA-G in patients thus has a wide usage.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Do not freeze.
Immunogen:
HLA-A2.1/human beta2-microglobulin double transgenic mice were immunized with murine L cells transfected with both human beta2-microglobulin and HLA-G.
Applications:
FC,IP,ELISA,IHC
Additional Info:
The mouse monoclonal antibody G233 recognizes an extracellular epitope on several isoforms of HLA-G expressed in all populations of extravillous trophoblast (cell columns, interstitial trophoblast, endovascular trophoblast, placental bed giant cells). HLA-G belongs to the nonclassical MHC Class I molecules (MHC Class Ib). The antibody G233 has been found not to cross-react with any other MHC Class I antigens (HLA-A, -B, -C, -E, -F).
Clone number:
G233
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: Extracellular and intracellular staining; recommended dilution: 1-4 ?g/ml.
The antibody 4H84 recognizes HLA-G molecule (39 kDa). HLA-G belongs to the MHC Class I molecules (MHC Class Ib; nonclassical) and it is expressed on the surface of trophoblast cells.<br> <i>This product is for research and in vitro experimental use only. It is not to be used for any other commercial purpose. Use of this product to produce products for sale or for therapeutic or drug discovery purposes is prohibited. In order to obtain a license to use this product for commercial purposes, contact The Regents of the Univessity of California.</i>
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Do not freeze. Do not use after expiration date stamped on vial label.
Immunogen:
amino acids 61-83 of HLA-G of human origin
Applications:
WB,IP,IHC,ICC,ELISA
Additional Info:
The antibody 4H84 recognizes HLA-G molecule (39 kDa). HLA-G belongs to the MHC Class I molecules (MHC Class Ib; nonclassical) and it is expressed on the surface of trophoblast cells.<br>_x000D_ <i>This product is for research and in vitro experimental use only. It is not to be used for any other commercial purpose. Use of this product to produce products for sale or for therapeutic or drug discovery purposes is prohibited. In order to obtain a license to use this product for commercial purposes, contact The Regents of the Univesity of California.</i>_x000D_ _x000D_
Cytokeratin 8, a member of the Type II family of cytokeratins, is typically expressed in simple epithelium. The dimerization of cytokeratin 8 with cytokeratin 18 (labeled by 35betaH11) in the cytoplasm of simple epithelial cells allows for the formation of an intermediate filament cytoskeletal framework. This structure plays a role in the maintenance of cellular structural integrity and also functions in promoting signal transduction and cellular differentiation processes. Additionally, the presence of cytokeratin 8 has been detected in neoplastic epithelia, including glandular epithelium that can be found in prostate carcinoma. Positive immunoreactivity with anti-cytokeratin 8 is a useful indicator for the identification of normal and neoplastic epithelial tissues.
Antibody Isotype:
IgM
Monosan Range:
MONOSAN Ready To Use
Clone:
35betaH11
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Battifora, H. Am J Surg Pathol 1988;12:24
References 2:
Gown, AM, et al. Am J Clin Pathol 1985;84:413
References 3:
Ljung G, et al. Prostate. 1997; 31:91-7
References 4:
Murata T, et al. Pathol Res Pract. 1993; 189:888-93
References 5:
Moll R, et al. Histochem Cell Biol. 2008; 129:705-33
Human leukocyte antigen G (HLA-G), belonging to MHC class I glycoproteins, plays important roles in both physiological and pathological immunotolerance. It gives an inhibitory signal to cytotoxic T cells, NK cells, monocytes, and some other immune cells. It also induces regulatory T cells and anti-inflammatory macrophages. HLA-G is important e.g. for maternal tolerance to the fetus, and for immunomodulation in particular adult tissues, such as in cornea, pancreatic islets, thymus and other. On the other hand, it is expressed in many solid and hematologic malignancies, where it contributes to evasion of the immune surveillance. HLA-G expression pattern in cancer is an important prognostic factor regarding a poor clinical outcome. Unlike most other MHC glycoproteins, HLA-G acts as an immune checkpoint molecule rather than as an antigen presenting molecule. It concerns both transmembrane and soluble HLA-G isoforms. Among other, HLA-G can promote Th2 immunological response and downregulate Th1 immunological response. For its benefits regarding allograft tolerance, including embryo implantation, soluble HLA-G (sHLA-G) can be used as a marker of developmental potential of embryos during the process of in vitro fertilization. Similarly, sHLA-G concentrations in maternal serum are decreased in preeclampsia. Transplanted patients with increased sHLA-G serum levels have improved allograft acceptance. On the other hand, increased sHLA-G can also indicate presence of malignant (sometimes also of benign) tumor cells. Another important topic is induction of HLA-G expression (sometimes associated with shedding of HLA-G from the cell surface) by some anti-cancer or anti-viral therapies, which can weaken the therapy effect. Monitoring of HLA-G in patients thus has a wide usage.SpecificityThe antibody MBH90AB recognizes the epitope EEEVE within N-terminal part of ubiquitously expressed Hsp90 alpha and Hsp90 beta intracellular proteins with calculated Mw of 84.7 kDa and 83.3 kDa, respectively, however, migrating as 90 kDa bands under reducing SDS-PAGE conditions.Application detailsFlow cytometry: Recommended dilution: 1-4 ?g/ml. Intracellular staining. <br>Immunohistochemistry (frozen sections): Recommended dilution: 10 ?g/ml; positive tissue: placenta.<br>Immunohistochemistry (paraffin sections): Recommended dilution: 10 ?g/ml; positive tissue: placenta. <br>ELISA: Positive control: HeLa/HLA-G5 transfectants cell lysate, HeLa/HLA-G5 cell supernatant; negative control: HeLa cell lysate. The antibody 5A6G7 has been tested as the capture antibody in a sandwich ELISA for analysis of soluble HLA-G in combination with antibody W6/32 (cat. no. 1B-422-C100). <br>Western blotting: Positive control: JEG-3 cell lysate, reducing conditions, 12% AA SDS-PAGE.
Antibody Isotype:
IgG1
Monosan Range:
MONOSAN
Clone:
5A6G7
Concentration:
1 mg/ml
Format:
Purified by protein-A affinity chromatography.
Storage buffer:
Phosphate buffered saline (PBS), pH 7.4, 15 mM sodium azide
X63-saporin is an antibody conjugate comprising of the non-specific monoclonal IgG1 antibody X63, chemically conjugated via a reducible disulfide bridge to the ribosome-inactivating protein saporin, purified from saponaria officinalis . Antibody clone X63 has no known binding ability, and thus can be used as negative control antibody. In combination with saporin, X63-saporin is a useful negative control for targeting IgG 1 -saporin conjugates such as MC192-saporin.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized from a 1 mg/mL solution containing PBS pH 7.2-7.6 without preservative.
Host Animal:
Mouse
Species Reactivity:
Non-Reactive (Negative Control)
Immunogen:
Unknown, naturally isolated IgG that has no known binding target in mammals
Applications:
Negative Control
Clone number:
X63
Antibody Isotype:
IgG1, kappa
Application Details:
Negative control for targeting IgG1-saporin conjugates., for instance MC192-saporin. X63-saporin should be used at a concentration equal to that of the test antibody-saporin conjugate.
Biological Activity:
None. Routinely tested for absence of killing of rat C6 cells in vitro. Note that the primary use of X63-saporin is for in vivo applications.
Biosensis Brand:
Biosensis®
Conjugate:
Saporin
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Specificity:
No staining has ever been identified with this immunoglobulin demonstrating its non-specific value as a control.
Storage:
Lyophilized product is shipped at ambient room temperature. Upon receipt, pulse-centrifuge the vial to collect solid that may be entrapped in the lid. After reconstitution, immediately prepare aliquots and keep the undiluted stock at -80°C for long-term storage. Avoid repeated thaw-freezing. For short-term storage, keep at 2-8°C for up to 2 weeks. it is recommended to handle this product under sterile conditions.
Purification:
Conjugate was purified by ion-exchange chromatography. Purity > 90% by non-reducing SDS-PAGE
> 90% based on SDS-PAGE Small amounts of intact IgG may be present.
Host:
Goat
Immunogen:
Purified Rat IgG, whole molecule
Buffer:
30 mM Triethanolamine, pH 7.2, 5 mM Magnesium Chloride, 0.1 mM Zinc Chloride, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
Store undiluted liquid at 2-8 °C. For storage at -20 °C, dilute with an equal volume of glycerol to prevent loss of enzymatic activity. Prepare working dilutions prior to use and then discard.
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on rat IgG · light chains on all rat immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins · IgG from human or mouse · highly cross absorbed against mouse IgG
Country Of Origin:
Goat serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified using solid phase Human Kappa (к) Chain
Purity:
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Goat
Immunogen:
Purified Human kappa (к) light chain
Buffer:
PBS, 1% BSA
Preservative:
0.1% proclin 150
Reconstitution:
Rehydrate with 0.55 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, dilute with 50% glycerol and store at -20 °C as a liquid.
Specificity:
Based on IEP, this antibody reacts with: · kappa (к) light chains on all human immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin human serum immunoglobulins · heavy chains on all human immunoglobulins · lambda (λ) light chains on all human immunoglobulins · mouse serum proteins
Country Of Origin:
Goat serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Human serum albumin (65-67 kDa) is the most abundant protein in human blood plasma (produced in the liver). It has a serum half-life of approximately 20 days.
Antibody Isotype:
IgG1
Monosan Range:
MONOSAN
Clone:
AL-01
Conjugate:
Biotin
Concentration:
1 mg/ml
Storage buffer:
Phosphate buffered saline (PBS) solution with 15 mM sodium azide
CD15 (Lewis X, Le(x); stage specific embryonic antigen-1, SSEA-1) is a trisacharide determinant (3-fucosyl-N-acetyllactosamine) expressed on several glycolipids, glycoproteins and proteoglycans of various cell types, e.g. granulocytes, mast cells, monocytes, macrophages, cells of gastric mucosa, nervous system or various tumour cells.
The Tyrosine Hydroxylase antiserum was quality control tested using standard immunohistochemical methods. The antiserum demonstrates strongly positive labeling of rat catecholamine neuron systems using indirect immunofluorescent and biotin/avidin-HRP techniques. Recommended primary dilutions for these methods are provided below. This antibody does not cross react with dihydropterdine reductase, dopamine-B-hydroxylase, phenylethanolamine-N-methyltransferase, phenylalanine hydroxylase or tryptophan hydroxylase using Western blot methods.
> 90% based on SDS-PAGE Small amounts of intact IgG may be present.
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 0.55 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, rabbit, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Methylated Lysine is involved in post-translational modifications of proteins which play a critical role in the regulation and function of many known biological processes. Proteins can be post-translationally modified in many different ways, and a common post-transcriptional modification of Lysine involves methylation.This antibody is conjugated to APC (allophycocyanin).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C for 1 year; make aliquots to avoid repeated freeze-thaw cycles.
Host Animal:
Rabbit
Species Reactivity:
Detects proteins containing methylated lysine residues in all specias
Immunogen:
KLH-conjugated methylated lysine
Applications:
ELISA (ELISA), Immunohistochemistry (IHC), Immunoprecipitation (IP), Western blot (WB)
Sub1C is a protein which is involved in rice tolerance to submergence.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Oryza sativa
Expected Species:
Oryza sativa
Immunogen:
KLH-conjugated synthetic peptide derived from Oryza sativa Sub1C. Chosen peptide is convered in all 6 isoforms (C-1 to C-6).
α-Amylases are hydrolytic enzymes responsible for the mobilization of the starch into metabolizable sugars. This process provides the energy for the growth of roots and shoots and is crucial during germination of cereal seeds.These enzymes are coded by a multigene family and even thought other amylolytic enzyme participate in the process of starch breakdown, the contribution of α-amylase is the prerequisite for the initiation of this process. Ramy3D is one of the alpha amylases genes in the rice multigene family (Huang et al. Nucleic Acid Research 1990).Synonymes:1,4-alpha-D-glucan glucanohydrolase
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Oryza sativa
Immunogen:
KLH-conjugated synthetic peptide derived from known Oryza sativa P27933
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Ye et al. (2018). Natural variation in the promoter of rice calcineurin B-like protein10 (OsCBL10) affects flooding tolerance during seed germination among rice subspecies. Plant J. 2018 May;94(4):612-625. doi: 10.1111/tpj.13881.Ho et al. (2017). A calcineurin B-like protein participates in low oxygen signalling in rice. CSIRO PUBLISHING Functional Plant Biology.
UCP (uncoupling protein) is an inner membrane mitochondrial protein that can dissipate the proton gradien before it can be used to provide the energy for oxidative phosphorylation. Synonymes: AtUCP, Uncoupling protein 2.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Czobor et al. (2019). Comparison of the response of alternative oxidase and uncoupling proteins to bacterial elicitor induced oxidative burst. PLoS One. 2019 Jan 10;14(1):e0210592. doi: 10.1371/journal.pone.0210592.Tak č et al. (2018). Shot-Gun Proteomic Analysis on Roots of Arabidopsis pldα1 Mutants Suggesting the Involvement of PLDα1 in Mitochondrial Protein Import, Vesicular Trafficking and Glucosinolate Biosynthesis. Int J Mol Sci. 2018 Dec 26;20(1). pii: E82. doi: 10.3390/ijms20010082. (immunolocalization)Garmash et al. (2017). Expression profiles of genes for mitochondrial respiratory energy-dissipating systems and antioxidant enzymes in wheat leaves during de-etiolation. J Plant Physiol. 2017 Aug;215:110-121. doi: 10.1016/j.jplph.2017.05.023.Florez-Sarasa et al. (2016). Impaired cyclic electron flow around Photosystem I disturbs high-light respiratory metabolism. Plant Physiol. 2016 Oct 19. pii: pp.01025.2016.Liu et al. (2015). Silencing of mitochondrial uncoupling protein gene aggravates chilling stress by altering mitochondrial respiration and electron transport in tomato. Acta Physiologiae Plantarum November 2015, 37:223.Long et al. (2015). Contributions of photosynthetic and non-photosynthetic cell types to leaf respiration in Vicia faba L. and their responses to growth temperature. Plant Cell Environ. 2015 Apr 1. doi: 10.1111/pce.12544.Grabelnych et al. (2014). Mitochondrial Energy Dissipating Systems (Alternative Oxidase, Uncoupling Proteins, and External NADH Dehydrogenase) Are Involved in Development of Frost Resistance of Winter Wheat Seedlings. ISSN 0006 2979, Biochemistry (Moscow), 2014, Vol. 79, No. 6, pp. 506 519. Pleiades Publishing, Ltd., 2014.Barreto et al. (2014). Overexpression of UCP1 in tobacco induces mitochondrial biogenesis and amplifies a broad stress response. BMC Plant Biol. 2014 May 28;14(1):144.
Special application note:
Peptide used to elicit this antibody is conserved in both isoforms, UCP1 and UCP2 of Arabidopsis thaliana.
AKT1 is a highly selective inward-rectifying potassium channel located in cell membrane, that mediates potassium uptake by plant roots in response to low potassium conditions.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Arabidopsis thaliana
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana AKT1 Q38998 , At2g26650
In the work of Honsbein et al, 125I has been used for detection of KC1 since this was the only way to get enough signal after 2-phase partitioning, ECL+ has been used with the protein after expression in Sf9 insect cells (1: 1000 primary antibody dilution) and in yeast with no problem (single band detected), but these are relatively high expression systems, In native plant material ion channels are expressed in ridiculously small quantities (a few hundred proteins per cell)
Application Details:
1 : 50 with 125I (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 100 l of sterile water
Molecular Weight:
96,9 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Safiarian et al. (2015). Lost in traffic? The K+ channel of lily pollen, LilKT1, is detected at the endomembranes inside yeast cells, tobacco leaves and lily pollen. Front. Plant Sci. | doi: 10.3389/fpls.2015.00047.Honsbein et al. (2009). A tripartite SNARE-K+ channel complex mediates in channel-dependent K+ nutrition in Arabidopsis. The Plant Cell 21:2859-2877.
Special application note:
For detection images please, refer to the publication belowAntibody detects native and recombinant AKT1
Heat-shock protein 70 (Hsp70) is the major stress-inducible protein in vertebrates and highly conserved throughout evolution. It plays a role as a molecular chaperone and is important for allowing cells to cope with acute stressor insult, especially those affecting the protein machinery.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
KLH-conjugated synthetic peptide chosen from the C-terminal of salmonid hsp70. The target peptide is a sequence specific to salmonid hsp70 UniProt: B5X4Z3.
Applications:
Immunohistochemistry (IHC), Immunoprecipitation (IP), Western blot (WB)
This antibody is recognizing the inducible Hsp70 in salmon but not the constitutive
Application Details:
5 g of antibodies in reaction mixture (IP), 1 : 100 (IHC), 1 : 15 000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 200 l of sterile water
Molecular Weight:
70 kDa
Not reactive in:
Gasterosteus aculeatus
Selected references:
Mottola et al. (2020). Comp Biochem Physiol A Mol Integr Physiol. 2020 Feb;240:110629. doi: 10.1016/j.cbpa.2019.110629. Gallant el al. (2017). Physiological responses to a short-term, environmentally realistic, acute heat stress in Atlantic salmon, Salmo salar. FACETS.Lewis et al. (2016). Different Relationship between hsp70 mRNA and hsp70 Levels in the Heat Shock Response of Two Salmonids with Dissimilar Temperature Preference. Front Physiol. 2016 Nov 7;7:511. eCollection 2016.Curie et al. (2008). β‐Adrenergic Stimulation Enhances the Heat‐Shock Response in Fish. Physiol & Bioch. Zoology 4:414-425.
Special application note:
Immunohistochemistry experiments have been done on salmon tissue treated with hydrated autoclaving of formalin fixed sections (unpublished results)
Saccharomyces cerevisiae Rnr3 is catalyzing the biosynthesis of deoxyribonucelaotides. Alternative names: Ribonucleotide reductase large subunit 2, ribonucleotide reductase DNA damage-inducible regulatory subunit 2, ribonucleotide reductase R1 subunit 2
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Saccharomyces cerevisiae
Immunogen:
KLH-conjugated synthetic peptide derived from Saccharomyces cerevisiae Rnr3 protein sequence UniProt: P21672
Load per well was approx 3x10^6 cells (of a total extract)
Application Details:
1 : 500-1 : 1000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 100 µl of sterile water
Molecular Weight:
97,5 | 98 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Ajazi et al. (2021) Endosomal trafficking and DNA damage checkpoint kinases dictate survival to replication stress by regulating amino acid uptake and protein synthesis. Dev Cell. 2021 Sep 27;56(18):2607-2622.e6. doi: 10.1016/j.devcel.2021.08.019. Epub 2021 Sep 16. PMID: 34534458.Cerritelli et al. (2020). High density of unrepaired genomic ribonucleotides leads to Topoisomerase 1-mediated severe growth defects in absence of ribonucleotide reductase. Nucleic Acids Res Sampaio-Marques et al. (2019). ?-Synuclein toxicity in yeast and human cells is caused by cell cycle re-entry and autophagy degradation of ribonucleotide reductase 1. Aging Cell. 2019 Aug;18(4):e12922. doi: 10.1111/acel.12922.Schmidt et al. (2019). Inactivation of folylpolyglutamate synthetase Met7 results in genome instability driven by an increased dUTP/dTTP ratio. Nucleic Acids Res. 2019 Oct 24. pii: gkz1006. doi: 10.1093/nar/gkz1006.Lafuente-Barquero et al. (2017). The Smc5/6 complex regulates the yeast Mph1 helicase at RNA-DNA hybrid-mediated DNA damage. PLOS Genetics, December 27, 2017, doi.org/10.1371/journal.pgen.1007136
BiP2 (Binding immunoglobulin protein) is localized in endoplasmic reticulum lumen (ER) and plays a role in protein assembly inside ER. BiP protein is abundant under all growth conditions but its synthesis can increase under conditions that lead to the accumulation of unfolded polypeptides in endoplasmic reticulum (ER). Alternative name: AtBP2
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Hordeum vulgare, Nicotiana tabacum, Oryza sativa, Picea sitchensis, Populus trichocarpa, Physcomitrium patens, Spinacia oleracea, Zea maysSpecies of your interest not listed? Contact us
Protein or membrane sample should be treated at 70 C for 10 min before loading on the gel.Antibody has a reduced reactivity to monocots in western blot.
Application Details:
1 : 2000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 100 µl of sterile water
Molecular Weight:
73,5 | 80 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Narusaka et al (2016). Leucine zipper motif in RRS1 is crucial for the regulation of Arabidopsis dual resistance protein complex RPS4/RRS1. Sci Rep. 2016 Jan 11;6:18702. doi: 10.1038/srep18702.
BiP2 (Binding immunoglobulin protein) is localized in endoplasmic reticulum lumen (ER) and plays a role in protein assembly inside ER. BiP protein is abundant under all growth conditions but its synthesis can increase under conditions that lead to the accumulation of unfolded polypeptides in endoplasmic reticulum (ER). Alternative name: AtBP2
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4 C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Nicotiana tabacum, Oryza sativa, Physcomitrium patens, Piea sitchensis, Populus trichocarpa, Spinacia oleracea, Zea mays Species of your interest not listed? Contact us
Protein or membrane sample should be treated at 70 C for 10 min before loading on the gel
Application Details:
1 : 50-1 : 1000 (IF), 1 : 2000 (WB)
Purity:
Immunogen affinity purified total IgY. in PBS pH 7.4.
Molecular Weight:
73,5 | 80 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Bennett et al. (2014). Plasma Membrane-Targeted PIN Proteins Drive Shoot Development in a Moss. Curr Biol. 2014 Dec 1;24(23):2776-85. doi: 10.1016/j.cub.2014.09.054. Epub 2014 Nov 13.
Special application note:
Antibody solution contains 0,02% sodium azide as preservative
c-Myc is derived from Myc proto-oncogene protein. A short peptide located between amino acids 408-420 is used as an epitope tag, that is easily recognized by tag specific antibodies. This is a universal detection reagent which will allow detection of any tag containing protein.This antibody is directly conjugated to Biotin.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized antibodies at -20 °C and reconstituted antibodies at 4°C. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
c-Myc
Expected Species:
c-Myc
Immunogen:
KLH-conjugated peptide, sequence MEQKLISEEDLNE, human c-Myc UniProt: Q6LBK7
AKIN beta-1 (AKINB1) is a member of SnRK1/SNF1/AMPK family in plants. It is a regulatory subunit of the putative trimeric SNF1-related protein kinase (SnRK) comples which may play a role in a signal transduction cascade regulating gene expression and carbohydrate metabolism in higher plants.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Arabidopsis thaliana
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana AKIN beta-1 Q84VQ1, At5g21170
Belda-Palaz n et al. (2020) A dual function of SnRK2 kinases in the regulation of SnRK1 and plant growth. Nat Plants. 2020 Nov;6(11):1345-1353. doi: 10.1038/s41477-020-00778-w. Epub 2020 Oct 19. PMID: 33077877.Crozet et al. (2016). SUMOylation represses SnRK1 signaling in Arabidopsis. Plant J. 2016 Jan;85(1):120-133. doi: 10.1111/tpj.13096.Emanuelle et al. (2015). SnRK1 from Arabidopsis thaliana is an atypical AMPK. Plant J. 2015 Mar 3. doi: 10.1111/tpj.12813.
KC1 is a regulatory K+ channel subunit that assembles with different inward-rectifying K+ channels to affect their activities. The protein is expressed in extremely low amounts, e.g. a few houndred per cell. Alternative names: AKT4, AtKC1, potassium channel TKC
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Arabidopsis thaliana
Immunogen:
KLH-conjugated peptide derived from Arabidopsis thaliana KC1 protein P92960, At4g32650
In the work of Honsbein et al, 125I has been used for detection of KC1 since this was the only way to get enough signal after 2-phase partitioning, ECL+ has been used with the protein after expression in Sf9 insect cells (1: 1000 primary antibody dilution) and in yeast with no problem (single band detected), but these are relatively high expression systems, In native plant material ion channels are expressed in ridiculously small quantities (a few hundred proteins per cell)
Application Details:
1 : 50 with 125I (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 100 l of sterile water
Molecular Weight:
75,5 | 75 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Honsbein et al. (2009). A tripartite SNARE-K+ channel complex mediates in channel-dependent K+ nutrition in Arabidopsis. The Plant Cell 21:2859-2877.
Special application note:
For detection images please, refer to the publication belowAntibody detects native and recombinant KC1
Exoenzyme S (ExoS) is a toxin directly translocated into eukaryotic cells by the type III secretory process of Pseudomonas aeruginosa. It is a bi-functional toxin and contain an N-terminal Rho GAP domain that disrupts the actin cytoskeleton and interference of phagocytosis. The C-terminal of ExoS contains an ADP-ribosyltransferase domain, which elicits a cytotoxic phenotype in cultured cells.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4 C; make aliquots to avoid working with a stock. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
Pseudomonas aeruginosa
Expected Species:
Pseudomonas aeruginosa
Immunogen:
amino acids 366 to 453 of PA3841 of ADP-rbosylating enzyme - Exoenzyme S overexpressed in a GST fusion. Afterwards cleaved with a help of trombin and separated on a polyacrylamide gel. Gel piece has been used for immunizations.
Purified, total IgY (chicken egg yolk immunoglobulin) in PBS pH 8. Contains 0.02 % sodium azide.
Molecular Weight:
48 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Feng et al. (2019: Tanshinones: First-in-Class Inhibitors of the Biogenesis of the Type 3 Secretion System Needle of Pseudomonas aeruginosa for Antibiotic Therapy. ACS Cent. Sci.2019.Anantharajah et al. (2017). Salicylidene acylhydrazides and hydroxyquinolines act as inhibitors of type three secretion systems in Pseudomonas aeruginosa by distinct mechanisms. Antimicrob Agents Chemother. 2017 Apr 10. pii: AAC.02566-16. doi: 10.1128/AAC.02566-16.Anantharajah et al. (2016). Inhibition of the Injectisome and Flagellar Type III Secretion Systems by INP1855 Impairs Pseudomonas aeruginosa Pathogenicity and Inflammasome Activation. J Infect Dis. 2016 Jul 13. pii: jiw295.
hMSCs have emerged as a promising regenerative tool, owing mainly to their multi-differentiation potential and immunosuppressive capacity. MSCs of neonatal origins exhibit superior proliferation ability, lower immunogenicity, and are expected to show lower incorporated mutation. hMSCs are isolated from three neonatal tissues, namely amniotic membrane, Chorion Villi, and Decidua tissue of the human placenta from the same donor.
Email us for more details - tech@nktscientific.com.
Background Info:
Product Quality Control:
Rigid quality control testing is performed for each batch (both cell donors and cell cultures). Cultured cells are tested for cell identity, purity, potency, viability and suitability for the intended use.
Before cryopreservation cultured MSCs (P2-P3) are characterised by flow cytometry analysis for identity by a comprehensive panel of markers [CD73/CD90/CD105 (positive) and CD14/CD34/CD45/HLA-DR (negative)] as proposed by the ISCTMSC committee position statement, 2006.
A multilineage differentiation assay into adipogenic and osteogenic directions is performed for each MSCs batch expanded in vitro. In addition, all donors and cell cultures have been screened for the absence of the following infectious agents: HIV-1/2, HBV, HCV, HSV1, HSV2, CMV, EBV, HHV6, Treponema pallidum, Toxoplasmagondii, Chlamydia trachomatis, Ureaplasma urealyticum, Ureaplasma parvum and microbial contaminants (bacteria & fungi,Mycoplasma hominis and Mycoplasma genitalium).
MSC cultures genetic stability is verified by karyotype evaluation (GTG banding).
hMSCs from adipose tissue (hADSCs) hADSCs have been shown to differentiate in vitro or in vivo into adipocytes, chondrocytes, osteoblasts, myocytes, neurons, hepatocytes, and pancreatic islet cells. hADSCs are harvested from normal human adipose tissue from individual donors and are provided in a cryopreserved format. The cells are tested for their ability to differentiate in vitro into adipocytes, chondrocytes, and osteoblasts and for a verified marker expression profile that complies with ISCT recommendations, providing well characterized cells.
Email us for more details - tech@nktscientific.com.
Background Info:
Product Quality Control:
Rigid quality control testing is performed for each batch (both cell donors and cell cultures). Cultured cells are tested for cell identity, purity, potency, viability and suitability for the intended use.
Before cryopreservation cultured MSCs (P2-P3) are characterised by flow cytometry analysis for identity by a comprehensive panel of markers [CD73/CD90/CD105 (positive) and CD14/CD34/CD45/HLA-DR (negative)] as proposed by the ISCTMSC committee position statement, 2006.
A multilineage differentiation assay into adipogenic and osteogenic directions is performed for each MSCs batch expanded in vitro. In addition, all donors and cell cultures have been screened for the absence of the following infectious agents: HIV-1/2, HBV, HCV, HSV1, HSV2, CMV, EBV, HHV6, Treponema pallidum, Toxoplasmagondii, Chlamydia trachomatis, Ureaplasma urealyticum, Ureaplasma parvum and microbial contaminants (bacteria & fungi,Mycoplasma hominis and Mycoplasma genitalium).
MSC cultures genetic stability is verified by karyotype evaluation (GTG banding).
Bcl-2 is a member of a family of proteins that are involved in apoptosis. Bcl-2 is an integral inner mitochondrial membrane protein of 25 kD and has a wide tissue distribution. It is considered to act as an inhibitor of apoptosis. For this reason, bcl-2 expression is inhibited in germinal centers where apoptosis forms part of the B cell production pathway.
Antibody Isotype:
IgG1
Monosan Range:
MONXtra
Clone:
bcl-2/100/D5
Concentration:
Greater than or equal to 56 mg/L
Storage buffer:
Tissue culture supernatant with sodium azide
Storage:
2-8°C
References 1:
Von Haefen C et al. Oncogene. 2002; 21(25):4009-4019
References 2:
Takes RP et al.Journal of Pathology. 2001; 194:298-302
References 3:
Tweddle DA et al. American Journal of Pathology. 2001; 158(6): 2067-2077
References 4:
Ramani P et al. Journal of Pathology. 1994; 172:273-278
References 5:
Pezzella F et al. American Journal of Pathology. 1990; 137(2):225-232
Immunostaining with anti-myoglobin provides a specific, sensitive, and practical procedure for the identification of tumors of muscle origin. Since myoglobin is found exclusively in skeletal and cardiac muscle and is not present in any other cells of the human body, it may be used to distinguish rhabdomyosarcoma from other soft tissue tumors.
Monosan Range:
MONOSAN
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Mukai K, et al. Am J Surg Pathol. 1979; 3:373-6
References 2:
Corson JM, et al.Am J Pathol. 1981; 103:384-9
References 3:
Brooks JJ. Cancer. 1982; 50:1757-63
References 4:
Furlong MA, et al. Ann Diagn Pathol. 2001; 5:199-206
Apop's suite of CalRexin (TM) imaging reagents have been designed for imaging stressed, dying and apoptotic cells. They are monoclonal antibody fluorophore conjugates that target an epitope in the extracellular domain of the human calcitonin receptor (CT receptor), a novel marker of cell stress/autophagy and pre-apoptotic cell stress/apoptosis. They recognise and bind an epitope that is common to both C1a and C1b isoforms of the human calcitonin receptor, a membrane protein with seven transmembrane domains that is coupled to G protein messenger systems. The calcitonin receptor has been identified in a broad range of tissues throughout the life cycle of an organism as well as in diseased, stressed and damaged tissues. CalRexin (TM):fluorophore is accumulated into live cells and is designed for live cell assays.
Advantages: Simple to use High sensitivity, detect sub-populations in FACS of dying cells Enhanced stability (> 1 yr) Multiple applications (FACS, Operetta, confocal microscopy) Calcium independence for assays No false positives vs Annexin
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
200 µg in 200 µL PBS Purified, 1 mg/mL in phosphate buffered saline (PBS), sterile filtered
Host Animal:
Mouse
Species Reactivity:
Human cells and cell lines
Immunogen:
Synthetic peptide derived from sequence situated in the N-terminal domain of human calcitonin receptor.
For use in live cell assays to study pre-apoptotic stress and events leading to apoptosis. Flow Cytometry (1:500) Immunocytochemistry Live* (1:500) *Note that cells undergoing programmed cell death must be unfixed during the stain but may be fixed thereafter. ELISA (1:5000/50% colour) Immunoblotting (1:100)
UK:
447
WEBLIST PRICE 2022 USD:
650
GBP Equivalent price at 1.3:
358
Distributor_Net_Purchase_Price_2022_USD:
455
Price to us in GBP:
250.25
Profit:
196.75
Alternative Names:
Monoclonal antibody mAb2C4 conjugated with TFP esters:AZ568 The name given to mAb2C4 is CalRexin (TM)
Shelf Life:
Short term storage (12 months) at 4-6?C
Storage:
Storage for 12 months at 4-6?C after filter sterilization. Do not freeze. Prepare working dilutions on day of use.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Rabbit
Immunogen:
Purified Human IgM (µ chain)
Buffer:
PBS, 1% BSA & 0.1% proclin 150
Preservative:
0.1% (v/v) Kathon CG
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, dilute with 50% glycerol and store at -20 °C as a liquid.
Specificity:
Based on IEP, this antibody reacts with: · heavy (µ) chains on human IgM
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin human serum immunoglobulins · light chains on all human immunoglobulins
Country Of Origin:
Rabbit serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Rabbit
Immunogen:
Purified Human IgM (µ chain)
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
2-8 °C
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (µ) chains on human IgM
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin human serum immunoglobulins · light chains on all human immunoglobulins
Country Of Origin:
Rabbit serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Cytokeratins 8 &18 (CK 8 & 18) are expressed in most simple epithelia (e.g. thyroid, breast, gastrointestinal tract, and respiratory tract). Anti-CK 8 & 18 have been reported to stain most adenocarcinomas and squamous cell carcinomas, but not some well-differentiated squamous cell carcinomas. Cytokeratin 8 & 18 have been reported to be useful markers for identifying Paget cells, colorectal carcinoma metastases,5 and gastric cancer micro metastases.
Antibody Isotype:
IgG1
Monosan Range:
MONOSAN Ready To Use
Clone:
B22.1&B23.1
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Angus B, et al. J Pathol. 1987; 155:377-84
References 2:
Corson, JM. Pathol Annu. 1986; 21:47-81
References 3:
Moll R, et al. Histochem Cell Biol. 2008; 129:705-33
CD23 is a 45 kDa glycoprotein which is present on a subpopulation of freshly isolated peripheral blood and tonsil B cells and strongly expressed on EBV-transformed B lymphoblasts. The CD23 molecule is identical to the low affinity IgE receptor found on B cells. Expression of CD23 has been detected in neoplastic cells from cases of B cell chronic lymphocyctic leukaemia and some cases of centroblastic/centrocytic lymphoma. CD23 is present on a subpopulation of freshly isolated peripheral blood and tonsil B cells and strongly expressed on EBV-transformed B lymphoblasts.
CD38 (NAD+ glycohydrolase) is a type II transmembrane glycoprotein able to induce activation, proliferation and differentiation of mature lymphocytes and mediate apoptosis of myeloid and lymphoid progenitor cells. CD38 functions as a multi-catalytic ectoenzyme serving as ADP-ribosyl cyclase, cyclic ADP-ribose hydrolase and possibly NAD+ glycohydrolase or as a cell surface receptor. Antibodies to CD38 are useful in subtyping of lymphomas and leukemias, detection of plasma cells (i.e. identification of myelomas), and as a marker for activated B and T cells.
CD19 is a member of the immunoglobulin superfamily and has two Ig like domains. The CD19 molecule is expressed on 100% of the peripheral B cells as defined by expression of kappa or lambda light chains. CD19 appears to be expressed on myeloid leukemia cells, particularly those of monocytic lineage. Leukemia phenotype studies have demonstrated that the earliest and broadest B cell restricted antigen is the CD19 antigen.
CD22 (BL-CAM) is a type 1 integral membrane glycoprotein with molecular weight of 130 to 140 kDa. CD22 is expressed in both the cytoplasm and cell membrane of B-lymphocytes. CD22 antigen appears early in B-cell lymphocyte differentiation at approximately the same stage as the CD19 antigen. Unlike other B-cell markers, CD22 membrane expression is limited to the late differentiation stages comprised between mature B cells (CD22+) and plasma cells (CD22-), and may thus prove useful in phenotyping mature leukemias.
Antibody Isotype:
IgG1
Monosan Range:
MONOSAN
Clone:
RFB4
Conjugate:
FITC
Concentration:
n/a
Storage buffer:
PBS with 4mg/ml BSA and 0.1% sodium azide
Storage:
2-8°C
References 1:
Bechanova V et al. Am Assoc for Cancer Res 2015
References 2:
Pantelyushin S et al. J of Int Soc for Anal Cytol. 2020
CD44 cell surface antigen is a 100 kDa type 1 transmembrane glycoprotein widely expressed on human leucocytes, white matter of the brain and by some epithelial cells of the intestine and breast. Several isoforms of CD44 exist, including the predominant CD44H isoform detected in many normal tissues. CD44 is a receptor for hyaluronic acid (HA) and is involved in cell-cell interactions, cell adhesion and migration. CD44 also participates in a wide variety of cellular functions including lymphocyte activation, recirculation and homing.
MART-1 (also known as Melan A) is a melanocyte differentiation antigen. MART-1 is a transmembrane protein present in melanocytes of normal skin, retina, nevi, and most melanomas. MART-1 is a very useful marker for identifying metastatic melanomas.
Antibody Isotype:
IgG1
Monosan Range:
MONOSAN
Clone:
A103
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Kageshita T et al. J Immunother 1997 Nov;20(6):460-5
References 2:
Yaziji H, et al. In J Surg Pathol. 2003 Jan;11(1):11-5
References 3:
Mocellin S et al. J Immunother. 2001 Nov-Dec;24(6):447-58
References 4:
Perez RP et al. Hum Pathol. 2000 Nov;31(11):1381-8
References 5:
Hoang MP et al. J Cutan Pathol. 2001 Sep;28(8):400-6
The monoclonal antibody 52B83 reacts with tumor necrosis factor alpha (TNF-alpha). TNF-alpha is a homotrimeric 17 kDa protein, that interacts with either one of the two types of TNF-receptors, termed I and II, leading to receptor cross-linking and signal transduction. The receptors differ strongly in their intra-cellular signaling pathways.<br /> TNF-alpha was originally described as a highly cytotoxic cytokine for tumor cells, it causes tumor necrosis in vivo and shows cytolytic activity against tumor cells in vitro. Furthermore,- TNF-alpha is found to be a central mediator in many inflammatory and immunological processes. It can be induced by various products of micro-organisms and by various cytokines leading to expression of a wide variety of- cytokines. The pro-inflammatory properties of- TNF-alpha play a central role in several auto-immune diseases such as rheumatoid arthritis and inhibition by neutralizing molecules have been shown to be beneficial in patients.
Antibody Isotype:
IgG1
Monosan Range:
MONOSAN
Clone:
52B83
Concentration:
100 ug/ ml
Storage buffer:
PBS with 0.1% BSA and 0.02% sodium azide
Storage:
2-8°C
References 1:
Bradding; P et al. Am J Respir Cell Mol Biol 1994; 10: 471
References 2:
Bradding, P et al: Clin Exp Allergy 1995, 25: 406
References 3:
Gerspach; J et al. Microsc Res Tech 2000; 50: 243
References 4:
Laan van der N et al. Arch Dermatol Res 2001; 293: 226
The monoclonal antibody 266-6K1 recognizes human myeloperoxidase (MPO), an ~135 glycoprotein expressed in all cells of the myeloid linage. MPO functions as an ?2β2 heteromultimer consisting of two heavy (?) and two light (β) chains of 55 and 15 kDa respectively. MPO is abundantly present in azurophilic granules of polymorphonuclear neutrophils (PMNs). It is an important enzyme used during phagocytic lysis of engulfed foreign particles which takes part in the defense of the organism through production of hypochlorous acid (HOCl), a potent oxidant. In the stimulated PMN, MPO catalyzes the production of hypohalous acids, primarily hypochlorous acid in physiologic situations, and other toxic intermediates that greatly enhance PMN microbicidal activity. Upon activation of neutrophils, MPO can be rapidly released and as such useful in body fluids as marker for inflammatory status. Involvement of MPO has been described in numerous diseases such as atherosclerosis, lung cancer, Alzheimer's disease, inflammatory bowel disease and multiple sclerosis. Autoimmune antibodies to MPO (so called ANCA) are involved in Wegenerâs disease. Since the discovery of MPO deficiency, initially regarded as rare and restricted to patients suffering from severe infections, MPO has attracted more clinical attention.
Antibody Isotype:
IgG1
Monosan Range:
MONOSAN
Clone:
266-6K1
Concentration:
100 ug/ ml
Storage buffer:
PBS with 0.1% BSA and 0.02% sodium azide
Storage:
2-8°C
References 1:
La Rocca; G et al. Basic Res Cardiol 2009; 104: 307
The antibody reacts with free soluble (17 kDa) and membrane (26 kDa) human TNF-alpha. The antibody inhibits the biological activity of soluble and membrane TNF-alpha. The antibody can be a useful tool to discriminate between receptor bound soluble (17 kDa) and the membrane (26 kDa) form of TNF-alpha. For this purpose we recommend to use this antibody in combination with the anti-TNF-alpha antibody HM2024, which recognizes only soluble and membrane TNF-alpha, but not the receptor bound TNF-alpha.
The monoclonal antibody 25F9 recognises a protein of 86 kD on the cell surface and within the cytoplasm of mature macrophages. The antibody is associated with fully differentiated tissue macrophages both in normal and in diseased tissues, independently of the presence or absence of inflammation. The antigen is absent on freshly isolated monocytes and other blood cells. After 6 to 7 days culture human monocytes become positive. Some melanoma and carcinoma cell lines are also positive. Furthermore the monoclonal antibody 25F9 cross reacts with a subpopulation of macrophages of rhesus monkey, pig alveolar macrophages and Kupffer cells. The monoclonal antibody 25F9 is very useful for macrophage phenotyping.
Antibody Isotype:
IgG1
Monosan Range:
MONOSAN
Clone:
25F9
Concentration:
100 ug/ ml
Storage buffer:
PBS with 0.1% BSA and 0.02% sodium azide
Storage:
2-8°C
References 1:
Rosseau; S et al. Am J Physiol Lung Cell Mol Physiol 2000; 279: L25
The antibody reacts with free soluble (17 kDa) and membrane (26 kDa) human TNF-alpha. The antibody inhibits the biological activity of both forms. It does not react with receptor bound TNF-alpha. It can be a useful tool to discriminate between the membrane form of TNF expressed on producer cells and the proteolytically cleaved, soluble TNF-alpha bound to its cognate cell membrane receptors (TNF-RI and TNF-RII). For this purpose we recommend to use this antibody in combination with the anti-TNF-alpha antibody HM2026, which recognizes soluble, membrane and receptor bound TNF-alpha.
Monoclonal antibody MNA.1 (formerly known as 5D3-F7) recognizes human natural and recombinant monocyte chemotactic protein-1 (MCP-1). Monocyte chemotactic protein-1 (MCP-1) is a 11 kDa protein belonging to the CC subgroup of the chemokine superfamily, which stimulate the migration of monocytic cells. In contrast, the CXC chemokines predominantly activate polymorphonuclear leukocytes. The coordinated synthesis and release of MCP-1 plays a central role in both acute and chronic inflammatory processes by controlling the influx of phagocytic cells. Furthermore, their state of activation is in concert with primary inflammatory cytokines, such as IL-1, TNF-a, and IL-6. A selective accumulation of MCP-1 in the cerebrospinal fluid (CSF) of AIDS patients with cytomegalovirus encephalitis, but not with other opportunistic infections or primary lymphomas of the central nervous system , has been described. Furthermore, the chemotactic activity of MCP-1 on monocytic cells has been suggested to play a role in psoriasis, rheumatoid arthritis and atherosclerosis. No cross-reactivity of mAb MNA.1 with other cytokines has been detected.
The monoclonal antibody ECE.2 recognizes mouse monocyte chemoattractant protein 1 (MCP-1). The murine JE gene encodes the monocyte-specific cytokine monocyte chemotactic protein 1 (MCP- 1). MCP-1 is a CC chemokine of 76 amino acids (~11 kDa) and is chemotactic for monocytes and basophils but not neutrophils and eosinophils. MCP-1 is expressed by smooth muscle cells (SMC), macrophages, endothelial cells, keratinocytes and fibroblasts in response to inflammatory stimuli such as interleukin 1β and tumor necrosis factor ?. MCP-1 has been implicated in a variety of inflammatory processes, including inflammatory bowel disease, rheumatoid arthritis, asthma, nephritis, and parasitic and viral infections. MCP-1 antigen is not detected in the endothelium or SMC of normal arteries. MCP-1 has also been shown to exhibit biological activities other than chemotaxis. It can induce the proliferation and activation of killer cells known as CHAK (CC-Chemokine-activated killer) MCP-1 signals via the CCR2 receptor, and is critical for aneurysm formation because of its stability to recruit leukocytes. These leukocytes produce extracellular matrix-degrading MMPs, thereby inductin aortic remodelling and dilatation. Interleukin-6 is also involved in this amplification loop accelerating vascular inflammation. MCP-/- mice display significantly delayed wound re-epithelialization, and also delayed wound angiogenesis.
CD18 integrin beta 2 subunit is a 90 kDa type I transmembrane protein expressed on all leucocytes. CD18 can combine with integrin molecules CD11a-c to form heterodimers at the cell surface, and these heterodimers are known to participate in the process of cell adhesion as well as cell-surface mediated signaling. CD18 forms heterodimers with four types of CD11 molecule to constitute leukocyte (beta2) integrins: alphaLbeta2 (CD11a/CD18, LFA-1), alphaMbeta2 (CD11b/CD18, Mac-1, CR3), alphaXbeta2 (CD11c/CD18) and alphaDbeta2 (CD11d/CD18). In most cases, the response mediated by the integrin is a composite of the functions of its individual subunits, and these integrins are essential for proper leukocyte migration, mediating intercellular contacts.
Monosan Range:
MONOSAN
Clone:
CLB-LFA-1/1
Conjugate:
FITC
Concentration:
n/a
Storage buffer:
PBS with BSA and 0.1% sodium azide
Storage:
2-8°C
References 1:
Hajishengallis G et al. Clin.Diagn Lab.Immunol 2002
Monoclonal antibody FA6-152 recognizes human CD36 (88-kDa), a cell surface class B scavenger receptor, also known as thrombospondin receptor CD36 is a heavily N-glycosylated transmembrane protein of ~88 kDa with two short intracellular domains and a large extracellular domain. The protein is sensitive for neuroaminidase, resulting in a shift from 88 to 85 kDa. CD36 is expressed on platelets, mature monocytes and macrophages, microvascular endothelial cells, mammary endothelial cells, during stages of erythroid cell development and on some macrophage derived dendritic cells. The antibody recognizes adult and fetal monocytes, platelets and reticulocytes, but doesnât stain lymphocytes and granulocytes. Reactivity has also been found in small intestine, kidney, liver and thyroid. CD36 expression is primarily controlled by the transcription heterodimer PPARg-RXR (peroxisome proliferator-activated receptor-g-retinoid-X-receptor). CD36 is preferentially found within lipid rafts, which facilitates its association with receptors, signaling and adaptor molecules. It is a receptor and transporter of oxidized lipids and long chain fatty acids. CD36 has been implicated in many biological processes including angiogenesis, phagocytosis, inflammation, and lipid and glucose metabolism. Several in vivo models support the role of the thrombospondin / CD36 system in angiogenesis and tumor growth. An important role for CD36 has been found in Malaria as major receptor for P. falciparum-infected red blood cells. CD36 is associated with Src-family kinases and with the integrins ?3β1 and ?6β1. Recently, CD36 has been identified as a protein that is required for toll like receptor (TLR2) recognition of di-acylated bacterial lipopeptides and lipoteichoic acid4. Furthermore, CD36 has been shown to function as phagocytic receptor for apoptotic cells. Many different ligands have been reported to interact with CD36, suggesting that CD36 could recognize a structure-based domain rather than specific contact residues. Monoclonal antibody FA6-152 blocks the biological activity of CD36 by blocking collagen/thrombospondin binding. The antibody agglutinates fetal but not adult erythrocytes.
Antibody Isotype:
IgG1
Monosan Range:
MONOSAN
Clone:
FA6-152
Concentration:
100 ug/ ml
Storage buffer:
PBS with 0.1% BSA and 0.02% sodium azide
Storage:
2-8°C
References 1:
Edelman P et al. Blood 1986; 67: 56
References 2:
Kieffer N et al Biochem J 1989, 262: 835
References 3:
Thibert V et al. Thromb Haemost 1992; 68: 600
References 4:
Nakata A et al. Arterioscler Thromb Vasc Biol 1999; 19: 1333
The monoclonal antibody TLR3.7 recognizes the 116 kDa human Toll-like receptor 3 (TLR3, CD283). Toll-like receptors (TLRs) are highly conserved from Drosophila to humans and share structural and functional similarities. TLRs constitute of a family of pattern recognition receptors (PRRs) that mediate cellular responses to a large variety of pathogens (viruses, bacteria, and parasites) by specific recognition of so-called âpathogen-associated molecular patternsâ. Activation of TLRs, a family of at least 11 different members that function either as homo- or heterodimers, leads to activation of NFκBdependent and IFN-regulatory factor-dependent signaling pathways. TLRs have a central role in innate immunity and are also required for the development of an adaptive immune response. TLRs are expressed by various cells of the immune system, such as macrophages and dendritic cells. TLRs are class I receptors, with a single ?-helix that spans the cell membrane. They recognize and respond to molecules derived from bacterial, viral and fungal pathogens, such as lipopolysaccharide (LPS) from the outer membrane of Gram negative bacteria, peptidoglycan fragments from bacterial cell walls and single-stranded and double-stranded RNA from viruses.<br /> Some forms of RNA and DNA from pathogens exhibit immutable features that distinguish them from nucleic acids of higher organisms. For example, dsRNA, is a common intermediate of viral replication and a potent indicator of infection. Toll-like receptor 3 (TLR3) recognizes viral double-stranded RNA and its synthetic analog polyriboinosinic:polyribocytidylic acid (poly(I:C)). TLR3 is normally located in acidic endosomes where its luminal ectodomain (ECD) encounters dsRNA and induces type I interferon (IFN), inflammatory cytokine/chemokine production and dendritic cell (DC) maturation via the adaptor protein TICAM-1 (also called TRIF). Based on the different subcellular localization of cytosolic RNA receptors and TLR3, these receptors seem to play distinct roles in anti-viral immune responses.
Antibody Isotype:
IgG1
Monosan Range:
MONOSAN
Clone:
TLR3.7
Concentration:
100 ug/ ml
Storage buffer:
PBS with 0.1% BSA and 0.02% sodium azide
Storage:
2-8°C
References 1:
Matsumoto; M et al. Biochem Biophys Res Commun 2002; 293: 1364
References 2:
Oshiumi, H et al Nat Immunol 2003, 4: 161
References 3:
Matsumoto; M et al. J Immunol 2003; 171: 3154
References 4:
Burgener I et al. Vet Immunol Immunopathol 2008; 124
Toll-like receptors (TLR) are highly conserved throughout evolution and have been implicated in the innate defense to many pathogens. In Drosophila, toll is required for the anti-fungal response, while the related 18-wheeler is involved in antibacterial defenses. In mammals, TLR identified as type I transmembrane signaling receptors with pattern recognition capabilities, have been implicated in the innate host defense to pathogens. TLR2 has been identified as a receptor that is central to the innate immune response to lipoproteins of Gram-negative bacteria, several whole Gram-positive bacteria, as well as a receptor for peptidoglycan and lipoteichoic acid and other bacterial cell membrane products. A functional interaction between TLR2 and TLR6 in the cellular response to various bacterial products has been discovered. The currently accepted paradigm regards TLR2 as an essential receptor for many eubacterial cell wall components, including lipoproteins and peptidoglycan. Bacterial species as diverse as mycobacteria, spirochetes, mycoplasma, Staphylococcus aureus, and Streptococcus pneumoniae have all been shown to mediate cellular activation via TLR2 (CD282). The monoclonal antibody TL2.3 is specific for human TLR2 (CD282). TL2.3 is useful for studies on the role of TLR2 as a pattern recognition receptor in microbial products induced cytokine production by TLR2 bearing cells such as human peripheral blood mononuclear cells. The monoclonal antibody TL23 is cross reactive with canine TLR2.
Antibody Isotype:
IgG2a
Monosan Range:
MONOSAN
Clone:
TL2.3
Concentration:
100 ug/ ml
Storage buffer:
PBS with 0.1% BSA and 0.02% sodium azide
Storage:
2-8°C
References 1:
Flo; T et al. J Leukoc Biol 2001; 69: 474
References 2:
Schjetne, K et al J Immunol 2003, 171: 32
References 3:
Siedlar; M et al. J Immunol 2004; 173: 2736
References 4:
Tunheim G et al. Vaccine 2007; 25: 4723
References 5:
Burgener I et al. Vet Immunol Immunopathol 2008; 124: 184
The monoclonal antibody TL2.1 recognizes human Toll-like receptor 2 (TLR2, CD282). Toll-like receptors (TLR) are highly conserved throughout evolution and are involved in the innate defence to many pathogens. In Drosophila toll is required for the anti-fungal response, while the related 18-wheeler is involved in antibacterial defences. In mammals, TLRs are identified as type I transmembrane signaling receptors with pattern recognition capabilities. They have been implicated in the innate host defence to pathogens. TLR2 is expressed on macrophages, smooth muscle, lung, spleen, thymus, brain and adipose tissue.<br /> TLR2 has been identified as a receptor that is central to the innate immune response to lipoproteins of Gram-negative bacteria, several whole Gram-positive bacteria, as well as a receptor for peptidoglycan and lipoteichoic acid and other bacterial cell membrane products. A functional interaction between TLR2 and TLR6 in the cellular response to various bacterial products has been discovered. TLR2 cooperates with LY96 to mediate the innate immune response to bacterial lipoproteins and other microbial cell wall components. It cooperates with TLR1 to mediate te innate immune response to bacterial lipoproteins or lipopeptides. It acts via MYD88 and TRAF6, leading to NF-κ-B activation, cytokine secretion and the inflammatory response. TLR2 also promotes apoptosis in response to lipoproteins.<br /> Bacterial species as diverse as mycobacteria, spirochetes, mycoplasma, S. aureus, B Burgdorferi, T pallidum, M fermentans and Streptococcus pneumoniae have all been shown to mediate cellular activation via TLR2.<br /> The monoclonal antibody TL2.1 is a TLR2 function blocking antibody that is useful for studies on the role of TLR2 as a pattern recognition receptor in microbial products induced cytokine production by TLR2 bearing cells such as human peripheral blood mononuclear cells
Antibody Isotype:
IgG2a
Monosan Range:
MONOSAN
Clone:
TL2.1
Concentration:
100 ug/ ml
Storage buffer:
PBS with 0.1% BSA and 0.02% sodium azide
Storage:
2-8°C
References 1:
Lien; E et al. J Biol Chem 1999; 274: 33419
References 2:
Flo, T et al J Leukoc Biol 2001, 69: 474
References 3:
Faure; E et al. J Immunol 2001; 166: 2018
References 4:
Droemann D et al. Histochem Cell Biol 2003; 119: 103
References 5:
Burgener I et al. Vet Immunol Immunopathol 2008; 124: 184
Monoclonal antibody mT2.7 reacts with mouse Toll-like receptor 2 (TLR2, CD282). Toll-like receptors (TLR) are highly conserved throughout evolution and have been implicated in the innate defense to many pathogens. In Drosophila toll is required for the anti-fungal response, while the related 18-wheeler is involved in antibacterial defenses. In mammals, TLR identified as type I transmembrane signaling receptors with pattern recognition capabilities, have been implicated in the innate host defense to pathogens. TLR2 has been identified as a receptor that is central to the innate immune response to lipoproteins of Gram-negative bacteria, several whole Gram-positive bacteria, as well as a receptor for peptidoglycan and lipoteichoic acid and other bacterial cell membrane products. A functional interaction between TLR2 and TLR6 in the cellular response to various bacterial products has been discovered. The currently accepted paradigm regards TLR2 as an essential receptor for many eubacterial cell wall components, including lipoproteins and peptidoglycan. Bacterial species as diverse as mycobacteria, spirochetes, mycoplasma, Staphylococcus aureus, and Streptococcus pneumoniae have all been shown to mediate cellular activation via TLR2. The monoclonal antibody mT2.7 stained overexpressed, as well as endogenous cell surface- and intracellular TLR2. The antibody does not affect cell activation through TLR2.
The monoclonal antibody 5G5 recognizes human Toll-like receptor 9. Toll-like receptors (TLRs) are highly conserved from Drosophila to humans and share structural and functional similarities. TLRs constitute of a family of pattern recognition receptors (PRRs) that mediate cellular responses to a large variety of pathogens (viruses, bacteria, and parasites) by specific recognition of so-called âpathogen-associated molecular patternsâ. Activation of TLRs, a family of at least 11 differentmembers that function either as homo- or heterodimers, leads to activation of NFκB-dependent and IFNregulatory factor-dependent signaling pathways. TLRs have a central role in innate immunity and are also required for the development of an adaptive immune response. TLRs are expressed by various cells of the immune system, such as macrophages and dendritic cells. They recognize and respond to molecules derived from bacterial, viral and fungal pathogens.<br /> Whereas most TLRs are expressed on the cell surface, TLR9 is expressed intracellularly within one or more endosomal compartments and recognizes nucleic acids. TLR9 detects a rather subtle difference in the DNA of vertebrates compared with that of pathogens. Vertebrate genomic DNAs have mostly methylated CpG dinucleotides where bacterial and viral DNAs have unmethylated CpG dinucleotides. TLR9 undergoes relocation from endoplasmic reticulum to CpG-ODN-containing endosomes. In these endosomes TLR9 becomes a functional receptor after proteolytic cleavage. TLR9 exists as a preformed homodimer and CpG-ODN binding promotes its conformational change, bringing the cytoplasmic TIR-like domains close to each other. This allows a recruitment of the key adapter protein MyD88 which initiates a signalling cascade. The only human immune cell types known to constitutively express TLR9 and to be activated by CpG ODN are pDCs and B cells. TLR9 triggering induces an activation phenotype in the B cells and pDCs, characterized by the expression of costimulatory molecules, resistance to apoptosis, and induces Th1-type immune response profiles.
Antibody Isotype:
IgG2a
Monosan Range:
MONOSAN
Clone:
5G5
Concentration:
100 ug/ ml
Storage buffer:
PBS with 0.1% BSA and 0.02% sodium azide
Storage:
2-8°C
References 1:
Ahmad-Nejad; P et al. Eur J Immunol 2002; 32: 1958
The monoclonal antibody 67D3 recognizes human heart-type fatty acid-binding protein (H-FABP) of both natural and recombinant origin. The H-FABP protein is derived from the human FABP3 gene. FABPs are small intracellular proteins (~13-14 kDa) with a high degree of tissue specificity that bind long chain fatty acids. They are abundantly present in various cell types and play an important role in the intracellular utilization of fatty acids, transport and metabolism. There are at least nine distinct types of FABP, each showing a specific pattern of tissue expression. Due to its small size, FABP leaks rapidly out of ischemically damaged necrotic cells leading to a rise in serum levels. Ischemically damaged tissues are characterized histologically by absence (or low presence) of FABP facilitating recognition of such areas. H-FABP is localized in the heart, skeletal and smooth muscle, mammary epithelial cells, aorta, distal tubules of the kidney, lung, brain, placenta, and ovary. Furthermore, this antibody is useful for the purification of H-FABP.
CD16 (FCGR3A) is a 50-65 kDa cell surface molecule that exists in two forms - a transmembranous form expressed by NK cells and some T cells, and a phosphatidylinositol linked form expressed by granulocytes. CD16 is a low affinity receptor for IgG (FcR III), and is an important receptor mediating ADCC by NK cells. Human CD16 is expressed in two forms FCGR3A and FCGR3B. FCGR3A is associated with the FcepsilonRI-gamma subunit and is responsible for antibody-dependent NK cell cytotoxicity.
This antibody reacts with Human IgE (ε chain). IgE evaluation of patients with suspected diseases associated with elevations in total immunoglobulin E (IgE), including allergic disease, primary immunodeficiencies, infections, malignancies, or other inflammatory diseases.
Concentration:
1.0 mg/ml (E 1% at 280 nm = 13.0)
Conjugate:
Horseradish Peroxidase
Form:
Lyophilized
Purification:
Affinity purified using solid phase Human IgE
Purity:
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Goat
Immunogen:
Purified Human IgE, (ε) chain
Buffer:
PBS, 1% BSA & 0.1% proclin 150
Preservative:
0.1% (v/v) Kathon CG
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, dilute with 50% glycerol and store at -20 °C as a liquid.
Specificity:
Based on IEP, this antibody reacts with: · heavy (ε) chains on human IgE
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin human serum immunoglobulins · light chains on all human immunoglobulins · serum proteins from bovine, mouse or rabbit
Country Of Origin:
Goat serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
CBP20 (Nuclear cap-binding protein subunit 2)is a component of the cap-binding complex (CBC), involved in various processes such as pre-mRNA splicing and RNA-mediated gene silencing (RNAi) by microRNAs (miRNAs). Alternative names: 20 kDa nuclear cap-binding protein, NCBP 20 kDa subunit
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Glycne max, Hordeum vulgare, Lotus corniculatus, Nicotiana tabacum, Oryza sativa, Ricinus communis, Solanum lycopersicum, Solanum tuberosum, Zea mays Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide, derived with Arabidopsis thaliana CBP20 protein Q9xFD1, At5g44200
Mouse anti-6x Histidine is a primary antibody which binds to 6x Histidine and is directly conjugated to ALP, Alkaline Phosphatase. This is of advantage to shorten assay time by no need to use a secondary antibody to 6x Histidine tag.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Final primary antibody dilution, depend upon amount of Hisx6 tagged protein in analyzed sample.
Application Details:
1: 5000 - 10 000 (WB)
Purity:
Immunogen affinity purified in 25 mM Tris, 150 mM NaCl, 5 mM MgCl2, 0.12 mM ZnCl2, pH 7.4. with 2 mM sodium azide.
Reconstitution:
For reconstitution add 100 µl of sterile water
Molecular Weight:
depends upon fusion partner
Special application note:
Antibody is provided in: 25 mM Tris, 150 mM Sodium Chloride, 5 mM Magnesium Chloride, 0.12 mM Zinc Chloride, 2 mM Sodium Azide (pH 7.4)Concentration: 0.1mg/ml
HA-tag is derived from a human influenza hemagglutinin HA-molecule corresponding to amino acids 96-106 and is used as a general epitope tag in expression vectors.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Important note: there is a strong cross reactivity between 25 -20 kDa in Arabidopsis thaliana wildtype.
Application Details:
1 : 5000 (WB)
Purity:
affinity purified serum in PBS, pH 7.4.
Reconstitution:
For reconstitution add 100 µl of sterile water
Molecular Weight:
Depends on the MW of the protein which is HA-tagged
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Hwang et al. (2019) Arabidopsis ABF3 and ABF4 Transcription Factors Act with the NF-YC Complex to Regulate SOC1 Expression and Mediate Drought-Accelerated Flowering. Mol Plant. 2019 Apr 1;12(4):489-505. doi: 10.1016/j.molp.2019.01.002
p40 is a relatively unknown antibody that recognizes ?Np63-a p63 isoform suggested to be highly specific for squamous/basal cells. In a recent study, p40 is equivalent to p63 in sensitivity for squamous cell carcinoma, but it is markedly superior to p63 in specificity1, which eliminates a potential pitfall of misinterpreting a p63-positive adenocarcinoma or unsuspected lymphoma as squamous cell carcinoma. These findings strongly support the routine use of p40 in place of p63 for the diagnosis of pulmonary squamous cell carcinoma. Postive control Prostate
Claudins are a family of over twenty proteins which are components of tight junctions. Tight junctions are specialized regions of cell-to-cell contact made up of a network of strands to act as a molecular gasket for preventing the leakage of ions, water, etc., between cells.1 Claudin 1 has been shown to distinguish epithelial neoplasms from lymphomas, making it a useful marker for nearly all carcinomas.2
Monosan Range:
MONOSAN Ready To Use
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Folpe AL, et al. Am J Surg Pathol. 2002; 26:1620-6
Smooth Muscle Actin is a part of the actin family of proteins which are highly conserved and form microfilaments. These filaments are one of the major components of the cytoskeleton. Anti-smooth muscle actin immunohistochemical reactivity is seen in smooth muscle cells, myofibroblasts and myoepithelial cells.
Antibody Isotype:
IgG1-k
Monosan Range:
MONOSAN
Clone:
1A4
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Cooke PH. A. J Cell Biol. 1976; 68:539-56
References 2:
Skalli O, et al. J Cell Biol. 1986; 103:2787-96
References 3:
Perez-Montiel MD, et al. Am J Dermatopathol. 2006; 28:105-11
CD20 is a transmembrane protein in late B-cell precursors and mature B-cells that plays a role in regulating proliferation and differentiation. CD20 expression is lost at the plasma cell stage of differentiation. MON 3226 (pan B-cell) has rarely been detected in T-cell malignancies, and is a dependable marker of B-cell lymphomas such as DLBCL. CD20 expression is present in some thymomas. It does not cross-react with non-hematopoietic neoplasms.
Antibody Isotype:
IgG2a-k
Monosan Range:
MONOSAN
Clone:
L26
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Anti-CD45 (anti-leukocyte common antigen) is routinely used to aid the differential diagnosis of undifferentiated neoplasms, whenever malignant lymphoma is suspected by the morphological or clinical data. It is a highly specific antibody; therefore a positive result is highly indicative of hematolymphoid origin. Certain types of hematolymphoid neoplasms may lack CD45 (Hodgkin lymphoma, some T-cell lymphomas, and some leukemias) so its absence does not rule out a hematolymphoid tumor. This antibody is expressed almost exclusively by cells of hematopoietic lineage and is present in most benign and malignant lymphocytes as well as plasma cell precursors.
Antibody Isotype:
IgG1-k
Monosan Range:
MONOSAN
Clone:
2B11 & PD7/26
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Mason, DY, Am Pathol 1987;128:1-4
References 2:
Hall PA, Histopathology 1988;13:149-160
References 3:
Kurtin, PJ, Hum Path 1985;16:353-365
References 4:
Maluf HM et al. Mod Pathol. 1995 Feb; 8(2): 155-9
References 5:
Caballero T et al. J Clin Pathol. 1995 Aug;48(8): 743-8
The antibody marks cells of monocyte/macrophage lineage. This antibody is capable of staining monocytes, Kupffer cells, osteoclasts, granulocytes and their precursors; lymphomas are negative or show few granules. This antibody may be useful for the identification of myelomonocytic and histiocytic tumors. Since this detects a formalin-resistant epitope that may be associated with lysosomal granules, other lysosome-rich cells may also stain.
Antibody Isotype:
IgG1-k
Monosan Range:
MONOSAN
Clone:
Kp-1
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Anti-CEA is employed as a tool to assist in the distinction between adenocarcinoma and mesotheliomas, along with other markers such as calretinin, CK 5/6, D2-40, HBME-1, Napsin A, MOC31, and Ber-EP4. Anti-CEA positivity is seen in adenocarcinomas from the lung and colon, as well.
Antibody Isotype:
IgG1
Monosan Range:
MONOSAN
Clone:
CEA31
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Go, VLW, et al., Cancer 1976;37:562-566
References 2:
Delellis, RA, et al., Am J Clin Pathol 1978;50:587-594
References 3:
Abutaily AS et al. J Clin Pathol. 2002 Sep;55(9):662-8
References 4:
Bhatnagar J et al. Anticancer Res. 2002;22(3):1849-57
References 5:
Carella R. et al. Am J Surg Pathol. 2001 Jan;25(1):43-50
Immunohistochemical methods have localized chromogranin in a wide variety of endocrine tissues including the pituitary, pancreas, thyroid, and parathyroid. Neuroendocrine cells exhibit a fine granular immunoreactivity to chromogranin. It is generally accepted that the co-expression of certain keratins and chromogranin mean neuroendocrine lineage. The presence of strong chromogranin staining and absence of keratin staining should raise the possibility of paraganglioma. The co-expression of chromogranin and NSE is typical of neuroendocrine neoplasms.
Antibody Isotype:
IgG1-k
Monosan Range:
MONOSAN
Clone:
LK2H10
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Wilson, BS, et al., Am J Pathol; 115:458-468 (1984)
References 2:
Lyda MH, Weiss LM. Hum Pathol. 31(8):980-7 (2000)
References 3:
ontochristopoulous GJ et al. Dermatology.; 201(2):123-6 (2000)
References 4:
Qvigstad G et al. Histochem J.; 32(9):551-6 (2000)
Bovine milk contains two types of beta-casein protein, A2 or A1. Recent studies have shown that milk containing the A1 beta casein protein can contribute to issues including gastrointestinal discomfort after ingestion. There is some evidence of a link between ingestion of A1 beta casein protein and the development of Type 1 diabetes.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS, pH 7.4, containing 0.02% sodium azide as preservative. Refer to the product label for antibody concentration.
Host Animal:
Chicken
Species Reactivity:
Bovine
Immunogen:
A synthetic peptide (PGPIHNSLP, aa: 78-86) conjugated to KLH has been used as immunogen. Bovine A2 beta casein differs from bovine A1 beta casein by one amino acid (P82 -> H82)
Applications:
ELISA,WB
Antibody Isotype:
IgY
Application Details:
Western blot and ELISA. Suggested working dilution for western blot is 1:1,000-1:5,000. The amount of milk per lane can be 0.05 µL-0.1 µL for Western blot. Sample Preparation: Milk should be diluted 1:10 in 0.1M NaOH. The reason for diluting (1:10) in 0.1M NaOH is because the milk protein is easier to dissolve in NaOH. The sample is then further diluted with PBS or other buffer and mixed at 1:1 ratio, to prepare for loading. For example, one can take the 1:10 dilution milk (0.5 µL-1 µL) and add into 9.5 µL or 9 µL PBS and mix with 10 µL SDS-PAGE Sample buffer, boil for 5 minutes, quick spin, and load on the gel. Recommended blocking buffer: TBS with 5% BSA. Recommended antibody dilution buffer: TBST containing 3% BSA. Biosensis recommends that optimal working dilutions should be determined by the end user.
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Specificity:
The antibody is specific to A1 beta casein by western blot. No cross-reactivity with A2 beta casein is seen. Species cross-reactivity not tested.
Storage:
Maintain unopened vial at -20°C for up to 12 months after date of receipt. After opening maintain at -20°C in undiluted aliquots for up to 6 months. For short-term storage, keep aliquot at 2-8°C for up to one week. Avoid repeated freeze-thaw cycles.
Bovine milk contains two types of beta-casein protein, A2 or A1. Recent studies have shown that milk containing the A1 beta casein protein can contribute to issues including gastrointestinal discomfort after ingestion. There is some evidence of a link between ingestion of A1 beta casein protein and the development of Type 1 diabetes.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS, pH 7.4, containing 0.02% sodium azide as preservative. Refer to the product label for antibody concentration.
Host Animal:
Chicken
Species Reactivity:
Bovine
Immunogen:
A synthetic peptide (PGPIPNSLP, aa: 78-86) conjugated to KLH has been used as immunogen. Bovine A1 beta casein differs from bovine A2 beta casein by one amino acid (H82 -> P82)
Applications:
ELISA,WB
Antibody Isotype:
IgY
Application Details:
Western blot and ELISA. Suggested working dilution for western blot is 1:200-1:1,000. The amount of milk per lane can be 0.05 µL-0.1 µL for Western blot. Sample Preparation: Milk should be diluted 1:10 in 0.1M NaOH. The reason for diluting (1:10) in 0.1M NaOH is because the milk protein is easier to dissolve in NaOH. The sample is then further diluted with PBS or other buffer and mixed at 1:1 ratio, to prepare for loading. For example, one can take the 1:10 dilution milk (0.5 µL-1 µL) and add into 9.5 µL or 9 µL PBS and mix with 10 µL SDS-PAGE Sample buffer, boil for 5 minutes, quick spin, and load on the gel. Recommended blocking buffer: TBS with 5% BSA. Recommended antibody dilution buffer: TBST containing 3% BSA. Biosensis recommends that optimal working dilutions should be determined by the end user.
Biosensis Brand:
Biosensis®
Conjugate:
Unconjugated
Shelf Life:
12 months after date of receipt (unopened vial).
Use:
For research use only.
Specificity:
The antibody is specific to A2 beta casein by western blot. No cross-reactivity with A1 beta casein is seen. Species cross-reactivity not tested.
Storage:
Maintain unopened vial at -20°C for up to 12 months after date of receipt. After opening maintain at -20°C in undiluted aliquots for up to 6 months. For short-term storage, keep aliquot at 2-8°C for up to one week. Avoid repeated freeze-thaw cycles.
Ikaros, also known as IKZF1 (Ikaros family zinc finger protein 1) is a hematopoietic-specific transcription factor involved in the regulation of lymphocyte development, together with other members of this family, such as Aiolos and Helios. Ikaros forms homo- and heterodimers with these proteins and functions predominantly in early hematopoietic development. Expression of Ikaros, Aiolos and Helios is restricted to cells of the hematopoietic system, whereas other family members, Eos and Pegassus, are more widely expressed. Disruption of Ikaros leads to T and B cell leukemias.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Recombinant human Ikaros (C-terminal part)
Applications:
FC
Additional Info:
The mouse monoclonal antibody 4E9 recognizes Ikaros, a transcription factor (intracellular antigen) expressed broadly in hematopoietic progenitors and serving as a key regulator of lymphopoiesis.
Clone number:
4000000000
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests. Intracellular staining.
Ki-67 is a highly protease-sensitive nuclear protein expressed in two isoforms (345 kDa and 395 kDa), both of which are identified by the antibody clone Ki-67. The Ki-67 antigen is essential for cell proliferation and its expression is restricted to the cycling cells. It is detected in G1, S, G2 and M phase, whereas it is absent in cells which are in G0 phase and it is not associated with DNA repair processes. Ki-67 thus represents an important tool for detection of proliferating cells, which is of great importance in tumor diagnostics and is commonly used as a prognostic factor in cancer studies.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Nuclei of the Hodgkin lymphoma cell line L428
Applications:
FC
Additional Info:
The mouse monoclonal antibody Ki-67 recognizes Ki-67 antigen, a non-histone nuclear protein expressed exclusively in proliferating cells.
Clone number:
Ki-67
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests. Intracellular staining.
Lactoferrin is an iron-binding glycoprotein of the transferrin family, which is released to most biological fluids, with particularly high levels in milk. It has anti-inflammatory (e.g. sequestering of lipopolysaccharides), anti-microbial (e.g. blocking of viral attachment to the target cell), and immunomodulatory properties and can prevent infections in young children. Lactoferrin is considered to bridge the innate and adaptive immune responses. It also participates in iron homeostasis, regulation of cellular growth and differentiation and protection against cancer development and metastasis. Besides biological fluids it is also found in the secondary granules of neutrophils.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human lactoferrin
Applications:
FC
Additional Info:
The mouse monoclonal antibody LF5-1D2 recognizes lactoferrin, an iron-binding secreted glycoprotein of about 90 kDa, which has anti-inflammatory, immunomodulatory and anti-microbial properties.
Clone number:
LF5-1D2
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests. Intracellular staining.
CD45 (LCA, leukocyte common antigen) is a receptor-type protein tyrosine phosphatase ubiquitously expressed in all nucleated hematopoietic cells, comprising approximately 10% of all surface proteins in lymphocytes. CD45 glycoprotein is crucial in lymphocyte development and antigen signaling, serving as an important regulator of Src-family kinases. CD45 protein exists as multiple isoforms as a result of alternative splicing; these isoforms differ in their extracellular domains, whereas they share identical transmembrane and cytoplasmic domains. These isoforms differ in their ability to translocate into the glycosphingolipid-enriched membrane domains and their expression depends on cell type and physiological state of the cell. Besides the role in immunoreceptor signaling, CD45 is important in promoting cell survival by modulating integrin-mediated signal transduction pathway and is also involved in DNA fragmentation during apoptosis.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Murine peripheral blood leukocytes
Applications:
FC
Additional Info:
The rat monoclonal antibody EM-05 reacts with an extracellular epitope of murine CD45 antigen (Leukocyte Common Antigen), a single chain type I transmembrane protein expressed at high level on cells of hematopoietic origin, except erythrocytes and platelets.
CD45 (LCA, leukocyte common antigen) is a receptor-type protein tyrosine phosphatase ubiquitously expressed in all nucleated hematopoietic cells, comprising approximately 10% of all surface proteins in lymphocytes. CD45 glycoprotein is crucial in lymphocyte development and antigen signaling, serving as an important regulator of Src-family kinases. CD45 protein exists as multiple isoforms as a result of alternative splicing; these isoforms differ in their extracellular domains, whereas they share identical transmembrane and cytoplasmic domains. These isoforms differ in their ability to translocate into the glycosphingolipid-enriched membrane domains and their expression depends on cell type and physiological state of the cell. Besides the role in immunoreceptor signaling, CD45 is important in promoting cell survival by modulating integrin-mediated signal transduction pathway and is also involved in DNA fragmentation during apoptosis.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Murine peripheral blood leukocytes
Applications:
FC
Additional Info:
The rat monoclonal antibody EM-05 reacts with an extracellular epitope of murine CD45 antigen (Leukocyte Common Antigen), a single chain type I transmembrane protein expressed at high level on cells of hematopoietic origin, except erythrocytes and platelets.
LARGE1 serves as a glycosyltransferase which participates in glycosylation of the muscle membrane protein alpha-dystroglycan. Mutations of LARGE1 lead to hypoglycosylation of alpha-dystroglycan and cause congenital muscular dystrophy (MDC1D) associated with severe mental retardation. Altered alpha-dystroglycan glycosylation may also play a role in cancer, as hypoglycosylation of the protein and loss of laminin binding have been demonstrated in invasive carcinoma cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Recombinant fragment of human LARGE1 (amino acids 35-142)
Applications:
FC
Additional Info:
The mouse monoclonal antibody LARGE-02 recognizes human LARGE1, a glycosyltransferase expressed mainly in the Golgi apparatus. Crossreactivity with LARGE2 was not determined.
Lysozyme is anti-bacterial enzyme found mainly in milk, saliva, tears, plasma, spleen, mucus, and leukocytes (e.g. in cytoplasmic granules of neutrophils). It damages bacterial cell walls by hydrolysis of 1,4-beta-linkages between N-acetylmuramic acid and N-acetyl-D-glucosamine residues in a peptidoglycan and between N-acetyl-D-glucosamine residues in chitodextrins. Lysozyme is part of the innate immune system. It protects wet body surfaces, such as conjunctiva. Reduced lysozyme levels have been associated with bronchopulmonary dysplasia in newborns. On the other hand high lysozyme blood levels produced for example by myelomonocytic leukemia cells can lead to kidney failure and low blood potassium.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human lysozyme
Applications:
FC
Additional Info:
The mouse monoclonal antibody LZ598-10G9 recognizes lysozyme, an approximately 17 kDa antibacterial enzyme, which is being used as a marker for the lineage diagnosis of acute leukemias (intracellular antigen).
CD4 (T4) is a single chain transmembrane glycoprotein and belongs to immunoglobulin supergene family. In extracellular region there are 4 immunoglobulin-like domains (1 Ig-like V-type and 3 Ig-like C2-type). Transmembrane region forms 25 aa, cytoplasmic tail consists of 38 aa. Domains 1,2 and 4 are stabilized by disulfide bonds. The intracellular domain of CD4 is associated with p56Lck, a Src-like protein tyrosine kinase. It was described that CD4 segregates into specific detergent-resistant T-cell membrane microdomains. Extracellular ligands: MHC class II molecules (binds to CDR2-like region in CD4 domain 1); HIV envelope protein gp120 (binds to CDR2-like region in CD4 domain 1); IL-16 (binds to CD4 domain 3), human seminal plasma glycoprotein gp17 (binds to CD4 domain 1), L-selectin. Intracellular ligands: p56LckCD4 is a co-receptor involved in immune response (co-receptor activity in binding to MHC class II molecules) and HIV infection (human immunodeficiency virus; CD4 is primary receptor for HIV-1 surface glycoprotein gp120). CD4 regulates T-cell activation, T/B-cell adhesion, T-cell diferentiation, T-cell selection and signal transduction. Defects in antigen presentation (MHC class II) cause dysfunction of CD4+ T-cells and their almost complete absence in patients blood, tissue and organs (SCID immunodeficiency).
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Mouse CTL clone V4 cells
Applications:
FC
Additional Info:
The rat monoclonal antibody GK1.5 reacts with an extracellular epitope of mouse CD4 transmembrane glycoprotein (55 kDa).
CD2 belongs to T lymphocyte glycoproteins of immunoglobulin superfamily. Its interaction with CD58 stabilizes adhesion between T cells and antigen presenting or target cells. Relatively low affinity of CD2 to CD58 (as measured in solution) is compensated within the two-dimensional cell-cell interface to provide tight adhesion. Moreover, T cell activation induces increased CD2 expression and its lateral mobility, making easier contact between CD2 and CD58. Subsequently, T cell activation causes fixation of CD58-CD2 at sites of cell-cell contact, thereby strengthening intercellular adhesion. CD2 deficiency reduces intestinal inflammation and helps to control infection.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
murine thymocytes
Applications:
FC
Additional Info:
The rat monoclonal antibody RM2-5 recognizes an extracellular epitope of CD2, a 50 kDa glycoprotein present on the human peripheral blood T lymphocytes and NK cells; also expressed by all thymocytes.
TNF-alpha is a cytokine produced by monocytes, macrophages, neutrophils, NK cells, CD4+ T cells and many transformed cells. It can be expressed as a 17 kDa free molecule, or as a 26 kDa membrane protein. TNF-alpha easily forms stable trimers, but also other multimeric complexes. In the immune system, it is an important regulator, which has cytolytic and cytostatic activity against a range of tumor cells, increases fibroblast proliferation and supports neutrophil chemotaxis and phagocytosis.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Recombinant human TNF-alpha
Applications:
FC
Additional Info:
The mouse monoclonal antibody MAb11 recognizes human 17-26 kDa cytokine TNF-alpha (tumor necrosis factor alpha).
Clone number:
MAb11
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests. Intracellular staining.
TNF-alpha is a cytokine produced by monocytes, macrophages, neutrophils, NK cells, CD4+ T cells and many transformed cells. It can be expressed as a 17 kDa free molecule, or as a 26 kDa membrane protein. TNF-alpha easily forms stable trimers, but also other multimeric complexes. In the immune system, it is an important regulator, which has cytolytic and cytostatic activity against a range of tumor cells, increases fibroblast proliferation and supports neutrophil chemotaxis and phagocytosis.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Recombinant human TNF-alpha
Applications:
FC
Additional Info:
The mouse monoclonal antibody MAb11 recognizes human 17-26 kDa cytokine TNF-alpha (tumor necrosis factor alpha).
Clone number:
MAb11
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests. Intracellular staining.
CD138 (syndecan 1) is a transmembrane proteoglycan that can bind a variety of cytokines and modulate their activity, as well as the activity of extracellular matrix components and influence many developmental processes. CD138 is expressed mainly in differentiating keratinocytes and is transiently upregulated in all layers of the epidermis upon tissue injury. It is also highly expressed on plasma cells and can be detected even on fibroblasts, vascular smooth muscle cells and endothelial cells. Up-regulation and down-regulation of CD138 on the cell surface often correlates with the gain of cancerous characteristics. Serum levels of the shedded soluble sCD138 are used as a prognostic factor of cancerogenesis. _x000D_
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store in the dark at 2-8°C. Do not freeze. Avoid prolonged exposure to light. Do not use after expiration date stamped on vial label.
Immunogen:
A mixture of U266 and XG-1 human myeloma cell lines
Applications:
FC,IP,WB,IHC
Additional Info:
The mouse monoclonal antibody MI15 recognizes CD138 (syndecan 1), a 65-70 kDa heparan sulfate proteoglycan expressed mainly in the epidermis and plasma cells, but also in growth factor-stimulated lymphocytes.
LAR is a receptore-linked transmembrane protein tyrosine phosphatase expressed on mesenchymal stem cells, that reside e.g. in bone marrow, blood, placenta, adipose tissue, or skin, as well as it is expressed on some carcinoma cell lines, including HeLa, MCF-7, or HT29. During the process of externalization, LAR is intracellularly proteolytically processed into two non-covalently associated subunits. This protein is involved in intercellular and cell-matrix interactions and its extracellular part resembles that of cell adhesion molecules (CAMs). The extracellular part can be released from the surface, which may be used for regulation of LAR function.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
WERI-RB-1 retinoblastoma cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody W7C6 recognizes an extracellular epitope of protein tyrosine phosphatase LAR, a marker of mesenchymal stem cells.
LAR is a receptore-linked transmembrane protein tyrosine phosphatase expressed on mesenchymal stem cells, that reside e.g. in bone marrow, blood, placenta, adipose tissue, or skin, as well as it is expressed on some carcinoma cell lines, including HeLa, MCF-7, or HT29. During the process of externalization, LAR is intracellularly proteolytically processed into two non-covalently associated subunits. This protein is involved in intercellular and cell-matrix interactions and its extracellular part resembles that of cell adhesion molecules (CAMs). The extracellular part can be released from the surface, which may be used for regulation of LAR function.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
WERI-RB-1 retinoblastoma cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody W7C6 recognizes an extracellular epitope of protein tyrosine phosphatase LAR, a marker of mesenchymal stem cells.
CD138 (syndecan 1) is a transmembrane proteoglycan that can bind a variety of cytokines and modulate their activity, as well as the activity of extracellular matrix components and influence many developmental processes. CD138 is expressed mainly in differentiating keratinocytes and is transiently upregulated in all layers of the epidermis upon tissue injury. It is also highly expressed on plasma cells and can be detected even on fibroblasts, vascular smooth muscle cells and endothelial cells. Up-regulation and down-regulation of CD138 on the cell surface often correlates with the gain of cancerous characteristics. Serum levels of the shedded soluble sCD138 are used as a prognostic factor of cancerogenesis. _x000D_
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store in the dark at 2-8°C. Do not freeze. Avoid prolonged exposure to light. Do not use after expiration date stamped on vial label.
Immunogen:
U266 human peripheral blood myeloma cell line
Applications:
FC,IHC
Additional Info:
The antibody B-A38 recognizes CD138 (syndecan 1), a 65-70 kDa heparan sulfate proteoglycan expressed mainly in the epidermis and plasma cells, but also in growth factor-stimulated lymphocytes. _x000D_
CD138 (syndecan 1) is a transmembrane proteoglycan that can bind a variety of cytokines and modulate their activity, as well as the activity of extracellular matrix components and influence many developmental processes. CD138 is expressed mainly in differentiating keratinocytes and is transiently upregulated in all layers of the epidermis upon tissue injury. It is also highly expressed on plasma cells and can be detected even on fibroblasts, vascular smooth muscle cells and endothelial cells. Up-regulation and down-regulation of CD138 on the cell surface often correlates with the gain of cancerous characteristics. Serum levels of the shedded soluble sCD138 are used as a prognostic factor of cancerogenesis. _x000D_
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store in the dark at 2-8°C. Do not freeze. Avoid prolonged exposure to light. Do not use after expiration date stamped on vial label.
Immunogen:
A mixture of U266 and XG-1 human myeloma cell lines
Applications:
FC,IP,WB,IHC
Additional Info:
The mouse monoclonal antibody MI15 recognizes CD138 (syndecan 1), a 65-70 kDa heparan sulfate proteoglycan expressed mainly in the epidermis and plasma cells, but also in growth factor-stimulated lymphocytes.
Myeloperoxidase (MPO) is a heme enzyme that is localized in azurophilic (primary) granules of myeloid cells and its synthesis occurs at an early stage of differentiation. The mature myeloperoxidase is a tetramer composed of two light (12 kDa) and two heavy (60 kDa) chains. This enzyme uses hydrogen peroxide to oxidize numerous substrates, including serotonin, melatonin or chloride, to produce reactive free radicals that contribute to immune reactions of myeloid cells against pathogens. Myeloperoxidase functions not only in host defense by mediating efficient microbial killing but also can contribute to progressive tissue damage in chronic inflammatory states such as atherosclerosis or acute pancreatitis.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human myeloperoxidase
Applications:
FC
Additional Info:
The mouse monoclonal antibody MPO421-8B2 recognizes human myeloperoxidase, a heme protein present in intracellular granules of myeloblasts, neutrophils and monocytes. It is a marker of acute myelogenous leukemias and acute lymphoblastic leukemias.
Clone number:
MPO421-8B2
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests. Intracellular staining.
CD138 (syndecan 1) is a transmembrane proteoglycan that can bind a variety of cytokines and modulate their activity, as well as the activity of extracellular matrix components and influence many developmental processes. CD138 is expressed mainly in differentiating keratinocytes and is transiently upregulated in all layers of the epidermis upon tissue injury. It is also highly expressed on plasma cells and can be detected even on fibroblasts, vascular smooth muscle cells and endothelial cells. Up-regulation and down-regulation of CD138 on the cell surface often correlates with the gain of cancerous characteristics. Serum levels of the shedded soluble sCD138 are used as a prognostic factor of cancerogenesis. _x000D_
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store in the dark at 2-8°C. Do not freeze. Avoid prolonged exposure to light. Do not use after expiration date stamped on vial label.
Immunogen:
A mixture of U266 and XG-1 human myeloma cell lines
Applications:
FC,IP,WB,IHC
Additional Info:
The mouse monoclonal antibody MI15 recognizes CD138 (syndecan 1), a 65-70 kDa heparan sulfate proteoglycan expressed mainly in the epidermis and plasma cells, but also in growth factor-stimulated lymphocytes.
CD1a, together with CD1b and c, belongs to group 1 of CD1 glycoproteins. These proteins serve as antigen-presenting molecules for a subset of T cells that responds to specific lipids and glycolipids found in the cell walls of bacterial pathogens or self-glycolipid antigens such as gangliosides, and they have also roles in antiviral immunity. Unlike CD1b, CD1a is excluded from late endosomal compartments and instead traffics independently in the recycling pathway of the early endocytic system, and CD1a antigen presentation is independent upon vesicular acidification.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store in the dark at 2-8°C. Do not freeze. Avoid prolonged exposure to light. Do not use after expiration date stamped on vial label.
Immunogen:
Human thymocytes
Applications:
FC,IP
Additional Info:
The mouse monoclonal antibody SK9 recognizes CD1a (T6), a 49 kDa polypeptide associated with beta2-microglobulin expressed on cortical thymocytes (strongly), Langerhans cells, dendritic cells and some T cell leukemias and lymphomas.
CD1a, together with CD1b and c, belongs to group 1 of CD1 glycoproteins. These proteins serve as antigen-presenting molecules for a subset of T cells that responds to specific lipids and glycolipids found in the cell walls of bacterial pathogens or self-glycolipid antigens such as gangliosides, and they have also roles in antiviral immunity. Unlike CD1b, CD1a is excluded from late endosomal compartments and instead traffics independently in the recycling pathway of the early endocytic system, and CD1a antigen presentation is independent upon vesicular acidification.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store in the dark at 2-8°C. Do not freeze. Avoid prolonged exposure to light. Do not use after expiration date stamped on vial label.
Immunogen:
Human thymocytes
Applications:
FC,IP
Additional Info:
The mouse monoclonal antibody SK9 recognizes CD1a (T6), a 49 kDa polypeptide associated with beta2-microglobulin expressed on cortical thymocytes (strongly), Langerhans cells, dendritic cells and some T cell leukemias and lymphomas.
SIGLEC8 is a sialic acid binding lectin similar to CD33. In its cytoplasmic comain it contains an immunoreceptor tyrosine-based inhibitory motif (ITIM), and a motive similar to a binding site for SLAM-associated protein. SIGLEC8 is expressed e.g. in lymph nodes and spleen. It is an eosinophil marker, although it can be found also on the surface of mast cells. Crosslinking of SIGLEC8 leads to apoptosis. Soluble form of SIGLEC8 can be foud in human serum, especially in case of eosinophil-associated diseases.
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Extracellular domain of human SIGLEC8 fused with Fc fragment of human IgG1
STRO-1 is a cell surface antigen expressed by stromal elements in human bone marrow, identified by monoclonal antibody STRO-1. Approximately 10% of mononuclear cells, greater than 95% of which are nucleated erythroid precursors, are STRO-1 positive, whereas the CFU-GM (colony-forming unit granulocyte-macrophage), BFU-E (erythroid burst) and CFU-Mix (mixed colonies) committed progenitor cells are negative. CFU-F (fibroblast colony-forming cells) are present exclusively in the STRO-1 positive population. When plated under long-term bone marrow culture conditions, STRO-1 positive cells generate adherent cell layers containing multiple stromal cell types, including adipocytes, smooth muscle cells, osteoblasts, chondrocytes, and fibroblastic elements. In combination with glycophorin A, STRO-1 is a useful marker for identification of mesenchymal stem cells. STRO-1 and CD117 are markers for osteosarcoma cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human CD34 positive bone marrow cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody STRO-1 recognizes an extracellular epitope of the cell surface antigen STRO-1 expressed by bone marrow mesenchymal stromal cells and nucleated erythroid precursors, but not by committed hematopoietic progenitors.
CD22, also known as Siglec-2 (sialic acid-binding immunoglobulin-like lectin-2) is a transmembrane glycoprotein binding alpha2,6-linked sialic acid-bearing ligands. Intracellular domain of CD22 recruits protein tyrosine phosphatase SHP-1 through the immunoreceptor tyrosine-based inhibitory motifs (ITIMs), thus setting a treshold for B cell receptor-mediated activation. CD22 also regulates B-cell response by involvement in controlling the CD19/CD21-Src-family protein tyrosine kinase amplification pathway and CD40 signaling. CD22 exhibits hallmarks of clathrin-mediated endocytic pathway.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store in the dark at 2-8°C. Do not freeze. Avoid prolonged exposure to light. Do not use after expiration date stamped on vial label.
Immunogen:
Whole hairy cell leukemia cells and membrane preparation
Applications:
FC
Additional Info:
The mouse monoclonal antibody S-HCL-1 (also known as S-HCL1) recognizes CD22 (BL-CAM), a 130 kDa type I transmembrane glycoprotein (immunoglobulin superfamily) expressed in the cytoplasm of pro-B and pre-B lymphocytes, and on the surface of mature and activated B lymphocytes; it is lost on plasma cells, peripheral blood T lymphocytes, granulocytes and monocytes._x000D_ <br><b>HLDA IV; WS Code B48</b>
CD22, also known as Siglec-2 (sialic acid-binding immunoglobulin-like lectin-2) is a transmembrane glycoprotein binding alpha2,6-linked sialic acid-bearing ligands. Intracellular domain of CD22 recruits protein tyrosine phosphatase SHP-1 through the immunoreceptor tyrosine-based inhibitory motifs (ITIMs), thus setting a treshold for B cell receptor-mediated activation. CD22 also regulates B-cell response by involvement in controlling the CD19/CD21-Src-family protein tyrosine kinase amplification pathway and CD40 signaling. CD22 exhibits hallmarks of clathrin-mediated endocytic pathway.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store in the dark at 2-8°C. Do not freeze. Avoid prolonged exposure to light. Do not use after expiration date stamped on vial label.
Immunogen:
Whole hairy cell leukemia cells and membrane preparation
Applications:
FC
Additional Info:
The mouse monoclonal antibody S-HCL-1 (also known as S-HCL1) recognizes CD22 (BL-CAM), a 130 kDa type I transmembrane glycoprotein (immunoglobulin superfamily) expressed in the cytoplasm of pro-B and pre-B lymphocytes, and on the surface of mature and activated B lymphocytes; it is lost on plasma cells, peripheral blood T lymphocytes, granulocytes and monocytes._x000D_ <br><b>HLDA IV; WS Code B48</b>
STRO-1 is a cell surface antigen expressed by stromal elements in human bone marrow, identified by monoclonal antibody STRO-1. Approximately 10% of mononuclear cells, greater than 95% of which are nucleated erythroid precursors, are STRO-1 positive, whereas the CFU-GM (colony-forming unit granulocyte-macrophage), BFU-E (erythroid burst) and CFU-Mix (mixed colonies) committed progenitor cells are negative. CFU-F (fibroblast colony-forming cells) are present exclusively in the STRO-1 positive population. When plated under long-term bone marrow culture conditions, STRO-1 positive cells generate adherent cell layers containing multiple stromal cell types, including adipocytes, smooth muscle cells, osteoblasts, chondrocytes, and fibroblastic elements. In combination with glycophorin A, STRO-1 is a useful marker for identification of mesenchymal stem cells. STRO-1 and CD117 are markers for osteosarcoma cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human CD34 positive bone marrow cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody STRO-1 recognizes an extracellular epitope of the cell surface antigen STRO-1 expressed by bone marrow mesenchymal stromal cells and nucleated erythroid precursors, but not by committed hematopoietic progenitors.
CD23 (Fc epsilon RII), the low affinity IgE receptor, is a 45 kDa type II membrane glycoprotein expressed more or less on eosinophils, follicular dendritic cells, Langerhans cells, mature B cells (mainly upon activation), EBV-transformed lymphoblasts, monocytes, and subpopulation of platelets. A soluble form of 37 kDa and other its fragments were also described. CD23 mediates IgE-dependent cytotoxicity by eosinophils and macrophages, and downregulates IgE secretion in response to high levels of IgE, involving release of pro-inflammatory cytokines.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store in the dark at 2-8°C. Do not freeze. Avoid prolonged exposure to light. Do not use after expiration date stamped on vial label.
Immunogen:
EBV-transformed human cells
Applications:
FC,IP
Additional Info:
The mouse monoclonal antibody EBVCS-5 recognizes an epitope located in the stalk region of human low affinity IgE receptor (CD23) between the 37 and 25 kDa cleavage sites.
The antigen-specific T cell receptor (TCR) is composed of either alpha and beta subunit, or gamma and delta subunit. Majority of T cells present in the blood, lymph and secondary lymphoid organs express TCR alpha/beta heterodimers, whereas the T cells expressing TCR gamma/delta heterodimers are localized mainly in epithelial tissues and at the sites of infection. The subunits of TCR heterodimers are covalently bonded and in the endoplasmic reticulum they associate with CD3 subunits to form functional TCR-CD3 complex. Lack of expression of any of the chains is sufficient to stop cell surface expression.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Applications:
FC
Additional Info:
The mouse monoclonal antibody IP26 recognizes a monomorphic extracellular determinant of TCR alpha/beta, the dominant subtype of T cell receptor expressed in human peripheral blood.
Clone number:
IP26
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
The antigen-specific T cell receptor (TCR) is composed of either alpha and beta subunit, or gamma and delta subunit. Majority of T cells present in the blood, lymph and secondary lymphoid organs express TCR alpha/beta heterodimers, whereas the T cells expressing TCR gamma/delta heterodimers are localized mainly in epithelial tissues and at the sites of infection. The subunits of TCR heterodimers are covalently bonded and in the endoplasmic reticulum they associate with CD3 subunits to form functional TCR-CD3 complex. Lack of expression of any of the chains is sufficient to stop cell surface expression.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Applications:
FC
Additional Info:
The mouse monoclonal antibody IP26 recognizes a monomorphic extracellular determinant of TCR alpha/beta, the dominant subtype of T cell receptor expressed in human peripheral blood.
Clone number:
IP26
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD23 (Fc epsilon RII), the low affinity IgE receptor, is a 45 kDa type II membrane glycoprotein expressed more or less on eosinophils, follicular dendritic cells, Langerhans cells, mature B cells (mainly upon activation), EBV-transformed lymphoblasts, monocytes, and subpopulation of platelets. A soluble form of 37 kDa and other its fragments were also described. CD23 mediates IgE-dependent cytotoxicity by eosinophils and macrophages, and downregulates IgE secretion in response to high levels of IgE, involving release of pro-inflammatory cytokines.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store in the dark at 2-8°C. Do not freeze. Avoid prolonged exposure to light. Do not use after expiration date stamped on vial label.
Immunogen:
EBV-transformed human cells
Applications:
FC,IP
Additional Info:
The mouse monoclonal antibody EBVCS-5 recognizes an epitope located in the stalk region of human low affinity IgE receptor (CD23) between the 37 and 25 kDa cleavage sites.
The antigen-specific T cell receptor (TCR) is composed of either alpha and beta subunit, or gamma and delta subunit. Majority of T cells present in the blood, lymph and secondary lymphoid organs express TCR alpha/beta heterodimers, whereas the T cells expressing TCR gamma/delta heterodimers are localized mainly in epithelial tissues and at the sites of infection. The subunits of TCR heterodimers are covalently bonded and in the endoplasmic reticulum they associate with CD3 subunits to form functional TCR-CD3 complex. Lack of expression of any of the chains is sufficient to stop cell surface expression.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Applications:
FC
Clone number:
IP26
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 4 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (0.4 ml) is sufficient for 100 tests.
The antigen-specific T cell receptor (TCR) is composed of either alpha and beta subunit, or gamma and delta subunit. Majority of T cells present in the blood, lymph and secondary lymphoid organs express TCR alpha/beta heterodimers, whereas the T cells expressing TCR gamma/delta heterodimers are localized mainly in epithelial tissues and at the sites of infection. The subunits of TCR heterodimers are covalently bonded and in the endoplasmic reticulum they associate with CD3 subunits to form functional TCR-CD3 complex. Lack of expression of any of the chains is sufficient to stop cell surface expression.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Applications:
FC
Additional Info:
The mouse monoclonal antibody IP26 recognizes a monomorphic extracellular determinant of TCR alpha/beta, the dominant subtype of T cell receptor expressed in human peripheral blood.
Clone number:
IP26
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
Alpha-beta T cell receptors (TCRs) are antigen specific receptors, which are essential to the immune response and are present on the cell surface of T lymphocytes. They recognize peptide-loaded major histocompatibility complexes (pMHCs), that are displayed by antigen presenting cells (APCs). Binding of alpha-beta TCR to pMHC initiates TCR-CD3 clustering on the cell surface and intracellular activation of LCK, that phosphorylates the ITAM motifs of CD3gamma, CD3delta, CD3epsilon and CD3zeta, enabling the recruitment of ZAP70. In turn, ZAP70 phosphorylates LAT, which recruits numerous signaling molecules to form the LAT signalosome. The LAT signalosome propagates signal branching to three major signaling pathways, the calcium signaling, the mitogen-activated protein kinase (MAPK) kinase and the nuclear factor NFkappaB (NF-kB) pathways, leading to the mobilization of transcription factors, that are critical for gene expression and essential for T cell growth and differentiation. The T cell repertoire is generated by V-D-J-C rearrangements. This repertoire is then shaped by intrathymic selection events to generate a peripheral T cell pool of self-MHC restricted, non-autoaggressive T cells. Post-thymic interaction of alpha-beta TCRs with the pMHCs shapes TCR structural and functional avidity.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
thymus, spleen, and mesenteric lymph nodes isolated from a mouse transgenic for human TCR Vbeta3Cbeta1
Applications:
FC
Additional Info:
The mouse monoclonal antibody JOVI.1 recognizes an extracellular epitope on TCR Cbeta1 (TRBC1).
Clone number:
JOVI.1
Antibody Isotype:
IgG2a k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
Alpha-beta T cell receptors (TCRs) are antigen specific receptors, which are essential to the immune response and are present on the cell surface of T lymphocytes. They recognize peptide-loaded major histocompatibility complexes (pMHCs), that are displayed by antigen presenting cells (APCs). Binding of alpha-beta TCR to pMHC initiates TCR-CD3 clustering on the cell surface and intracellular activation of LCK, that phosphorylates the ITAM motifs of CD3gamma, CD3delta, CD3epsilon and CD3zeta, enabling the recruitment of ZAP70. In turn, ZAP70 phosphorylates LAT, which recruits numerous signaling molecules to form the LAT signalosome. The LAT signalosome propagates signal branching to three major signaling pathways, the calcium signaling, the mitogen-activated protein kinase (MAPK) kinase and the nuclear factor NFkappaB (NF-kB) pathways, leading to the mobilization of transcription factors, that are critical for gene expression and essential for T cell growth and differentiation. The T cell repertoire is generated by V-D-J-C rearrangements. This repertoire is then shaped by intrathymic selection events to generate a peripheral T cell pool of self-MHC restricted, non-autoaggressive T cells. Post-thymic interaction of alpha-beta TCRs with the pMHCs shapes TCR structural and functional avidity.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
thymus, spleen, and mesenteric lymph nodes isolated from a mouse transgenic for human TCR Vbeta3Cbeta1
Applications:
FC
Additional Info:
The mouse monoclonal antibody JOVI.1 recognizes an extracellular epitope on TCR Cbeta1 (TRBC1).
Clone number:
JOVI.1
Antibody Isotype:
IgG2a k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD25 (IL2Ralpha, Tac) is a ligand-binding alpha subunit of interleukin 2 receptor (IL2R). Together with beta and gamma subunit CD25 constitues the high affinity IL2R, whereas CD25 alone serves as the low affinity IL2R. CD25 expression rapidly increases upon T cell activation. The 55 kDa CD25 molecule is enzymatically cleaved and shed from the cell surface as a soluble 45 kDa s-Tac, whose concentration in serum can be used as a marker of T cell activation. Expression of CD25 indicates the neoplastic phenotype of mast cells. CD25+ CD4+ FoxP3+ regulatory cells (Treg cells) play a crucial role in the control of organ-specific autoimmune diseases.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store in the dark at 2-8°C. Do not freeze. Avoid prolonged exposure to light. Do not use after expiration date stamped on vial label.
Immunogen:
B6.1 CTL cell line
Applications:
FC,IP,IHC,FA
Additional Info:
The rat monoclonal antibody PC61.5 (PC61.5.3) recognizes CD25 (Interleukin-2 receptor alpha chain), a 55 kDa type I transmembrane glycoprotein expressed on activated B and T lymphocytes, activated monocytes/macrophages and on CD4<sup>+</sup> T lymphocytes (T regulatory cells); it is lost on resting B and T lymphocytes.
TRAIL-R2 (CD262, DR5) is one of two TNF superfamily member intracellular death domain containing receptors for TRAIL (APO2L). Apoptosis, or programmed cell death, occurs during normal cellular differentiation and development of multicellular organisms. Apoptosis is induced by certain cytokines including tumor necrosis factor (TNF) and Fas ligand in the TNF family through their death domain containing receptors, TNF receptor 1 (TNFR1) and Fas, respectively. Another member in the TNF family has been identified and designated TRAIL (for TNF related apoptosis inducing ligand) and Apo2L (for Apo2 ligand). Receptors for TRAIL include two death domain containing receptors, DR4 and DR5, as well as two decoy receptors, DcR1 and DcR2, lacking the intracellular signaling death domain. DcR1 (also called TRID), like the related death receptors DR4 and DR5, contains two extracellular cysteine rich domains. However, DcR1 contains no intracellular death domain and is thus incapable of signaling apoptosis. It has been suggested DcR1 is responsible for TRAIL resistance in normal human tissues including heart, placenta, lung, liver, kidney, spleen, and bone marrow. DR5 is a member of the TNF receptor superfamily, and contains an intracellular death domain. This receptor can be activated by tumor necrosis factor related apoptosis inducing ligand (TNFSF10/TRAIL/APO2L), and transduces apoptosis signal. Studies with FADD deficient mice suggested that FADD, a death domain containing adaptor protein, is required for the apoptosis mediated by this protein.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store in the dark at 2-8°C. Do not freeze. Avoid prolonged exposure to light. Do not use after expiration date stamped on vial label.
Immunogen:
Recombinant fusion protein of human IgG heavy chain and extracellular domain of DR5.
Applications:
FC
Additional Info:
The antibody DR5-01-1 recognizes an extracellular domain of TRAIL-R2 (DR5). TRAIL-R2 is one of two TNF superfamily member intracellular death domain containing receptors for TRAIL (APO2L). _x000D_ _x000D_
TRAIL-R3 (CD263, TR3, DcR1, LIT, TRID), expressed mainly on neutrophils, belongs to receptors of TRAIL, a TNF-like membrane cytotoxic protein that induces apoptosis in many tumour cells, but not in normal cells. TRAIL-R3, however, is a GPI-anchored protein that lacks cytoplasmic death domain, thus it is unable to induce apoptosis and serves as a negative regulator of apoptotic signaling by competing for binding of TRAIL with death receptor 5 (DR5).
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store in the dark at 2-8°C. Do not freeze. Avoid prolonged exposure to light. Do not use after expiration date stamped on vial label.
Immunogen:
TRAIL-R3 (aa 1-280) - hIgGhc fusion protein
Applications:
FC
Additional Info:
The antibody TRAIL-R3-02 reacts with TRAIL-R3, a 35 kDa GPI-anchored extracellular membrane protein expressed mainly on neutrophils.
CD3 complex is crucial in transducing antigen-recognition signals into the cytoplasm of T cells and in regulating the cell surface expression of the TCR complex. T cell activation through the antigen receptor (TCR) involves the cytoplasmic tails of the CD3 subunits CD3 gamma, CD3 delta, CD3 epsilon and CD3 zeta. These CD3 subunits are structurally related members of the immunoglobulins super family encoded by closely linked genes on human chromosome 11. The CD3 components have long cytoplasmic tails that associate with cytoplasmic signal transduction molecules. This association is mediated at least in part by a double tyrosine-based motif present in a single copy in the CD3 subunits. CD3 may play a role in TCR-induced growth arrest, cell survival and proliferation._x000D_ The CD3 antigen is present on 68-82% of normal peripheral blood lymphocytes, 65-85% of thymocytes and Purkinje cells in the cerebellum. It is never expressed on B or NK cells. Decreased percentages of T lymphocytes may be observed in some autoimmune diseases.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store in the dark at 2-8°C. Do not freeze. Avoid prolonged exposure to light. Do not use after expiration date stamped on vial label.
Immunogen:
Human thymocytes
Applications:
FC,WB,IHC,ICC
Additional Info:
The mouse monoclonal antibody SK7 recognizes the CD3 antigen of the TCR/CD3 complex on mature human T cells. This antibody reacts with the epsilon chain of the CD3 complex. The monoclonal antibodies SK7 and UCHT1 recognize overlapping epitopes._x000D_ <br><b>HLDA II; WS Code T118<br>_x000D_ HLDA III; WS Code T492</b>
The antigen-specific T cell receptor (TCR) is composed of either alpha and beta subunit, or gamma and delta subunit. Majority of T cells present in the blood, lymph and secondary lymphoid organs express TCR alpha/beta heterodimers, whereas the T cells expressing TCR gamma/delta heterodimers are localized mainly in epithelial tissues and at the sites of infection. The subunits of TCR heterodimers are covalently bonded and in the endoplasmic reticulum they associate with CD3 subunits to form functional TCR-CD3 complex. Lack of expression of any of the chains is sufficient to stop cell surface expression.
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
The antigen-specific T cell receptor (TCR) is composed of either alpha and beta subunit, or gamma and delta subunit. Majority of T cells present in the blood, lymph and secondary lymphoid organs express TCR alpha/beta heterodimers, whereas the T cells expressing TCR gamma/delta heterodimers are localized mainly in epithelial tissues and at the sites of infection. The subunits of TCR heterodimers are covalently bonded and in the endoplasmic reticulum they associate with CD3 subunits to form functional TCR-CD3 complex. Lack of expression of any of the chains is sufficient to stop cell surface expression.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Applications:
FC
Additional Info:
The mouse monoclonal antibody B1 (also known as B1.1) recognizes an extracellular epitope of TCR gamma/delta, the subtype of T cell receptor expressed mainly in epithelial tissues and at the sites of infection.
Clone number:
B1
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD3 complex is crucial in transducing antigen-recognition signals into the cytoplasm of T cells and in regulating the cell surface expression of the TCR complex. T cell activation through the antigen receptor (TCR) involves the cytoplasmic tails of the CD3 subunits CD3 gamma, CD3 delta, CD3 epsilon and CD3 zeta. These CD3 subunits are structurally related members of the immunoglobulins super family encoded by closely linked genes on human chromosome 11. The CD3 components have long cytoplasmic tails that associate with cytoplasmic signal transduction molecules. This association is mediated at least in part by a double tyrosine-based motif present in a single copy in the CD3 subunits. CD3 may play a role in TCR-induced growth arrest, cell survival and proliferation._x000D_ The CD3 antigen is present on 68-82% of normal peripheral blood lymphocytes, 65-85% of thymocytes and Purkinje cells in the cerebellum. It is never expressed on B or NK cells. Decreased percentages of T lymphocytes may be observed in some autoimmune diseases.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store in the dark at 2-8°C. Do not freeze. Avoid prolonged exposure to light. Do not use after expiration date stamped on vial label.
Immunogen:
Human thymocytes
Applications:
FC,WB,IHC,ICC
Additional Info:
The mouse monoclonal antibody SK7 recognizes the CD3 antigen of the TCR/CD3 complex on mature human T cells. This antibody reacts with the epsilon chain of the CD3 complex. The monoclonal antibodies SK7 and UCHT1 recognize overlapping epitopes._x000D_ <br><b>HLDA II; WS Code T118<br>_x000D_ HLDA III; WS Code T492</b>
CD3 complex is crucial in transducing antigen-recognition signals into the cytoplasm of T cells and in regulating the cell surface expression of the TCR complex. T cell activation through the antigen receptor (TCR) involves the cytoplasmic tails of the CD3 subunits CD3 gamma, CD3 delta, CD3 epsilon and CD3 zeta (CD247). These CD3 subunits are structurally related members of the immunoglobulins super family encoded by closely linked genes on human chromosome 11. The CD3 components have long cytoplasmic tails that associate with cytoplasmic signal transduction molecules. This association is mediated at least in part by a double tyrosine-based motif present in a single copy in the CD3 subunits. CD3 may play a role in TCR-induced growth arrest, cell survival and proliferation.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store in the dark at 2-8°C. Do not freeze. Avoid prolonged exposure to light. Do not use after expiration date stamped on vial label.
Immunogen:
Synthetic peptide corresponding to amino acids 151-164 of mouse CD3 zeta. _x000D_
Applications:
FC,IP,WB,ICC
Additional Info:
The Armenian hamster antibody H146-968 reacts with CD3 zeta chain (CD247), which is a component of TCR/CD3 complex expressed on T cells.
TCR Vdelta2 is a variant of TCR delta chain, that is present on a major subset of human gamma/delta T cells. TCR Vgamma9/Vdelta2 (or Vgamma2/Vdelta2) T cells are able to recognize and kill various tumor cells, as this receptor heterodimer binds to certain phosphoantigens, expressed by tumors. They can recognize these antigens in an MHC-unrestricted manner. Similarly to NK cells, Vdelta2 T cells express MHC I receptors and killer Ig-like receptors, that are involved in tumor recognition and cytolysis. The potently cytotoxic subset of them is identified by cell surface expression of polysialyated CD56.
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Vimentin (57 kDa) is the most ubiquituos intermediate filament protein and the first to be expressed during cell differentiation. All primitive cell types express vimentin but in most non-mesenchymal cells it is replaced by other intermediate filament proteins during differentiation. Vimentin is expressed in a wide variety of mesenchymal cell types - fibroblasts, endothelial cells etc., and in a number of other cell types derived from mesoderm, e.g., mesothelium and ovarian granulosa cells. In non-vascular smooth muscle cellsand striated muscle, vimentin is often replaced by desmin, however, during regeneration, vimentin is reexpressed. Cells of the lymfo-haemopoietic system (lymphocytes, macrophages etc.) also express vimentin, sometimes in scarce amounts. Vimentin is also found in mesoderm derived epithelia, e.g. kidney (Bowman capsule), endometrium and ovary (surface epithelium), in myoepithelial cells (breast, salivary and sweat glands), an in thyroid gland epithelium. In these cell types, as in mesothelial cells, vimentin is coexpressed with cytokeratin.Furthermore, vimentin is detected in many cells from the neural crest. Particularly melanocytes express abundant vimentin. In glial cells vimentin is coexpressed with Glial Fibrillary Acidic Protein (GFAP). Vimentin is present in many different neoplasms but is particulary expressed in those originated from mesenchymal cells. Sarcomas e.g., fibrosarcoma, malignt fibrous histiocytoma, angiosarcoma, and leio- and rhabdomyosarcoma, as well as lymphomas, malignant melanoma and schwannoma, are virtually always vimentin positive. Mesoderm derived carcinomas like renal cell carcinoma, adrenal cortical carcinoma and adenocarcinomas from endometrium and ovary usually express vimentin. Also thyroid carcinomas are vimentin positive. Any low differentiated carcinoma may express some vimentin. Vimentin is frequently included in the so-called primary panel (together with CD45, cytokeratin, and S-100 protein). Intense staining reaction for vimentin without coexpression of other intermediate filament proteins is strongly suggestive of a mesenchymal tumour or malignant melanoma.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Bacterially expressed full-length human vimentin
Applications:
FC
Additional Info:
The antibody VI-RE/1 reacts with human vimentin, a 57 kDa intermediate filament intracellular protein expressed on a wide variety of mesenchymal and mesodermal cell types.
Vimentin (57 kDa) is the most ubiquituos intermediate filament protein and the first to be expressed during cell differentiation. All primitive cell types express vimentin but in most non-mesenchymal cells it is replaced by other intermediate filament proteins during differentiation. Vimentin is expressed in a wide variety of mesenchymal cell types - fibroblasts, endothelial cells etc., and in a number of other cell types derived from mesoderm, e.g., mesothelium and ovarian granulosa cells. In non-vascular smooth muscle cellsand striated muscle, vimentin is often replaced by desmin, however, during regeneration, vimentin is reexpressed. Cells of the lymfo-haemopoietic system (lymphocytes, macrophages etc.) also express vimentin, sometimes in scarce amounts. Vimentin is also found in mesoderm derived epithelia, e.g. kidney (Bowman capsule), endometrium and ovary (surface epithelium), in myoepithelial cells (breast, salivary and sweat glands), an in thyroid gland epithelium. In these cell types, as in mesothelial cells, vimentin is coexpressed with cytokeratin.Furthermore, vimentin is detected in many cells from the neural crest. Particularly melanocytes express abundant vimentin. In glial cells vimentin is coexpressed with Glial Fibrillary Acidic Protein (GFAP). Vimentin is present in many different neoplasms but is particulary expressed in those originated from mesenchymal cells. Sarcomas e.g., fibrosarcoma, malignt fibrous histiocytoma, angiosarcoma, and leio- and rhabdomyosarcoma, as well as lymphomas, malignant melanoma and schwannoma, are virtually always vimentin positive. Mesoderm derived carcinomas like renal cell carcinoma, adrenal cortical carcinoma and adenocarcinomas from endometrium and ovary usually express vimentin. Also thyroid carcinomas are vimentin positive. Any low differentiated carcinoma may express some vimentin. Vimentin is frequently included in the so-called primary panel (together with CD45, cytokeratin, and S-100 protein). Intense staining reaction for vimentin without coexpression of other intermediate filament proteins is strongly suggestive of a mesenchymal tumour or malignant melanoma.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Bacterially expressed full-length human vimentin
Applications:
FC
Additional Info:
The antibody VI-RE/1 reacts with human vimentin, a 57 kDa intermediate filament intracellular protein expressed on a wide variety of mesenchymal and mesodermal cell types.
CD4 (T4) is a single chain transmembrane glycoprotein and belongs to immunoglobulin supergene family. In extracellular region there are 4 immunoglobulin-like domains (1 Ig-like V-type and 3 Ig-like C2-type). Transmembrane region forms 25 aa, cytoplasmic tail consists of 38 aa. Domains 1,2 and 4 are stabilized by disulfide bonds. The intracellular domain of CD4 is associated with p56Lck, a Src-like protein tyrosine kinase. It was described that CD4 segregates into specific detergent-resistant T-cell membrane microdomains. Extracellular ligands: MHC class II molecules (binds to CDR2-like region in CD4 domain 1); HIV envelope protein gp120 (binds to CDR2-like region in CD4 domain 1); IL-16 (binds to CD4 domain 3), human seminal plasma glycoprotein gp17 (binds to CD4 domain 1), L-selectin. Intracellular ligands: p56LckCD4 is a co-receptor involved in immune response (co-receptor activity in binding to MHC class II molecules) and HIV infection (human immunodeficiency virus; CD4 is primary receptor for HIV-1 surface glycoprotein gp120). CD4 regulates T-cell activation, T/B-cell adhesion, T-cell diferentiation, T-cell selection and signal transduction. Defects in antigen presentation (MHC class II) cause dysfunction of CD4+ T-cells and their almost complete absence in patients blood, tissue and organs (SCID immunodeficiency).
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
MLR generated rat Th cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody OX-35 reacts with an extracellular epitope of rat CD4 transmembrane glycoprotein (55 kDa).
TCR Vgamma4 is a variant of TCR gamma chain, that is present on a minor subset of human gamma/delta T cells.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human T cells
Applications:
FC
Clone number:
4A11.904
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
TCR Vgamma9 is a variant of TCR gamma chain, that is present on a subset of human gamma/delta T cells. TCR Vgamma9/Vdelta2 T cells are able to recognize and kill various tumor cells, as this receptor heterodimer binds to certain phosphoantigens, expressed by tumors.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human T cells
Applications:
FC
Clone number:
B3
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
TROP2 is a cell surface receptor that transduces calcium signals. It belongs to carcinoma-associated antigens. Mutations of TROP2 have been associated with gelatinous drop-like corneal dystrophy.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
TROP2-transfected CHO cells
Applications:
FC
Clone number:
TrMab-6
Antibody Isotype:
IgG2b k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD4 (T4) is a single chain transmembrane glycoprotein and belongs to immunoglobulin supergene family. In extracellular region there are 4 immunoglobulin-like domains (1 Ig-like V-type and 3 Ig-like C2-type). Transmembrane region forms 25 aa, cytoplasmic tail consists of 38 aa. Domains 1,2 and 4 are stabilized by disulfide bonds. The intracellular domain of CD4 is associated with p56Lck, a Src-like protein tyrosine kinase. It was described that CD4 segregates into specific detergent-resistant T-cell membrane microdomains. Extracellular ligands: MHC class II molecules (binds to CDR2-like region in CD4 domain 1); HIV envelope protein gp120 (binds to CDR2-like region in CD4 domain 1); IL-16 (binds to CD4 domain 3), human seminal plasma glycoprotein gp17 (binds to CD4 domain 1), L-selectin. Intracellular ligands: p56LckCD4 is a co-receptor involved in immune response (co-receptor activity in binding to MHC class II molecules) and HIV infection (human immunodeficiency virus; CD4 is primary receptor for HIV-1 surface glycoprotein gp120). CD4 regulates T-cell activation, T/B-cell adhesion, T-cell diferentiation, T-cell selection and signal transduction. Defects in antigen presentation (MHC class II) cause dysfunction of CD4+ T-cells and their almost complete absence in patients blood, tissue and organs (SCID immunodeficiency).
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
MLR generated rat Th cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody OX-35 reacts with an extracellular epitope of rat CD4 transmembrane glycoprotein (55 kDa).
The interferon gamma (IFN-gamma; 16-25 kDa) is an important regulator of the immune response, produced in activated Th1 cells and NK cells, particularly in response to IL-2, TNF-alpha and IL-12; its production is suppressed by IL-4, IL-10, and TGF-beta. The producing of IFN-gamma is activated by specific antigens or mitogens through the T cell antigen receptor. IFN-gamma polypeptide forms: 40-60 kDa forms are observable under non-denaturing conditions as dimers and trimers; 20 kDa and 25 kDa forms exist due to variable glycosylation. IFN-gamma belongs to the type II interferons, also called immune IFN. IFN-gamma shows antiviral activity and has important immunoregulatory functions. It is a potent activator of macrophages and had antiproliferative effects on transformed cells. IFN-gamma plays an important role in regulating B cell differentiation by simultaneously stimulating class switch recombination to the IgG3 and IgG2a isotypes while represing class switch recombination to the IgE and IgG1 isotypes. It also appears to promote antigen presentation by B cells through its effects on MHC. Binding of IFN-gamma to its receptor increases the expression of class I MHC on all somatic cells. It also enhances the expression of class II MHC on antigen-presenting cells. IFN-gamma is the major means by which T cells activate macrophages, increasing their ability to kill bacteria, parasites, and tumours. The activation of macrophages by IFN-gamma is essential for the elimination of bacteria that replicate within the phagosomes of macrophages (f.e. Mycobacteria and Listeria monocytogenes). IFN-gamma can potentiate the high antiviral and antitumor effects of the type I interferons (IFN-alpha, IFN-beta). IFN-gamma may also activate neutrophils and NK cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Interferon gamma derived from human leukocytes
Applications:
FC
Additional Info:
The mouse monoclonal antibody 4S.B3 recognizes IFN-gamma, a 16-25 kDa cytokine produced by activated Th1 cells and NK cells. Binds both glycosylated and non-glycosylated protein.
Clone number:
4S.B3
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests. Intracellular staining.
The interferon gamma (IFN-gamma; 16-25 kDa) is an important regulator of the immune response, produced in activated Th1 cells and NK cells, particularly in response to IL-2, TNF-alpha and IL-12; its production is suppressed by IL-4, IL-10, and TGF-beta. The producing of IFN-gamma is activated by specific antigens or mitogens through the T cell antigen receptor. IFN-gamma polypeptide forms: 40-60 kDa forms are observable under non-denaturing conditions as dimers and trimers; 20 kDa and 25 kDa forms exist due to variable glycosylation. IFN-gamma belongs to the type II interferons, also called immune IFN. IFN-gamma shows antiviral activity and has important immunoregulatory functions. It is a potent activator of macrophages and had antiproliferative effects on transformed cells. IFN-gamma plays an important role in regulating B cell differentiation by simultaneously stimulating class switch recombination to the IgG3 and IgG2a isotypes while represing class switch recombination to the IgE and IgG1 isotypes. It also appears to promote antigen presentation by B cells through its effects on MHC. Binding of IFN-gamma to its receptor increases the expression of class I MHC on all somatic cells. It also enhances the expression of class II MHC on antigen-presenting cells. IFN-gamma is the major means by which T cells activate macrophages, increasing their ability to kill bacteria, parasites, and tumours. The activation of macrophages by IFN-gamma is essential for the elimination of bacteria that replicate within the phagosomes of macrophages (f.e. Mycobacteria and Listeria monocytogenes). IFN-gamma can potentiate the high antiviral and antitumor effects of the type I interferons (IFN-alpha, IFN-beta). IFN-gamma may also activate neutrophils and NK cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Interferon gamma derived from human leukocytes
Applications:
FC
Additional Info:
The mouse monoclonal antibody 4S.B3 recognizes IFN-gamma, a 16-25 kDa cytokine produced by activated Th1 cells and NK cells. Binds both glycosylated and non-glycosylated protein.
Clone number:
4S.B3
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests. Intracellular staining.
Hsp90 (heat shock protein 90) is one of the most abundant chaperones in the cytosol of eukaryotic cells. It interacts with various proteins, including protein kinases and transcription factors, and either facilitates their stabilization and activation or directs them for proteasomal degradation. Hsp90 thus affects multiple signaling pathways and biological processes and modulation of this single target offers the prospect of simultaneous intervence to various key points of oncogenic transformation. Hsp90 operates as a dimer in a conformational cycle driven by ATP binding and hydrolysis. There are two isoforms, alpha and beta, of vertebrate Hsp90. Whereas Hsp90 beta is expressed constitutively to a high level, Hsp90 alpha is stress-inducible and is overexpressed in many cancerous cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Do not freeze.
Immunogen:
Peptide corresponding to the sequence EEVHHGEEEVEC within N-terminal part of human Hsp90.
Applications:
WB,IHC
Additional Info:
The antibody MBH90AB recognizes the epitope EEEVE within N-terminal part of ubiquitously expressed Hsp90 alpha and Hsp90 beta intracellular proteins with calculated Mw of 84.7 kDa and 83.3 kDa, respectively, however, migrating as 90 kDa bands under reducing SDS-PAGE conditions.
CD11c (p150, alphaX integrin subunit) forms complex with CD18 (beta2 integrin subunit) and is expressed mainly on tissue macrophages and dendritic cells. CD11c binds to complement fragment iC3b, fibrinogen, VCAM-1 and ICAM-2 or e.g. CD90. Like other beta2 integrins, CD11c/CD18 plays roles in cell migration and phagocytosis. Moreover, interaction of CD11c/CD18 with plasminogen regulates plasmin activities, and interaction with heparin counteracts binding of iC3b.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Dendritic cells of synovial fluid
Applications:
FC
Additional Info:
The antibody BU15 reacts with an extracellular epitope of CD11c (alphaX, p150), a 150 kDa integrin expressed mainly on dendritic cells and tissue macrophages.
Clone number:
BU15
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD11c (p150, alphaX integrin subunit) forms complex with CD18 (beta2 integrin subunit) and is expressed mainly on tissue macrophages and dendritic cells. CD11c binds to complement fragment iC3b, fibrinogen, VCAM-1 and ICAM-2 or e.g. CD90. Like other beta2 integrins, CD11c/CD18 plays roles in cell migration and phagocytosis. Moreover, interaction of CD11c/CD18 with plasminogen regulates plasmin activities, and interaction with heparin counteracts binding of iC3b.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Dendritic cells of synovial fluid
Applications:
FC
Additional Info:
The antibody BU15 reacts with an extracellular epitope of CD11c (alphaX, p150), a 150 kDa integrin expressed mainly on dendritic cells and tissue macrophages.
Clone number:
BU15
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD11b (integrin alphaM subunit) is a 165-170 kDa type I transmembrane glycoprotein that non-covalently associates with integrin beta2 subunit (CD18); expression of the CD11b chain on the cell surface requires the presence of the CD18 antigen. CD11b/CD18 integrin (Mac-1, CR3) is highly expressed on NK cells, neutrophils, monocytes and less on macrophages. CD11b/CD18 integrin is implicated in various adhesive interactions of monocytes, macrophages and granulocytes, facilitating their diapedesis, as well as it mediates the uptake of complement coated particles, serving as a receptor for the iC3b fragment of the third complement component.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Rheumatoid synovial cells and human monocytes.
Applications:
FC
Additional Info:
The mouse monoclonal antibody ICRF44 recognizes an extracellular epitope of CD11b (Mac-1alpha), a 165-170 kDa type 1 transmembrane protein mainly expressed on monocytes, granulocytes and NK-cells.
Clone number:
ICRF44
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD11b (integrin alphaM subunit) is a 165-170 kDa type I transmembrane glycoprotein that non-covalently associates with integrin beta2 subunit (CD18); expression of the CD11b chain on the cell surface requires the presence of the CD18 antigen. CD11b/CD18 integrin (Mac-1, CR3) is highly expressed on NK cells, neutrophils, monocytes and less on macrophages. CD11b/CD18 integrin is implicated in various adhesive interactions of monocytes, macrophages and granulocytes, facilitating their diapedesis, as well as it mediates the uptake of complement coated particles, serving as a receptor for the iC3b fragment of the third complement component.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human granulocytes
Applications:
FC
Additional Info:
The antibody MEM-174 recognizes an extracellular epitope of CD11b antigen (Mac-1 alpha), a 165-170 kDa type I transmembrane protein mainly expressed on monocytes, granulocytes and NK-cells. The CD11b mediates neutrophil and monocyte interactions with stimulated endothelium.
Clone number:
MEM-174
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD11b (integrin alphaM subunit) is a 165-170 kDa type I transmembrane glycoprotein that non-covalently associates with integrin beta2 subunit (CD18); expression of the CD11b chain on the cell surface requires the presence of the CD18 antigen. CD11b/CD18 integrin (Mac-1, CR3) is highly expressed on NK cells, neutrophils, monocytes and less on macrophages. CD11b/CD18 integrin is implicated in various adhesive interactions of monocytes, macrophages and granulocytes, facilitating their diapedesis, as well as it mediates the uptake of complement coated particles, serving as a receptor for the iC3b fragment of the third complement component.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human granulocytes
Applications:
FC
Additional Info:
The antibody MEM-174 recognizes an extracellular epitope of CD11b antigen (Mac-1 alpha), a 165-170 kDa type I transmembrane protein mainly expressed on monocytes, granulocytes and NK-cells. The CD11b mediates neutrophil and monocyte interactions with stimulated endothelium.
Clone number:
MEM-174
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD11b (integrin alphaM subunit) is a 165-170 kDa type I transmembrane glycoprotein that non-covalently associates with integrin beta2 subunit (CD18); expression of the CD11b chain on the cell surface requires the presence of the CD18 antigen. CD11b/CD18 integrin (Mac-1, CR3) is highly expressed on NK cells, neutrophils, monocytes and less on macrophages. CD11b/CD18 integrin is implicated in various adhesive interactions of monocytes, macrophages and granulocytes, facilitating their diapedesis, as well as it mediates the uptake of complement coated particles, serving as a receptor for the iC3b fragment of the third complement component.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Rheumatoid synovial cells and human monocytes.
Applications:
FC
Clone number:
ICRF44
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD11b (integrin alphaM subunit) is a 165-170 kDa type I transmembrane glycoprotein that non-covalently associates with integrin beta2 subunit (CD18); expression of the CD11b chain on the cell surface requires the presence of the CD18 antigen. CD11b/CD18 integrin (Mac-1, CR3) is highly expressed on NK cells, neutrophils, monocytes and less on macrophages. CD11b/CD18 integrin is implicated in various adhesive interactions of monocytes, macrophages and granulocytes, facilitating their diapedesis, as well as it mediates the uptake of complement coated particles, serving as a receptor for the iC3b fragment of the third complement component.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Information not available
Applications:
FC
Additional Info:
The mouse monoclonal antibody CBRM1/5 recognizes an activation-dependent epitope on extracellular part of CD11b (Mac-1alpha), a 165-170 kDa type 1 transmembrane protein mainly expressed on monocytes, granulocytes and NK-cells. The antibody recognizes a subset of CD11b molecules on neutrophils and monocytes activated with chemoattractants or phorbol esters and it does not recognize CD11b on non-activated cells.
Clone number:
CBRM1/5
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD11a (LFA-1 alpha) together with CD18 constitute leukocyte function-associated antigen 1 (LFA-1), the alphaLbeta2 integrin. CD11a is implicated in activation of LFA-1 complex. LFA-1 is expressed on the plasma membrane of leukocytes in a low-affinity conformation. Cell stimulation by chemokines or other signals leads to induction the high-affinity conformation, which supports tight binding of LFA-1 to its ligands, the intercellular adhesion molecules ICAM-1, -2, -3. LFA-1 is thus involved in interaction of various immune cells and in their tissue-specific settlement, but participates also in control of cell differentiation and proliferation and of T-cell effector functions. Blocking of LFA-1 function by specific antibodies or small molecules has become an important therapeutic approach in treatment of multiple inflammatory diseases. For example, humanized anti-LFA-1 antibody Efalizumab (Raptiva) is being used to interfere with T cell migration to sites of inflammation; binding of cholesterol-lowering drug simvastatin to CD11a allosteric site leads to immunomodulation and increase in lymphocytic cholinergic activity.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Leukocytes from a patient suffering from a LGL-type leukaemia.
Applications:
FC
Additional Info:
The antibody MEM-25 reacts with an extracellular epitope of CD11a (alpha subunit of human LFA-1), a 170-180 kDa type I transmembrane glycoprotein expressed on B and T lymphocytes, monocytes, macrophages, neutrophils, basophils and eosinophils.
Clone number:
MEM-25
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD11a (LFA-1 alpha) together with CD18 constitute leukocyte function-associated antigen 1 (LFA-1), the alphaLbeta2 integrin. CD11a is implicated in activation of LFA-1 complex. LFA-1 is expressed on the plasma membrane of leukocytes in a low-affinity conformation. Cell stimulation by chemokines or other signals leads to induction the high-affinity conformation, which supports tight binding of LFA-1 to its ligands, the intercellular adhesion molecules ICAM-1, -2, -3. LFA-1 is thus involved in interaction of various immune cells and in their tissue-specific settlement, but participates also in control of cell differentiation and proliferation and of T-cell effector functions. Blocking of LFA-1 function by specific antibodies or small molecules has become an important therapeutic approach in treatment of multiple inflammatory diseases. For example, humanized anti-LFA-1 antibody Efalizumab (Raptiva) is being used to interfere with T cell migration to sites of inflammation; binding of cholesterol-lowering drug simvastatin to CD11a allosteric site leads to immunomodulation and increase in lymphocytic cholinergic activity.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human peripheral blood lymphocytes
Applications:
FC
Additional Info:
The antibody MEM-83 reacts with an extracellular epitope of CD11a (alpha subunit of human LFA-1), a 170-180 kDa type I transmembrane glycoprotein expressed on B and T lymphocytes, monocytes, macrophages, neutrophils, basophils and eosinophils.
Clone number:
MEM-83
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD11a (LFA-1 alpha) together with CD18 constitute leukocyte function-associated antigen 1 (LFA-1), the alphaLbeta2 integrin. CD11a is implicated in activation of LFA-1 complex. LFA-1 is expressed on the plasma membrane of leukocytes in a low-affinity conformation. Cell stimulation by chemokines or other signals leads to induction the high-affinity conformation, which supports tight binding of LFA-1 to its ligands, the intercellular adhesion molecules ICAM-1, -2, -3. LFA-1 is thus involved in interaction of various immune cells and in their tissue-specific settlement, but participates also in control of cell differentiation and proliferation and of T-cell effector functions. Blocking of LFA-1 function by specific antibodies or small molecules has become an important therapeutic approach in treatment of multiple inflammatory diseases. For example, humanized anti-LFA-1 antibody Efalizumab (Raptiva) is being used to interfere with T cell migration to sites of inflammation; binding of cholesterol-lowering drug simvastatin to CD11a allosteric site leads to immunomodulation and increase in lymphocytic cholinergic activity.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Leukocytes from a patient suffering from a LGL-type leukaemia.
Applications:
FC
Additional Info:
The antibody MEM-25 reacts with an extracellular epitope of CD11a (alpha subunit of human LFA-1), a 170-180 kDa type I transmembrane glycoprotein expressed on B and T lymphocytes, monocytes, macrophages, neutrophils, basophils and eosinophils.
Clone number:
MEM-25
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD117 / c-Kit (stem cell factor receptor) is a 145 kDa receptor tyrosine kinase that regulates cell proliferation, adhesion, chemotaxis, apoptosis and other cell processes. Mutations of CD117 / c-Kit can lead to growth and progression of tumours. After binding of its ligand, SCF (stem cell factor), CD117 / c-Kit is autophosphorylated on its intracellular domains and activated. CD117 is expressed on pluripotent hematopoietic progenitor cells, mast cells and various cancer cells, e.g. acute myeloid leukemia cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
MOLM-1 megakaryocytic cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 104D2 detects extracellular part of CD117 / c-Kit protooncogen.
Clone number:
104D2
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD117 / c-Kit (stem cell factor receptor) is a 145 kDa receptor tyrosine kinase that regulates cell proliferation, adhesion, chemotaxis, apoptosis and other cell processes. Mutations of CD117 / c-Kit can lead to growth and progression of tumours. After binding of its ligand, SCF (stem cell factor), CD117 / c-Kit is autophosphorylated on its intracellular domains and activated. CD117 is expressed on pluripotent hematopoietic progenitor cells, mast cells and various cancer cells, e.g. acute myeloid leukemia cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
MOLM-1 megakaryocytic cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 104D2 detects extracellular part of CD117 / c-Kit protooncogen.
Clone number:
104D2
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD116 (GM-CSF R alpha) is the low affinity receptor for granulocyte-macrophage colony-stimulating factor (GM-CSF). CD116 heterodimerizes with CD131, the common beta chain subunit shared with IL-3 and IL5- receptors, to form the high affinity GM-CSF receptor. CD116 is expressed by myeloid cells including macrophages, neutrophils, eosinophils, dendritic cells, and their precursors, as well as on endothelial cells. It is being used as a specific marker of myeloid leukemias.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
CD116-transfected COS cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 4H1 recognizes an extracellular epitope of human CD116, the GM-CSF receptor alpha subunit (approx. 80 kDa) expressed e.g. by neutrophils, eosinophils, monocytes and macrophages.
Clone number:
4H1
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD114 / G-CSFR (granulocyte colony-stimulating factor receptor, also known as CSF3R) is a type I transmembrane glycoprotein which upon binding of its ligand (G-CSF, granulocyte colony-stimulating factor) homodimerizes and activates signaling transduction to mediate cell proliferation, survival, and differentiation. It is expressed by granulocytes at all stages of their differentiation, as well as by monocytes, dendritic cells, and mature platelets. Among non-hematopoietic cells, it is expressed e.g. by endothelial cells, placenta, trophoblasts, and many tumor cell lines. This antigen is a target for stem cell mobilization for blood stem cell transplantation, for enhancing recovery of myelopoiesis following chemotherapy and in the treatment of patients with severe chronic neutropenia.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
CHO cells transfected with human CD114
Applications:
FC
Additional Info:
The mouse monoclonal antibody LMM741 recognizes an extracellular epitope of CD114 (colony stimulating factor 3 receptor), a 130 kDa transmembrane glycoprotein expressed on granulocytes and their differentiation stages, on monocytes, platelets, endothelial cells and placenta. It is absent from lymphocytes and erythrocytes.
Clone number:
LMM741
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD112, also known as nectin-2, is a transmembrane glycoprotein involved in organization of adherens junctions. It also serves as a target molecule for entry of certain strains of herpes simplex virus (HSV) and pseudorabies virus (PRV). It is homologous to CD155, which serves as a target molecule for polio virus. CD112 seems to play a role in neural tube formation, with N-cadherin. Inside the cell, CD112 is connected with actin cytoskeleton through afadin. Variations in the CD112 gene have been associated with differences in the severity of multiple sclerosis. Alternate transcriptional splice variants, encoding different isoforms, have been characterized.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
NIH/3T3 cells transfected with human Nectin-2
Applications:
FC
Additional Info:
The mouse monoclonal antibody R2.525 recognizes an extracellular epitope on CD112, a type I transmembrane glycoprotein expressed by myelomonocytic and megakaryocytic cells, and by CD34+ hematopoietic progenitors.
Clone number:
R2.525
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD111, also known as nectin-1, is a calcium-independent cell-cell adhesion transmembrane glycoprotein involved in organization of adherens junctions and tight junctions in epithelial and endothelial cells. It also serves as a target molecule for entry of herpes simplex virus (HSV-1, HSV-2) and pseudorabies virus (PRV) into epithelial and neuronal cells. CD111 is connected with actin cytoskeleton through afadin. Mutations in the gene for CD111 cause cleft lip and palate/ectodermal dysplasia 1 syndrome (CLPED1) as well as non-syndromic cleft lip with or without cleft palate (CL/P). Alternative splicing results in multiple transcript variants encoding proteins with distinct C-termini.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
NIH/3T3 cells transfected with human CD111
Applications:
FC
Additional Info:
The mouse monoclonal antibody R1.302 recognizes an extracellular epitope on CD111 (also known as Nectin 1), a 75 kDa type I transmembrane glycoprotein broadly expressed on endothelial cells, epithelial cells, neuronal cells, megakaryocytes, and CD34-positive stem cells.
Clone number:
R1.302
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD109, also known as the Gov platelet alloantigen, is a GPI-anchored glycoprotein which localizes to the surface of platelets, activated T-cells, and endothelial cells, as well as of various hematopoietic cells and T cell lines. The protein binds to and negatively regulates signaling by transforming growth factor beta (TGF-beta). Multiple transcript variants encoding different isoforms have been found for this gene. The Gov antigen system is involved in platelet transfusion reaction, posttransfusion purpura and in neonatal alloimmune thrombocytopenia.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
WERI-RB-1 retinoblastoma cell line
Applications:
FC
Additional Info:
The mouse monoclonal antibody W7C5 recognizes CD109, an approximately 165 kDa GPI-anchored extracellular protein expressed mainly on various hematopoietic cells, activated T lymphoblasts, activated platelets, and endothelial cells.
Clone number:
W7C5
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD107b (lysosome-associated membrane protein-2, LAMP-2), together with CD107a / LAMP-1, is a major constituent of lysosomal membrane. The LAMP proteins are involved in lysosome biogenesis and are required for fusion of lysosomes with phagosomes, especially CD107b is important regulator in successful phagosomal maturation. CD107b deficiency causes an accumulation of autophagosomes in many tissues leading to cardiomyopathy and myopathy (Danons disease). Immature CD107b is an approximately 45 kDa protein, but after extensive glycosylation the mature glycoprotein has about 100-120 kDa.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human PBMC
Applications:
FC
Additional Info:
The mouse monoclonal antibody H4B4 recognizes an extracellular/luminal epitope of CD107b / LAMP-2, an extensively glycosylated 100-120 kDa widely expressed lysosome-associated protein.
Clone number:
H4B4
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests. Intracellular and extracellular staining.
CD107b (lysosome-associated membrane protein-2, LAMP-2), together with CD107a / LAMP-1, is a major constituent of lysosomal membrane. The LAMP proteins are involved in lysosome biogenesis and are required for fusion of lysosomes with phagosomes, especially CD107b is important regulator in successful phagosomal maturation. CD107b deficiency causes an accumulation of autophagosomes in many tissues leading to cardiomyopathy and myopathy (Danons disease). Immature CD107b is an approximately 45 kDa protein, but after extensive glycosylation the mature glycoprotein has about 100-120 kDa.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human PBMC
Applications:
FC
Additional Info:
The mouse monoclonal antibody H4B4 recognizes an extracellular/luminal epitope of CD107b / LAMP-2, an extensively glycosylated 100-120 kDa widely expressed lysosome-associated protein.
Clone number:
H4B4
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests. Intracellular and extracellular staining.
CD107a (lysosome-associated membrane protein-1, LAMP-1), together with LAMP-2, is a major constituent of lysosomal membrane, 1-2% of total CD107a is found also on the plasma membrane. The LAMP proteins are involved in lysosome biogenesis and are required for fusion of lysosomes with phagosomes. Increased CD107a immunoreactivity is observed in neurones, and in glial cells surrounding senile plaques in Alzheimers disease cases and is localized mainly in medullary epithelial cells, single macrophages and lymphocytes in acute thymic involution. CD107a is a good marker of mast cell activation.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human PBMC
Applications:
FC
Additional Info:
The mouse monoclonal antibody H4A3 recognizes an extracellular/luminal epitope of CD107a, an approximately 100-120 kDa glycoprotein expressed mainly on lysosomal, but also on the plasma membrane.
Clone number:
H4A3
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 4 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (0.4 ml) is sufficient for 100 tests. Intracellular and extracellular staining.
CD107a (lysosome-associated membrane protein-1, LAMP-1), together with LAMP-2, is a major constituent of lysosomal membrane, 1-2% of total CD107a is found also on the plasma membrane. The LAMP proteins are involved in lysosome biogenesis and are required for fusion of lysosomes with phagosomes. Increased CD107a immunoreactivity is observed in neurones, and in glial cells surrounding senile plaques in Alzheimers disease cases and is localized mainly in medullary epithelial cells, single macrophages and lymphocytes in acute thymic involution. CD107a is a good marker of mast cell activation.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human PBMC
Applications:
FC
Additional Info:
The mouse monoclonal antibody H4A3 recognizes an extracellular/luminal epitope of CD107a, an approximately 100-120 kDa glycoprotein expressed mainly on lysosomal, but also on the plasma membrane.
Clone number:
H4A3
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests. Intracellular and extracellular staining.
CD106 / VCAM-1 (vascular cell adhesion molecule-1) is an Ig-like cell surface adhesion molecule binding VLA-4 integrin. VCAM-1 is a potent T cell costimulatory molecule taking part in their positive selection and survival, as well as in adhesion, transendothelial migration and activation of peripheral T cells. VCAM-1 is also involved in endothelial cell-cell contacts. Whereas VCAM-1 normally mediates leukocyte extravasion to sites of tissue inflammation, tumour cells can use overexpressed VCAM-1 to escape T cell immunity. Soluble form of VCAM-1 (sVCAM-1) is an inflammatory marker and can be used also in prognosis of subsequent cariovascular events following acute coronary syndromes.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human DS6 T cell line
Applications:
FC
Additional Info:
The mouse monoclonal antibody STA recognizes an extracellular epitope of CD106 antigen (VCAM-1), a 100-110 kDa type I membrane protein of the immunoglobulin superfamily, a crucial mediator of leukocyte adhesion, and a costimulation molecule.
Clone number:
STA
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD106 / VCAM-1 (vascular cell adhesion molecule-1) is an Ig-like cell surface adhesion molecule binding VLA-4 integrin. VCAM-1 is a potent T cell costimulatory molecule taking part in their positive selection and survival, as well as in adhesion, transendothelial migration and activation of peripheral T cells. VCAM-1 is also involved in endothelial cell-cell contacts. Whereas VCAM-1 normally mediates leukocyte extravasion to sites of tissue inflammation, tumour cells can use overexpressed VCAM-1 to escape T cell immunity. Soluble form of VCAM-1 (sVCAM-1) is an inflammatory marker and can be used also in prognosis of subsequent cariovascular events following acute coronary syndromes.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human DS6 T cell line
Applications:
FC
Additional Info:
The mouse monoclonal antibody STA recognizes an extracellular epitope of CD106 antigen (VCAM-1), a 100-110 kDa type I membrane protein of the immunoglobulin superfamily, a crucial mediator of leukocyte adhesion, and a costimulation molecule.
Clone number:
STA
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD105 (endoglin) is a homodimeric transmembrane glycoprotein serving in presence of TGFbetaR-2 as a receptor for TGFbeta-1 and TGFbeta-3. CD105 is highly expressed on endothelial cells and promotes angiogenesis during wound healing, infarcts and in a wide range of tumours and its gene expression is stimulated by hypoxia. CD105 prevents apoptosis in hypoxic endothelial cells and also antagonises the inhibitory effects of TGFbeta-1 on vascular endothelial cell growth and migration. Normal cellular levels of CD105 are required for formation of new blood vessels.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Recombinant Vaccinia virus containing the human CD105 cDNA.
Applications:
FC
Additional Info:
The antibody MEM-226 reacts with an extracellular epitope of CD105 (Endoglin), a 90 kDa type I homodimerizing membrane glycoprotein expressed on vascular endothelial cells (small and large vessels), activated monocytes and tissue macrophages, stromal cells of certain tissues including bone marrow, pre-B lymphocytes in fetal marrow and erythroid precursors in fetal and adult bone marrow; it is also present on syncytiotrophoblast on placenta throughout pregnancy.
Clone number:
MEM-226
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD105 (endoglin) is a homodimeric transmembrane glycoprotein serving in presence of TGFbetaR-2 as a receptor for TGFbeta-1 and TGFbeta-3. CD105 is highly expressed on endothelial cells and promotes angiogenesis during wound healing, infarcts and in a wide range of tumours and its gene expression is stimulated by hypoxia. CD105 prevents apoptosis in hypoxic endothelial cells and also antagonises the inhibitory effects of TGFbeta-1 on vascular endothelial cell growth and migration. Normal cellular levels of CD105 are required for formation of new blood vessels.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Recombinant Vaccinia virus containing the human CD105 (L-isoform) cDNA.
Applications:
FC
Additional Info:
The antibody MEM-229 recognizes an extracellular epitope of CD105 (Endoglin), a 90 kDa type I integral membrane homodimer glycoprotein expressed on vascular endothelial cells (small and large vessels), activated monocytes and tissue macrophages, stromal cells of certain tissues including bone marrow, pre-B lymphocytes in fetal marrow and erythroid precursors in fetal and adult bone marrow; it is also present on syncytiotrophoblast on placenta throughout pregnancy.
Clone number:
MEM-229
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD105 (endoglin) is a homodimeric transmembrane glycoprotein serving in presence of TGFbetaR-2 as a receptor for TGFbeta-1 and TGFbeta-3. CD105 is highly expressed on endothelial cells and promotes angiogenesis during wound healing, infarcts and in a wide range of tumours and its gene expression is stimulated by hypoxia. CD105 prevents apoptosis in hypoxic endothelial cells and also antagonises the inhibitory effects of TGFbeta-1 on vascular endothelial cell growth and migration. Normal cellular levels of CD105 are required for formation of new blood vessels.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Recombinant Vaccinia virus containing the human CD105 cDNA.
Applications:
FC
Additional Info:
The antibody MEM-226 reacts with an extracellular epitope of CD105 (Endoglin), a 90 kDa type I homodimerizing membrane glycoprotein expressed on vascular endothelial cells (small and large vessels), activated monocytes and tissue macrophages, stromal cells of certain tissues including bone marrow, pre-B lymphocytes in fetal marrow and erythroid precursors in fetal and adult bone marrow; it is also present on syncytiotrophoblast on placenta throughout pregnancy.
Clone number:
MEM-226
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD103 / integrin alphaE is an integrin subunit that is expressed on intraepithelial lymphocytes, epithelial dendritic cells, lamina propria-derived dendritic cells, a subpopulation of lamina propria T cells, a small subset of peripheral lymphocytes, namely T reg cells, and on activated and TGF-beta stimulated lymphocytes. CD103 is in mature form cleaved into two disulfide-linked chains (C-terminal 150 kDa chain and N-terminal 25 kDa chain). It heterodimerizes with integrin beta7 subunit to form alphaE/beta7 integrin (mucosal lymphocyte 1 antigen), which through binding E-cadherin mediates homing of lymphocytes to the intestinal epithelium, and, in addition to the role in adhesion, may serve as an accessory molecule for intraepithelial lymphocyte activation.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
HTLV-1 induced human T cell line MAPS16
Applications:
FC
Additional Info:
The mouse monoclonal antibody Ber-ACT8 recognizes an extracellular epitope of CD103 (alpha E integrin), a type I transmembrane glycoprotein primarily found on intestinal intraepithelial lymphocytes.
Clone number:
Ber-ACT8
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD103 / integrin alphaE is an integrin subunit that is expressed on intraepithelial lymphocytes, epithelial dendritic cells, lamina propria-derived dendritic cells, a subpopulation of lamina propria T cells, a small subset of peripheral lymphocytes, namely T reg cells, and on activated and TGF-beta stimulated lymphocytes. CD103 is in mature form cleaved into two disulfide-linked chains (C-terminal 150 kDa chain and N-terminal 25 kDa chain). It heterodimerizes with integrin beta7 subunit to form alphaE/beta7 integrin (mucosal lymphocyte 1 antigen), which through binding E-cadherin mediates homing of lymphocytes to the intestinal epithelium, and, in addition to the role in adhesion, may serve as an accessory molecule for intraepithelial lymphocyte activation.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
HTLV-1 induced human T cell line MAPS16
Applications:
FC
Additional Info:
The mouse monoclonal antibody Ber-ACT8 recognizes an extracellular epitope of CD103 (alpha E integrin), a type I transmembrane glycoprotein primarily found on intestinal intraepithelial lymphocytes.
Clone number:
Ber-ACT8
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD102 / ICAM-2 (intracellular cell adhesion molecule-2), a counter receptor of LFA-1 (CD11a/CD18), is a transmembrane glycoprotein with two extracellular IgC-like domains and intracellular C-terminal tail. It is involved in lymphocyte recirculation and homing to the sites of inflammation. Through interaction with integrins it provides to the immune cells costimulatory signals. Expression of CD102 on blood cells (lymphocytes, monocytes, thrombocytes) is lower than on endothelium and follicular dendritic cells. CD102 levels are upregulated in lymph nodes with malignant infiltration.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human CD102 cDNA transfected COS cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody CBR-IC2/2 recognizes an extracellular epitope of CD102 (ICAM-2), an approximately 55 kDa type I transmembrane glycoprotein expressed mainly on vascular endothelial cells and folicular dendritic cells, in lower amount on lymphocytes, monocytes and platelets.
Clone number:
CBR-IC2/2
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD101 is a type I transmembrane glycoprotein, which forms disulfide-linked homodimers. It is expressed on activated T cells, as well as on granulocytes, monocytes, dendritic cells or mucosal T cells. It plays a major role in the activation of T cells by skin dendritic cells. Function of CD101 has not been fully elucidated, but in mice its knock-out results in liver autoimmune disease induced by Novosphingobium aromaticivorans.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human thymic clone B12
Applications:
FC
Additional Info:
The mouse monoclonal antibody BB27 recognizes an extracellular epitope of CD101, a 140 kDa disulfide-bonded homodimeric protein expressed on activated T cells, and some other cell types, such as granulocytes and cells of the monocyte/macropgage lineage.
Clone number:
BB27
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD100, also known as semaphorin 4D, is a homodimerizing type I transmembrane glycoprotein containing an extracellular semaphorin domain. It is expressed on most hematopoietic cells with the exception of immature bone marrow cells, erythrocytes and platelets. A 120 kDa soluble form is generated from the transmembrane form by proteolytic cascade following primary T and B cell activation. It seems CD100 acts through dampening CD72-mediated negative signaling. CD100 promotes angiogenesis, invasive growth, proliferation and anti-apoptosis of cancer cells in vitro. Higher expression levels of CD100 correlate with poor survival in soft tissue sarcoma patients.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
PHA stimulated human PBL
Applications:
FC
Additional Info:
The mouse monoclonal antibody 133-1C6 recognizes an extracellular epitope of CD100, an approximately 150 kDa (when reduced) semaphorin family member expressed mainly on lymphocytes, NK cells, monocytes/macrophages and granulocytes, but also on some non-hematopoietic cells.
Clone number:
133-1C6
Antibody Isotype:
IgM
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD10 (neutral endopeptidase – NEP, common acute lymphocytic leukemia antigen – CALLA, membrane metallo-endopeptidase – MME, enkefalinase) is a 100-kDa cell surface zinc metalloprotease, cleaving peptide bonds on the N-terminus of hydrophobic amino acids and inactivating multiple physiologically active peptids. CD10 is expressed on various normal cell types, including lymphoid precursor cells, germinal center B lymhocytes, and some epithelial cells, and its expression level serves as a marker for diagnostics of many carcinomas. CD10 is also a differentiation antigen for early B-lymphoid progenitors in the B-cell differentiation pathway and has a key role in regulation of growth, differentiation and signal transduction of many cellular systems.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
NALM-6 human pre-B cell line
Applications:
FC
Additional Info:
The antibody MEM-78 reacts with an extracellular epitope CD10 antigen (CALLA - Common acute lymphatic leukemia antigen), a 100 kDa type II integral membrane protein.
Clone number:
MEM-78
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD10 (neutral endopeptidase – NEP, common acute lymphocytic leukemia antigen – CALLA, membrane metallo-endopeptidase – MME, enkefalinase) is a 100-kDa cell surface zinc metalloprotease, cleaving peptide bonds on the N-terminus of hydrophobic amino acids and inactivating multiple physiologically active peptids. CD10 is expressed on various normal cell types, including lymphoid precursor cells, germinal center B lymhocytes, and some epithelial cells, and its expression level serves as a marker for diagnostics of many carcinomas. CD10 is also a differentiation antigen for early B-lymphoid progenitors in the B-cell differentiation pathway and has a key role in regulation of growth, differentiation and signal transduction of many cellular systems.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
NALM-6 human pre-B cell line
Applications:
FC
Additional Info:
The antibody MEM-78 reacts with an extracellular epitope CD10 antigen (CALLA - Common acute lymphatic leukemia antigen), a 100 kDa type II integral membrane protein.
Clone number:
MEM-78
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD10 (neutral endopeptidase – NEP, common acute lymphocytic leukemia antigen – CALLA, membrane metallo-endopeptidase – MME, enkefalinase) is a 100-kDa cell surface zinc metalloprotease, cleaving peptide bonds on the N-terminus of hydrophobic amino acids and inactivating multiple physiologically active peptids. CD10 is expressed on various normal cell types, including lymphoid precursor cells, germinal center B lymhocytes, and some epithelial cells, and its expression level serves as a marker for diagnostics of many carcinomas. CD10 is also a differentiation antigen for early B-lymphoid progenitors in the B-cell differentiation pathway and has a key role in regulation of growth, differentiation and signal transduction of many cellular systems.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
mouse NALM-6 leukemia pre-B cell line (tissue/cell preparation)
Applications:
FC
Additional Info:
The antibody LT10 reacts with an extracellular epitope of CD10 (CALLA - Common acute lymphatic leukemia antigen), a 100 kDa type II integral membrane protein.
Clone number:
LT10
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD10 (neutral endopeptidase – NEP, common acute lymphocytic leukemia antigen – CALLA, membrane metallo-endopeptidase – MME, enkefalinase) is a 100-kDa cell surface zinc metalloprotease, cleaving peptide bonds on the N-terminus of hydrophobic amino acids and inactivating multiple physiologically active peptids. CD10 is expressed on various normal cell types, including lymphoid precursor cells, germinal center B lymhocytes, and some epithelial cells, and its expression level serves as a marker for diagnostics of many carcinomas. CD10 is also a differentiation antigen for early B-lymphoid progenitors in the B-cell differentiation pathway and has a key role in regulation of growth, differentiation and signal transduction of many cellular systems.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
NALM-6 human pre-B cell line
Applications:
FC
Additional Info:
The antibody MEM-78 reacts with an extracellular epitope CD10 antigen (CALLA - Common acute lymphatic leukemia antigen), a 100 kDa type II integral membrane protein.
Clone number:
MEM-78
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
C5aR2, also known as C5L2, is one of two receptors for C5a (anaphylatoxin). It is coexpressed with C5aR1 (CD88) in neutrophils, as well as e.g. in mast cells, astrocytes, or macrophages, and seems to have both pro-inflammatory and anti-inflammatory roles, depending on circumstances. Unlike CD88, C5aR2 is not coupled to G-protein, thus the modulatory role is more likely.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
L1.2 cells transfected with human C5aR2
Applications:
FC
Clone number:
1D9-M12
Antibody Isotype:
IgG2a k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
Bcl2 (B cell chronic lymphatic leukemia protein 2) is a proto-oncogen, which can contribute to tumorigenesis by counteracting apoptosis in various cell types. The anti-apoptotic effect of Bcl2 is performed by its interactions with suppressors and agonists of cell death and under physiological conditions it is regulated by proteolytic processing and phosphorylation. Bcl2 expression can be detected mainly in lymphoid tissues and in the basal cells of epithelial tissues. It is also a marker that can help in classification of lymphoproliferative diseases and in prognostics of some epithelial neoplasms.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Synthetic peptide corresponding to the amino acids 41-54 of human Bcl2
Applications:
FC
Additional Info:
The mouse monoclonal antibody Bcl-2/100 recognizes Bcl2, a 26 kDa intracellular protooncogen with anti-apoptotic effect, expressed in outer mitochondrial membrane, endoplasmic reticulum and nuclear envelope.
Clone number:
Bcl-2/100
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 4 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (0.4 ml) is sufficient for 100 tests. Intracellular staining.
Hsp90 beta (heat shock protein 90 beta) is a constitutively expressed isoform of Hsp90, one of the most abundant chaperones in the cytosol of eukaryotic cells. Hsp90 interacts with various proteins, including protein kinases and transcription factors, and either facilitates their stabilization and activation or directs them for proteasomal degradation. Hsp90 thus affects multiple signaling pathways and biological processes and modulation of this single target offers the prospect of simultaneous intervence to various key points of oncogenic transformation. Hsp90 operates as a dimer in a conformational cycle driven by ATP binding and hydrolysis.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Do not freeze.
Immunogen:
Peptide corresponding to the EEVHHGEEEVEC sequence within N-terminal part of human Hsp90.
Applications:
IP,WB,ICC
Additional Info:
The antibody MBH90B recognizes the EEVHHG epitope within the N-terminal part of Hsp90 beta an ubiquitously expressed intracellular protein with calculated Mw of 83.3 kDa, however, migrating as a 90 kDa band under reducing SDS-PAGE conditions.
CD11c (p150, alphaX integrin subunit) forms complex with CD18 (beta2 integrin subunit) and is expressed mainly on tissue macrophages and dendritic cells. CD11c binds to complement fragment iC3b, fibrinogen, VCAM-1 and ICAM-2 or e.g. CD90. Like other beta2 integrins, CD11c/CD18 plays roles in cell migration and phagocytosis. Moreover, interaction of CD11c/CD18 with plasminogen regulates plasmin activities, and interaction with heparin counteracts binding of iC3b.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Dendritic cells of synovial fluid
Applications:
FC
Additional Info:
The antibody BU15 reacts with an extracellular epitope of CD11c (alphaX, p150), a 150 kDa integrin expressed mainly on dendritic cells and tissue macrophages.
Clone number:
BU15
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD273 / PD-L2 (programmed death ligand-1), also known as B7-DC, is a member of the B7 family of regulatory proteins. It costimulates the proliferation of T cells, and mediates IFN gamma production. Ligation of CD273 on dendritic cells enhances dendritic cell activation and T cell responses. When interacting with CD279, it can act as a coinhibitor of the T cell function. CD273 expression is a useful marker to distinguish primary mediastinal B cell lymphoma from other diffuse large B cell lymphomas.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human CD273 cDNA
Applications:
FC
Additional Info:
The mouse monoclonal antibody 24F.10C12 recognizes an extracellular epitope of CD273 / PD-L2 (also known as B7-DC), a 25 kDa type I transmembrane protein expressed by dendritic cells, activated monocytes and T cells, heart, first trimester placenta, lung and liver, as well as in Hodgkin´s lymphoma cells and primary mediastinal B cell lymphoma (PMBL).
Clone number:
24F.10C12
Antibody Isotype:
IgG2a k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD273 / PD-L2 (programmed death ligand-1), also known as B7-DC, is a member of the B7 family of regulatory proteins. It costimulates the proliferation of T cells, and mediates IFN gamma production. Ligation of CD273 on dendritic cells enhances dendritic cell activation and T cell responses. When interacting with CD279, it can act as a coinhibitor of the T cell function. CD273 expression is a useful marker to distinguish primary mediastinal B cell lymphoma from other diffuse large B cell lymphomas.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human CD273 cDNA
Applications:
FC
Additional Info:
The mouse monoclonal antibody 24F.10C12 recognizes an extracellular epitope of CD273 / PD-L2 (also known as B7-DC), a 25 kDa type I transmembrane protein expressed by dendritic cells, activated monocytes and T cells, heart, first trimester placenta, lung and liver, as well as in Hodgkin´s lymphoma cells and primary mediastinal B cell lymphoma (PMBL).
Clone number:
24F.10C12
Antibody Isotype:
IgG2a k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD272, a type I transmembrane glycoprotein, contains in its intracellular domain two ITIM sequences, which are upon CD272 triggering phosphorylated and recruit SHP phosphatases to attenuate cell activation. CD272 is expressed on B and T lymphocytes, NK cells, dendritic cells, and macrophages, and its ligand is CD270. Defects in CD272-CD270 inhibitory mechanism lead to autoimmune diseases. Overexpression of CD272 is a marker of tolerant T cells.
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
CD271 / NGFR, also known as p75NGFR or p75NTR, is a 75 kDa low affinity receptor for the NGF (nerve growth factor), BDNF (brain-derived growth factor), and other neurotrophins, such as NT3 and NT4/5. Unlike other members of the tumor necrosis factor receptor superfamily of transmembrane proteins, CD271 has unique intracellular domain structure (lacks catalytic activity) and downstream signaling partners. Triggered by its ligands CD271 affects growth, differentiation, migration and death of the nervous system cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Purified CD271 protein isolated from human melanoma cell line A875
Applications:
FC
Additional Info:
The mouse monoclonal antibody NGFR5 (originally C34C) recognizes an intracellular epitope of CD271/NGFR, a 75 kDa transmembrane glycoprotein of the TNFR superfamily. The epitope is localized within ammino acids 1 - 160.
Clone number:
NGFR5
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests. Extracellular and intracellular staining.
CD271 / NGFR, also known as p75NGFR or p75NTR, is a 75 kDa low affinity receptor for the NGF (nerve growth factor), BDNF (brain-derived growth factor), and other neurotrophins, such as NT3 and NT4/5. Unlike other members of the tumor necrosis factor receptor superfamily of transmembrane proteins, CD271 has unique intracellular domain structure (lacks catalytic activity) and downstream signaling partners. Triggered by its ligands CD271 affects growth, differentiation, migration and death of the nervous system cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Purified CD271 protein isolated from human melanoma cell line A875
Applications:
FC
Additional Info:
The mouse monoclonal antibody NGFR5 (originally C34C) recognizes an intracellular epitope of CD271/NGFR, a 75 kDa transmembrane glycoprotein of the TNFR superfamily. The epitope is localized within ammino acids 1 - 160.
Clone number:
NGFR5
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests. Extracellular and intracellular staining.
CD27 is a transmembrane 55 kDa protein of the nerve growth factor-receptor family, expressed as a disulfide-linked homodimer on mature thymocytes, peripheral blood T cells and a subpopulation of B cells. Activation of T cells via TCR-CD3 complex results in upregulation of CD27 expression on the plasma membrane as well as in the release of its soluble 28-32 kDa form, sCD27, detected in the plasma, urine or spinal fluid. This sCD27 is an important prognostic marker of acute and chronic B cell malignancies. RgpA, a cystein proteinase, although activating T cells through the protease-activated receptors (PARs), degradates CD27 and counteracts T cell activation mediated by CD27 and its ligand CD70.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human peripheral blood lymphocytes
Applications:
FC
Additional Info:
The antibody LT27 reacts with an extracellular epitope of CD27 (T14), a 50-55 kDa type I transmembrane glycoprotein (member of the TNF-receptor superfamily) expressed on medullary thymocytes, peripheral T lymphocytes, some B lymphocytes and NK cells.
Clone number:
LT27
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD27 is a transmembrane 55 kDa protein of the nerve growth factor-receptor family, expressed as a disulfide-linked homodimer on mature thymocytes, peripheral blood T cells and a subpopulation of B cells. Activation of T cells via TCR-CD3 complex results in upregulation of CD27 expression on the plasma membrane as well as in the release of its soluble 28-32 kDa form, sCD27, detected in the plasma, urine or spinal fluid. This sCD27 is an important prognostic marker of acute and chronic B cell malignancies. RgpA, a cystein proteinase, although activating T cells through the protease-activated receptors (PARs), degradates CD27 and counteracts T cell activation mediated by CD27 and its ligand CD70.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human peripheral blood lymphocytes
Applications:
FC
Additional Info:
The antibody LT27 reacts with an extracellular epitope of CD27 (T14), a 50-55 kDa type I transmembrane glycoprotein (member of the TNF-receptor superfamily) expressed on medullary thymocytes, peripheral T lymphocytes, some B lymphocytes and NK cells.
Clone number:
LT27
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD268 / BAFF R is a TNFR family receptor that binds the B-cell-activating factor (CD257 / BAFF). Splice variants of CD268 have been observed both in man and mouse. A naturally occurring mutation of CD268 in A/WySnJ mice is associated with low number of mature B cells, but with normal B cell precursors. The role of BAFF in B-cell survival and activation make CD268 a potential diagnostic reagent. It may be involved in survival of B-cell malignancies. Experimental administration of a CD268-Fc fusion protein suppresses antibody responses. In T cells the CD268 costimulates their activation and proliferation. Defects in CD268 cause the common variable immunodeficiency 4 (CVID4).
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human CD268-transfected murine L1.2 cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 11C1 recognizes an extracellular epitope of CD268 / BAFF R (B cell-activating factor receptor), a 19 kDa type III transmembrane protein expressed on resting B cells and CD4-positive T cells, but down regulated after activation.
Clone number:
11C1
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD268 / BAFF R is a TNFR family receptor that binds the B-cell-activating factor (CD257 / BAFF). Splice variants of CD268 have been observed both in man and mouse. A naturally occurring mutation of CD268 in A/WySnJ mice is associated with low number of mature B cells, but with normal B cell precursors. The role of BAFF in B-cell survival and activation make CD268 a potential diagnostic reagent. It may be involved in survival of B-cell malignancies. Experimental administration of a CD268-Fc fusion protein suppresses antibody responses. In T cells the CD268 costimulates their activation and proliferation. Defects in CD268 cause the common variable immunodeficiency 4 (CVID4).
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human CD268-transfected murine L1.2 cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 11C1 recognizes an extracellular epitope of CD268 / BAFF R (B cell-activating factor receptor), a 19 kDa type III transmembrane protein expressed on resting B cells and CD4-positive T cells, but down regulated after activation.
Clone number:
11C1
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
The antibody MEM-136 recognizes common epitope on beta-chain of human HLA-DR and HLA-DP. It reacts with alpha/beta dimer as well as with dissociated beta-subunit. DR and DP are the isotypes of human MHC Class II molecules expressed on antigen-presenting cells (APC; dendritic cells, B lymphocytes, monocytes, macrophages).
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
PHA-activated peripheral blood lymphocytes.
Applications:
FC
Additional Info:
The antibody MEM-136 recognizes a common extracellular epitope on beta-chain of human HLA-DR and HLA-DP. It reacts with alpha/beta dimer as well as with dissociated beta-subunit. DR and DP are the isotypes of human MHC Class II molecules expressed on antigen-presenting cells (APC; dendritic cells, B lymphocytes, monocytes, macrophages).
Clone number:
MEM-136
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
The antibody HL-38 recognizes common epitope on beta-chain of human HLA-DR and HLA-DP. DR and DP are the isotypes of human MHC Class II molecules expressed on antigen-presenting cells (APC; dendritic cells, B lymphocytes, monocytes, macrophages).
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Raji Burkitt's lymphoma cell line
Applications:
FC
Additional Info:
The antibody HL-38 recognizes an extracellular common epitope on beta-chain of human HLA-DR and HLA-DP. DR and DP are the isotypes of human MHC Class II molecules expressed on antigen-presenting cells (APC; dendritic cells, B lymphocytes, monocytes, macrophages).
Clone number:
HL-38
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
FOLR2 (folate receptor beta) is a cell surface protein that was originally thought to be specific for placenta, but it can be also expressed in other tissues, including hematopoietic cells. Its expression is increased in malignant tissues. FOLR2 may play a role in the transport of methotrexate in synovial macrophages in rheumatoid arthritis patients. FOLR2 is a marker for macrophages generated in the presence of M-CSF (M2), including M2-like tumor-associated macrophages, which exert potent immunosuppressive functions within the tumor environment, but not GM-CSF (M1), and whose expression correlates with increased folate uptake ability.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
BW5147alpha,beta- cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody EM-35 recognizes an extracellular epitope on FOLR2, a 30-40 kDa cell surface protein serving as a receptor for folic acid.
Drebrin is an actin-binding protein, which is expressed mainly in neurons and plays important role in their morphogenesis. The highest level of its expression is in developing brain. Both in neurons and non-neuronal cells drebrin acts as a key regulator of actin cytoskeleton remodelling, affecting especially intercellular junctions, such as dendritic spines of neurons or the immune synapses of T cells. Decrease of drebrin amount in the brain seems to be associated with Alzheimer's disease and Down syndrome, and in case of B-cell precursor acute lymphoblastic leukemia (BCP-ALL) lower drebrin expression correlates with higher risk of relapse.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Bacterially expressed N-terminal fragment of recombinant human drebrin (aa 1-326)
Applications:
FC
Additional Info:
The mouse monoclonal antibody DBN-N-03 recognizes drebrin, an approximately 100-125 kDa intracellular regulator of actin cytoskeleton.
Clone number:
DBN-N-03
Antibody Isotype:
IgG2b
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 4 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (0.4 ml) is sufficient for 100 tests. Intracellular staining.
DR3, also known as APO-3, TRAMP or TNFRSF25, is a death domain-containing receptor of TNFR family, which is expressed preferentially in peripheral blood leukocytes and in the lymphocyte-enriched tissues. Its expression has been shown to be especially up-regulated in activated T cells. DR3 participates e.g. in the removal of self-reactive T cells in the thymus. The ligand for DR3 is TL1A (TNF-like ligand 1A), which is expressed in a variety of cell types (induced by inflammatory stimuli), and can also be released as a soluble factor. The TL1A/DR3 axis has been shown to costimulate T cells to produce a wide variety of cytokines and leads to T cell differentiation towards Th1 and Th17 types.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human DR3-Ig fusion protein
Applications:
FC
Additional Info:
The mouse monoclonal antibody JD3 recognizes an extracellular epitope of DR3 (APO-3, TNFRSF25), a transmembrane protein of TNFR superfamily expressed mainly in lymphocyte-enriched tissues.
Clone number:
JD3
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
DLL4 (Delta-like 4) is one of five ligands of Notch receptors. It interacts with Notch1 and Notch4. DLL4 is up-regulated at sites of physiologic and pathologic angiogenesis, whereas its expression is low in most adult normal tissues. It is also highly expressed in human clear-cell renal carcinomas, bladder cancers, and breast cancers. Blocking the DLL4-Notch interaction seems to be a promissing therapeutic approach.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
recombinant soluble human DLL4
Applications:
FC
Additional Info:
The mouse monoclonal antibody MHD4-46 recognizes the extracellular domain of DLL4 (Delta-like ligand 4), a type I transmembrane protein which plays an important role in vascular development.
DDIT4L (DNA-damage-inducible transcript 4-like), also known as REDD2 (regulated in development and DNA damage response 2) or RTP801L is a stress-inducted protein, which was shown to mediate monocyte cell death through a reduction in thioredoxin-1 expression, and is highly expressed in atherosclerotic lesions. Stimulation of DDIT4L expression in macrophages increases oxidized LDL-induced macrophage death.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
N-terminal recombinant fragment of human DDIT4L (amino acids 2-98)
Applications:
FC
Additional Info:
The mouse monoclonal antibody DDIT-03 recognizes DDIT4L / REDD2 protein, which belongs to intracellular stress-induced proteins involved in mediation of cell death.
Cyclin D1 (PRAD1, Bcl-1) is a cytoplasmic and nuclear protein, which is synthesized during G1 phase and assembles with either cyclin-dependent kinase 4 (CDK4) or CDK6 in response to growth factor stimulation. D-type cyclin-CDK complexes act to inactivate the growth-suppressive function of the Rb protein through its phosphorylation, and titrate CDK inhibitors such as p21Cip1 and p27Kip1. Whereas during G1 phase cyclin D1 accumulates in the nucleus, it translocates into the cytoplasm during S phase. Without growth factor-mediated stimulation, cyclin D1 is unstable, and undergoes ubiquitin-mediated degradation, which is triggered by its phosphorylation. Cyclin D1 destabilization participates in G1/S phase arrest.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
recombinant human cyclin D1 (amino acids 1-295)
Applications:
FC
Additional Info:
The mouse monoclonal antibody DCS-6 recognizes cyclin D1, an ubiquitously expressed 33 kDa intracellular protein that migrates as a 36 kDa band under reducing SDS-PAGE conditions.
Cyclin B1 is a regulatory protein involved in mitosis. It complexes with p34(cdc2) to form maturation-promoting factor (MPF), and is necessary for proper control of the G2/M phase transition of the cell cycle. It is expressed in tissues containing proliferating cells, such as lymph node, testis et al.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Recombinant His-tagged hamster cyclin B1
Applications:
FC
Clone number:
V152
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests. Intracellular staining.
CLIC5a belongs to the family of chloride intracellular channel (CLIC) proteins, all sharing a highly conserved C terminus and variable N terminus. Human CLIC5 is transcribed in two isoforms, 32 kDa CLIC5a (251 amino acids) and 49 kDa CLIC5b (410 amino acids). These proteins exist in a soluble form and their function as ion channels in vitro has not been fully confirmed in vivo. CLIC5a is a component of complexes of actin, ezrin, and several other actin-associated proteins and is important for functionality of actin-based structures.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
KLH-conjugated peptide corresponding to the amino acids 160-173 of human CLIC5a (Cys-Ile-Asp-Ala-Asn-Thr-Ser-Asp-Lys-Gly-Ser-Arg-Arg coupled with KLH).
Applications:
FC
Additional Info:
Mouse monoclonal antibody CLIC5-02 recognizes CLIC5a, a 32 kDa intracellular protein which associates with of actin complexes. Crossreactivity with CLIC5b was not determined.
CD370 / CLEC9A, also known as DNGR1, is a type II transmembrane glycoprotein with extracellular C-type lectin domain and intracellular ITAM-containing domain. Its expression is restricted to BDCA3+ conventional dendritic cells and to a subset of CD14+ CD16- monocytes. CD370 serves as a receptor for ubiquitous preformed acid-labile protein associated ligands that are exposed when the cell membrane is damaged, such as on necrotic cells. Its triggering by these ligands mediates recruitment and activation of the tyrosine kinase Syk and leads to their cross-presentation to the immune system.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
RBL-2H3 cells expressing human CLEC9A fused to an HA epitope
Applications:
FC
Additional Info:
The mouse monoclonal antibody 8F9 recognizes an extracellular epitope of CD370 / CLEC9A (DNGR1), a type II transmembrane protein functioning as an endocytic receptor on BDCA31+ dendritic cells and on a subset of CD14+ CD16- monocytes.
Clone number:
8F9
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD3 complex is crucial in transducing antigen-recognition signals into the cytoplasm of T cells and in regulating the cell surface expression of the TCR complex. T cell activation through the antigen receptor (TCR) involves the cytoplasmic tails of the CD3 subunits CD3 gamma, CD3 delta, CD3 epsilon and CD3 zeta. These CD3 subunits are structurally related members of the immunoglobulins super family encoded by closely linked genes on human chromosome 11. The CD3 components have long cytoplasmic tails that associate with cytoplasmic signal transduction molecules. This association is mediated at least in part by a double tyrosine-based motif present in a single copy in the CD3 subunits. CD3 may play a role in TCR-induced growth arrest, cell survival and proliferation.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Purified human CD3 proteins isolated from thymus
Applications:
FC
Additional Info:
The mouse monoclonal antibody APA1/1 recognizes an activation-dependent intracellular epitope of CD3 epsilon. Exposure of the epitope precedes CD3 phosphorylation and recruitment and activation of ZAP70, which initiates the signaling cascade produced by T-cell activation. APA1/1 provides the earliest known marker for TCR-mediated T cell activation.
Clone number:
APA1/1
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: Recommended dilution: 1-4 µg/ml. Intracellular staining.Immunocytochemistry: Fixed and permeabilised cells. The antibody can distinguish TCR-stimulated from non-stimulated cells.
CD3 complex is crucial in transducing antigen-recognition signals into the cytoplasm of T cells and in regulating the cell surface expression of the TCR complex. T cell activation through the antigen receptor (TCR) involves the cytoplasmic tails of the CD3 subunits CD3 gamma, CD3 delta, CD3 epsilon and CD3 zeta. These CD3 subunits are structurally related members of the immunoglobulins super family encoded by closely linked genes on human chromosome 11. The CD3 components have long cytoplasmic tails that associate with cytoplasmic signal transduction molecules. This association is mediated at least in part by a double tyrosine-based motif present in a single copy in the CD3 subunits. CD3 may play a role in TCR-induced growth arrest, cell survival and proliferation.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Purified human CD3 proteins isolated from thymus
Applications:
FC
Additional Info:
The mouse monoclonal antibody APA1/1 recognizes an activation-dependent intracellular epitope of CD3 epsilon. Exposure of the epitope precedes CD3 phosphorylation and recruitment and activation of ZAP70, which initiates the signaling cascade produced by T-cell activation. APA1/1 provides the earliest known marker for TCR-mediated T cell activation.
Bromodexyuridine (BrdU) is a thymidine analog, which is selectively incorporated into the DNA of proliferating cells to provide a marker for the DNA being replicated. The number of proliferating cells can then be detected in cell lysates, tissue sections or suspensions using an antibody specific for the BrdU.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Bromodeoxyuridine conjugated to BSA
Applications:
FC
Additional Info:
The antibody Bu20a reacts specifically with BrdU incorporated into DNA during S-phase of a cell cycle. It is useful for detecting proliferating cells by flow cytometry or immunohistochemistry staining.
Clone number:
Bu20a
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests. Intracellular staining.
ARHGEF4 (Rho guanine nucleotide exchange factor 4), also known as ASEF 1 (adenomatous polyposis coli – stimulated guanine nucleotide exchange factor 1) is an approximately 80 kDa cytoplasmic protein important for growth factor-mediated regulation of cell morphology and migration. Besides N-terminal adenomatous polyposis coli (APC)-binding region (ABR) it contains Dbl homology (DH), pleckstrin homology (PH) and SH3 domains. The SH3 domain inhibits GEF activity of ARHGEF4 by intramolecular interaction with the DH domain, whereas binding of APC stimulates the GEF activity. Activated ARHGEF4 stimulates the small GTPase Cdc42, which leads to decreased cell-cell adherence and enhanced cell migration.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Recombinant fragment of human ARHGEF4 (amino acids 143-271)
Applications:
FC
Additional Info:
The mouse monoclonal antibody ARHGEF-08 recognizes human intracellular protein ARHGEF4 / ASEF1, approx. 80 kDa guanine nucleotide exchange factor specific for Rac1 and Cdc42. The epitope is located in the rough at the region of SH3 domain.
The microtubules are intracellular dynamic polymers made up of evolutionarily conserved polymorphic alpha/beta-tubulin heterodimers and a large number of microtubule-associated proteins (MAPs). The microtubules consist of 13 protofilaments and have an outer diameter 25 nm. Microtubules have their intrinsic polarity; highly dynamic plus ends and less dynamic minus ends. Microtubules are required for vital processes in eukaryotic cells including mitosis, meiosis, maintenance of cell shape and intracellular transport. Microtubules are also necessary for movement of cells by means of flagella and cilia. In mammalian tissue culture cells microtubules have their minus ends anchored in microtubule organizing centers (MTOCs). The GTP (guanosintriphosphate) molecule is an essential for tubulin heterodimer to associate with other heterodimers to form microtubule. In vivo, microtubule dynamics vary considerably. Microtubule polymerization is reversible and a populations of microtubules in cells are on their minus ends either growing or shortening – this phenomenon is called dynamic instability of microtubules. On a practical level, microtubules can easily be stabilized by the addition of non-hydrolysable analogues of GTP (eg. GMPPCP) or more commonly by anti-cancer drugs such as Taxol. Taxol stabilizes microtubules at room temperature for many hours. Using limited proteolysis by enzymes both tubulin subunits can be divided into N-terminal and C-terminal structural domains. The alpha-tubulin (relative molecular weight around 50 kDa) is globular protein that exists in cells as part of soluble alpha/beta-tubulin dimer or it is polymerized into microtubules. In different species it is coded by multiple tubulin genes that form tubulin classes (in human 6 genes). Expressed tubulin genes are named tubulin isotypes. Some of the tubulin isotypes are expressed ubiquitously, while some have more restricted tissue expression. Alpha-tubulin is also subject of numerous post-translational modifications. Tubulin isotypes and their posttranslational modifications are responsible for multiple tubulin charge variants - tubulin isoforms. Heterogeneity of alpha-tubulin is concentrated in C-terminal structural domain.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Fraction of tubulin purified from porcine brain by two cycles of polymerization - depolymerization.
Applications:
FC,ICC
Additional Info:
The antibody TU-01 recognizes a defined epitope (aa 65-97) on N-terminal structural domain of alpha-tubulin.
Cytokeratins are a subfamily of intermediate filaments and are characterized by remarkable biochemical diversity. CThey are represented in epithelial tissues by at least 20 different polypeptides, molecular weight between 40 kDa and 68 kDa. The individual cytokeratin polypeptides are designated 1 to 20 and divided into the type I (acidic cytokeratins 9-20) and type II (basic to neutral cytokeratins 1-8) families.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human epidermal keratins
Applications:
FC
Additional Info:
Mouse monoclonal antibody AE1 recognizes acidic type cytokeratins (intracellular antigens), namely K10, 14, 15, 16, 19 (40-56 kDa). This antibody stains well the basal layer of epidermis and most epithelia.
CD169, also known as Siglec-1 or sialoadhesin, is a type I transmembrane glycoprotein of the sialic acid binding Ig-like lectin family. It binds to sialylated glycoproteins on various haematopoietic cells to mediate cell-cell interactions. CD169 is expressed on a subset of macrophages and dendritic cells. On CD14+ monocytes its expression can be induced by interferon alpha and gamma. High expression of CD169 is observed in the spleen, lymph nodes, bone marrow, and under inflammatory conditions rheumatoid arthritis and atherosclerosis, lower in the liver, lungs and gut. It has been shown to be involved in antigen presentation to invariant NKT cells, which play an important role in the innate arm of the immune system to modulate the subsequent acquired immune responses.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human rhinovirus 14-infected monocyte-derived dendritic cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 7-239 recognizes an extracellular epitope of CD169 (sialoadhesin, Siglec-1), a 210 kDa type I transmembrane glycoprotein expressed on macrophages and dendritic cells.
Clone number:
7-239
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD169, also known as Siglec-1 or sialoadhesin, is a type I transmembrane glycoprotein of the sialic acid binding Ig-like lectin family. It binds to sialylated glycoproteins on various haematopoietic cells to mediate cell-cell interactions. CD169 is expressed on a subset of macrophages and dendritic cells. On CD14+ monocytes its expression can be induced by interferon alpha and gamma. High expression of CD169 is observed in the spleen, lymph nodes, bone marrow, and under inflammatory conditions rheumatoid arthritis and atherosclerosis, lower in the liver, lungs and gut. It has been shown to be involved in antigen presentation to invariant NKT cells, which play an important role in the innate arm of the immune system to modulate the subsequent acquired immune responses.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human rhinovirus 14-infected monocyte-derived dendritic cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 7-239 recognizes an extracellular epitope of CD169 (sialoadhesin, Siglec-1), a 210 kDa type I transmembrane glycoprotein expressed on macrophages and dendritic cells.
Clone number:
7-239
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD167a, also known as e.g. discoidin domain receptor tyrosine kinase 1 (DDR1), tyrosine kinase receptor E (TRKE), cell adhesion kinase (CAK), or neuroepithelial tyrosine kinase 4 (NEP, NTRK4), is a transmembrane receptor tyrosine kinase expressed predominantly in epithelial cells. It has been shown to be significantly overexpressed in several human tumors. Alternatively spliced transcript variants encoding different isoforms of this protein have been described. After binding to fibrilar collagens I, II, III, V, or basement membrane collagens IV and VIII, CD167a becomes activated and autophosphorylated and transduces collagen-induced signaling.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
CD167a-transfected NIH-3T3 cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 51D6 recognizes an extracellular epitope of CD167a, an approximately 97-101 kDa receptor tyrosine kinase expressed mainly on epithelial cells, but also on B cells and dendritic cells.
Clone number:
51D6
Antibody Isotype:
IgM
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD165 is a poorly characterized transmembrane protein highly expressed on platelets and many leukemic T cell lines. At lower level it is expressed on a proportion of circulating T cells and monocytes, on thymic epithelium, fibroblasts, epidermal keratinocytes, pancreatic islet cells, and some neurons. It might have a role in adhesion between thymocytes and thymic epithelial cells and it can be used as a marker for tumor progression.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
CD165 purified from human Molt-4 cell line
Applications:
FC
Additional Info:
The mouse monoclonal antibody SN2, also known as SN2 N6-D11, recognizes an extracellular epitope of CD165, an approximately 37-42 kDa transmembrane glycoprotein expressed mainly on leukemic T cells, double positive and double negative thymocytes (CD4-CD8-, CD4+CD8+), and platelets.
Clone number:
SN2
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD164, also known as endolyn, is a type I transmembrane protein with heavily glycosylated extracellular part containing sialic acid and glycosaminoglycan residues. CD164 plays both adhesive and antiadhesive role and serves as a potent negative regulator for CD34+ CD38- hematopoietic progenitor cell proliferation. It has also been reported to be involved in myogenic differentiation and cancer metastasis. The adhesive and negative regulatory functions seem to depend on different posttranslational modifications of CD164 protein.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Breast tumor cell line T-47D
Applications:
FC
Additional Info:
The mouse monoclonal antibody 67D2 recognizes an extracellular class III epitope (not sensitive to sialidase, N-glycanase, O-glycosidase, and O-sialoglycoprotease) of CD164, a sialomucin expressed in hematopoietic myeloid and erythroid progenitors, activated basophils, and in various carcinomas and leukemic cells.
Clone number:
67D2
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD163, also known as M130, is a member of the scavenger receptor family, accounting for the clearance of hemoglobin-haptoglobin complexes during limited hemolysis, which protects the body, in particular the kidneys, against heme-mediated oxidative damages. It does not have measurable affinity for noncomplexed hemoglobin or haptoglobin. Immunomodulatory role of CD163 has been postulated. CD163 is expressed by cells of the monocyte-macrophage lineage and its extracellular part also circulates in plasma as a soluble protein, especially during sepsis and other conditions affecting macrophage activity, when its level may raise manyfold.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Hairy cell leukemia cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody GHI/61 recognizes an extracellular epitope CD163, an approximately 130 kDa high affinity scavenger receptor expressed mainly on monocytes and macrophages, which binds hemoglobin-haptoglobin complex.
Clone number:
GHI/61
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD163, also known as M130, is a member of the scavenger receptor family, accounting for the clearance of hemoglobin-haptoglobin complexes during limited hemolysis, which protects the body, in particular the kidneys, against heme-mediated oxidative damages. It does not have measurable affinity for noncomplexed hemoglobin or haptoglobin. Immunomodulatory role of CD163 has been postulated. CD163 is expressed by cells of the monocyte-macrophage lineage and its extracellular part also circulates in plasma as a soluble protein, especially during sepsis and other conditions affecting macrophage activity, when its level may raise manyfold.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Hairy cell leukemia cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody GHI/61 recognizes an extracellular epitope CD163, an approximately 130 kDa high affinity scavenger receptor expressed mainly on monocytes and macrophages, which binds hemoglobin-haptoglobin complex.
Clone number:
GHI/61
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD162 (P-selectin glycoprotein ligand-1, PSGL-1) is a sialomucin constitutively expressed as a disulfide-linked homodimer of two 120 kDa subunits on the surface of circulating leukocytes. CD162 serves as a ligand for P- E- and L-selectin, with the highest affinity for P-selectin. It is thus involved in leukocyte rolling at the endothelial surfaces, prerequisite for firm leukocyte adhesion and subsequent transendothelial migration. CD162 also mediates leukocyte-platelet adhesion and interleukocyte contacts. Whereas serving as an adhession molecule on mature leukocytes, CD162 is a potent negative regulator of human hematopoietic progenitors.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human thymocytes
Applications:
FC
Additional Info:
The antibody TC2 reacts with an extracellular epitope of CD162, a 220 kDa type I integral membrane protein expressed as disulfide-linked homodimer (sialomucin family). CD162 is present on the most peripheral blood T lymphocytes, monocytes, granulocytes; it is also expressed on a subpopulation of B lymphocytes and CD34+ bone marrow cells.
Clone number:
TC2
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD162 (P-selectin glycoprotein ligand-1, PSGL-1) is a sialomucin constitutively expressed as a disulfide-linked homodimer of two 120 kDa subunits on the surface of circulating leukocytes. CD162 serves as a ligand for P- E- and L-selectin, with the highest affinity for P-selectin. It is thus involved in leukocyte rolling at the endothelial surfaces, prerequisite for firm leukocyte adhesion and subsequent transendothelial migration. CD162 also mediates leukocyte-platelet adhesion and interleukocyte contacts. Whereas serving as an adhession molecule on mature leukocytes, CD162 is a potent negative regulator of human hematopoietic progenitors.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human thymocytes
Applications:
FC
Additional Info:
The antibody TC2 reacts with an extracellular epitope of CD162, a 220 kDa type I integral membrane protein expressed as disulfide-linked homodimer (sialomucin family). CD162 is present on the most peripheral blood T lymphocytes, monocytes, granulocytes; it is also expressed on a subpopulation of B lymphocytes and CD34+ bone marrow cells.
Clone number:
TC2
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD161, also known as Nkrp1 (natural killer receptor protein 1) or Klrb1 (killer cell lectin-like receptor subfamily b member 1), is a disulphide-linked homodimeric receptor, which is involved in regulation of NK cell and NKT cell function. It is expressed on rat NK cells, subset of T cells, dendritic cells, and activated monocytes. Although human CD161 is expressed as one isoform, the rat CD161 has three isoforms, referred to as CD161a, b, and c. These proteins contain C-terminal C-type lectin extracellular domain, a transmembrane domain, and N-terminal intracellular domain, which contains ITIM motif, such as CD161b, and displays inhibitory function, or does not contain ITIM motif, thus also not the inhibitory function, such as CD161a.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human NK cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody HP-3G10 recognizes an extracellular epitope of CD161, a type II transmembrane C-type lectin receptor, expressed on the plasma membrane of NK cells, dendritic cells, activated monocytes and a subset of T cells as a disulphide-linked homodimer.
Clone number:
HP-3G10
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD161, also known as Nkrp1 (natural killer receptor protein 1) or Klrb1 (killer cell lectin-like receptor subfamily b member 1), is a disulphide-linked homodimeric receptor, which is involved in regulation of NK cell and NKT cell function. It is expressed on rat NK cells, subset of T cells, dendritic cells, and activated monocytes. Although human CD161 is expressed as one isoform, the rat CD161 has three isoforms, referred to as CD161a, b, and c. These proteins contain C-terminal C-type lectin extracellular domain, a transmembrane domain, and N-terminal intracellular domain, which contains ITIM motif, such as CD161b, and displays inhibitory function, or does not contain ITIM motif, thus also not the inhibitory function, such as CD161a.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human NK cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody HP-3G10 recognizes an extracellular epitope of CD161, a type II transmembrane C-type lectin receptor, expressed on the plasma membrane of NK cells, dendritic cells, activated monocytes and a subset of T cells as a disulphide-linked homodimer.
Clone number:
HP-3G10
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD160 is a cell surface glycoprotein of immunoglobulin superfamily, which functions as a costimulatory receptor expressed mainly on cytotoxic cell populations and recognizing both classical and non-classical MHC class I molecules. It can form disulfide-linked multimers. Down-modulation of CD160 occurs as a consequence of its proteolytic cleavage and the released soluble form was found to impair the MHC-class I specific cytotoxicity of CD8+ T lymphocytes and NK cells. In contrast to GPI-anchored isoform with broader expression among CD160 positive cells, expression of the transmembrane isoform is restricted to NK cells and is activation-dependent.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human NK cell line YT2C2
Applications:
FC
Additional Info:
The mouse monoclonal antibody BY55 recognizes an extracellular epitope of CD160, a 27 kDa glycoprotein expressed on NK cells, NK-T cells, intestinal intraepithelial lymphocytes, TCR-gamma/delta T cells and a small population of TCR-alpha/beta T cells. The antibody detects both GPI-anchored and transmembrane form of CD160.
Clone number:
BY55
Antibody Isotype:
IgM k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD160 is a cell surface glycoprotein of immunoglobulin superfamily, which functions as a costimulatory receptor expressed mainly on cytotoxic cell populations and recognizing both classical and non-classical MHC class I molecules. It can form disulfide-linked multimers. Down-modulation of CD160 occurs as a consequence of its proteolytic cleavage and the released soluble form was found to impair the MHC-class I specific cytotoxicity of CD8+ T lymphocytes and NK cells. In contrast to GPI-anchored isoform with broader expression among CD160 positive cells, expression of the transmembrane isoform is restricted to NK cells and is activation-dependent.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human NK cell line YT2C2
Applications:
FC
Additional Info:
The mouse monoclonal antibody BY55 recognizes an extracellular epitope of CD160, a 27 kDa glycoprotein expressed on NK cells, NK-T cells, intestinal intraepithelial lymphocytes, TCR-gamma/delta T cells and a small population of TCR-alpha/beta T cells. The antibody detects both GPI-anchored and transmembrane form of CD160.
Clone number:
BY55
Antibody Isotype:
IgM k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD16 (FcgammaRIII) is a 50-65 kDa glycoprotein serving as a low affinity IgG receptor. Human FcgammaRIII is expressed in two forms – FcgammaRIII-A and -B. FcgammaRIII-A is a transmembrane protein of monocytes, macrophages, NK cells and a subset of T cells. It is associated with FcepsilonRI-gamma subunit and is responsible for antibody-dependent NK cell cytotoxicity. Mast cell FcgammaRIII-A is associated, moreover, with FcepsilonRI-beta subunit. Besides IgG, FcgammaRIII-A can be triggered also by oligomeric IgE. FcgammaRIII-B is a GPI-linked monomeric receptor expressed on neutrophils and is involved in their activation and induction of a proadhesive phenotype.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human neutrophils
Applications:
FC
Additional Info:
The mouse monoclonal antibody 3G8 recognizes an extracellular epitope of CD16, a low affinity receptor for aggregated IgG (FcgammaRIII antigen). CD16 exists in two different isoforms: CD16a (FcgammaRIIIA; 50-65 kDa; expressed on NK-cells, monocytes and macrophages) and CD16b (FcgammaRIIIB; 48 kDa; mainly expressed on neutrophils).
Clone number:
3G8
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD16 (FcgammaRIII) is a 50-65 kDa glycoprotein serving as a low affinity IgG receptor. Human FcgammaRIII is expressed in two forms – FcgammaRIII-A and -B. FcgammaRIII-A is a transmembrane protein of monocytes, macrophages, NK cells and a subset of T cells. It is associated with FcepsilonRI-gamma subunit and is responsible for antibody-dependent NK cell cytotoxicity. Mast cell FcgammaRIII-A is associated, moreover, with FcepsilonRI-beta subunit. Besides IgG, FcgammaRIII-A can be triggered also by oligomeric IgE. FcgammaRIII-B is a GPI-linked monomeric receptor expressed on neutrophils and is involved in their activation and induction of a proadhesive phenotype.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human neutrophils
Applications:
FC
Additional Info:
The mouse monoclonal antibody 3G8 recognizes an extracellular epitope of CD16, a low affinity receptor for aggregated IgG (FcgammaRIII antigen). CD16 exists in two different isoforms: CD16a (FcgammaRIIIA; 50-65 kDa; expressed on NK-cells, monocytes and macrophages) and CD16b (FcgammaRIIIB; 48 kDa; mainly expressed on neutrophils).
Clone number:
3G8
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 4 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (0.4 ml) is sufficient for 100 tests.
CD16 (FcgammaRIII) is a 50-65 kDa glycoprotein serving as a low affinity IgG receptor. Human FcgammaRIII is expressed in two forms – FcgammaRIII-A and -B. FcgammaRIII-A is a transmembrane protein of monocytes, macrophages, NK cells and a subset of T cells. It is associated with FcepsilonRI-gamma subunit and is responsible for antibody-dependent NK cell cytotoxicity. Mast cell FcgammaRIII-A is associated, moreover, with FcepsilonRI-beta subunit. Besides IgG, FcgammaRIII-A can be triggered also by oligomeric IgE. FcgammaRIII-B is a GPI-linked monomeric receptor expressed on neutrophils and is involved in their activation and induction of a proadhesive phenotype.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Normal human peripheral blood granulocytes
Applications:
FC
Additional Info:
The antibody LNK16 reacts with an extracellular epitope of CD16, a low affinity receptor for aggregated IgG (FcgammaRIII antigen). CD16 exists in two different isoforms: CD16a (FcgammaRIIIA; 50-65 kDa; expressed on NK-cells, monocytes and macrophages) and CD16b (FcgammaRIIIB; 48 kDa; mainly expressed on neutrophils).
Clone number:
LNK16
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD16 (FcgammaRIII) is a 50-65 kDa glycoprotein serving as a low affinity IgG receptor. Human FcgammaRIII is expressed in two forms – FcgammaRIII-A and -B. FcgammaRIII-A is a transmembrane protein of monocytes, macrophages, NK cells and a subset of T cells. It is associated with FcepsilonRI-gamma subunit and is responsible for antibody-dependent NK cell cytotoxicity. Mast cell FcgammaRIII-A is associated, moreover, with FcepsilonRI-beta subunit. Besides IgG, FcgammaRIII-A can be triggered also by oligomeric IgE. FcgammaRIII-B is a GPI-linked monomeric receptor expressed on neutrophils and is involved in their activation and induction of a proadhesive phenotype.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human neutrophils
Applications:
FC
Additional Info:
The mouse monoclonal antibody 3G8 recognizes an extracellular epitope of CD16, a low affinity receptor for aggregated IgG (FcgammaRIII antigen). CD16 exists in two different isoforms: CD16a (FcgammaRIIIA; 50-65 kDa; expressed on NK-cells, monocytes and macrophages) and CD16b (FcgammaRIIIB; 48 kDa; mainly expressed on neutrophils).
Clone number:
3G8
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD16 (FcgammaRIII) is a 50-65 kDa glycoprotein serving as a low affinity IgG receptor. Human FcgammaRIII is expressed in two forms – FcgammaRIII-A and -B. FcgammaRIII-A is a transmembrane protein of monocytes, macrophages, NK cells and a subset of T cells. It is associated with FcepsilonRI-gamma subunit and is responsible for antibody-dependent NK cell cytotoxicity. Mast cell FcgammaRIII-A is associated, moreover, with FcepsilonRI-beta subunit. Besides IgG, FcgammaRIII-A can be triggered also by oligomeric IgE. FcgammaRIII-B is a GPI-linked monomeric receptor expressed on neutrophils and is involved in their activation and induction of a proadhesive phenotype.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human granulocytes
Applications:
FC
Additional Info:
The antibody MEM-154 reacts with an extracellular epitope on CD16 antigen that is residing in proximity to FG loop (probably BC or C'E loop). CD16 is a low affinity receptor for aggregated IgG (FcgammaRIII antigen). The antibody MEM-154 reacts with CD16+ granulocytes.
Clone number:
MEM-154
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD16 (FcgammaRIII) is a 50-65 kDa glycoprotein serving as a low affinity IgG receptor. Human FcgammaRIII is expressed in two forms – FcgammaRIII-A and -B. FcgammaRIII-A is a transmembrane protein of monocytes, macrophages, NK cells and a subset of T cells. It is associated with FcepsilonRI-gamma subunit and is responsible for antibody-dependent NK cell cytotoxicity. Mast cell FcgammaRIII-A is associated, moreover, with FcepsilonRI-beta subunit. Besides IgG, FcgammaRIII-A can be triggered also by oligomeric IgE. FcgammaRIII-B is a GPI-linked monomeric receptor expressed on neutrophils and is involved in their activation and induction of a proadhesive phenotype.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human neutrophils
Applications:
FC
Additional Info:
The mouse monoclonal antibody 3G8 recognizes an extracellular epitope of CD16, a low affinity receptor for aggregated IgG (FcgammaRIII antigen). CD16 exists in two different isoforms: CD16a (FcgammaRIIIA; 50-65 kDa; expressed on NK-cells, monocytes and macrophages) and CD16b (FcgammaRIIIB; 48 kDa; mainly expressed on neutrophils).
Clone number:
3G8
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD158f, also known as KIR2DL5, is a polymorphic 60 kDa transmembrane glycoprotein with two Ig-like extracellular domains by which it recognize HLA class I molecules. Its long intracellular domain contains immunoreceptor tyrosine-based inhibitory motifs (ITIMs) that upon extracellular ligand-mediated phosphorylation serve as docking sites for inhibitory phosphatases, which results in blocking natural cytotoxicity as well as antibody-dependent cytotoxicity of the particular NK cell, and its adhesion toward target cells. Together with other killer inhibitory receptors CD158f is important for immunological tolerance to discriminate between normal and abnormal cells. Besides NK cells it is expressed on a small population of cytotoxic T cells. Expression of CD158f alleles is highly variable in the population.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human CD158f-Ig fusion protein
Applications:
FC
Additional Info:
The mouse monoclonal antibody UP-R1 recognizes an extracellular epitope on CD158f (KIR2DL5), a 60 kDa glycoprotein serving as a HLA class I ligand, and mainly expressed on a subset of NK cells and a small population of T cells. Its expression is highly polymorphic between individuals.
Clone number:
UP-R1
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD158f, also known as KIR2DL5, is a polymorphic 60 kDa transmembrane glycoprotein with two Ig-like extracellular domains by which it recognize HLA class I molecules. Its long intracellular domain contains immunoreceptor tyrosine-based inhibitory motifs (ITIMs) that upon extracellular ligand-mediated phosphorylation serve as docking sites for inhibitory phosphatases, which results in blocking natural cytotoxicity as well as antibody-dependent cytotoxicity of the particular NK cell, and its adhesion toward target cells. Together with other killer inhibitory receptors CD158f is important for immunological tolerance to discriminate between normal and abnormal cells. Besides NK cells it is expressed on a small population of cytotoxic T cells. Expression of CD158f alleles is highly variable in the population.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human CD158f-Ig fusion protein
Applications:
FC
Additional Info:
The mouse monoclonal antibody UP-R1 recognizes an extracellular epitope on CD158f (KIR2DL5), a 60 kDa glycoprotein serving as a HLA class I ligand, and mainly expressed on a subset of NK cells and a small population of T cells. Its expression is highly polymorphic between individuals.
Clone number:
UP-R1
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD158d / KIR2DL4 is a KIR family member that shares structural features with both activating and inhibitory receptors and may mediate different functions under different circumstances. It contains cytoplasmic ITIM, suggesting inhibitory function, but also transmembrane domain similar to those of activating KIRs. It has been reported that CD158d serves as an inhibitory receptor for peripheral and uterine NK cells, but its ligation with soluble mAbs (unlike immobilized mAbs) results in activation of IFN-γ secretion. CD158d also binds both membrane form and soluble form of its ligand HLA-G.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
NK3.3 cells and KIR2DL4-Ig fusion protein
Applications:
FC
Additional Info:
The mouse monoclonal antibody mAb#33 (also known as mAb 33 or 33) recognizes extracellular portion of CD158d / KIR2DL4, a 45 kDa NK cell marker. Cell surface expression and function of CD158d / KIR2DL4 depends on genotype of particular individuals.
Clone number:
mAb#33
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 4 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (0.4 ml) is sufficient for 100 tests.
CD158d / KIR2DL4 is a KIR family member that shares structural features with both activating and inhibitory receptors and may mediate different functions under different circumstances. It contains cytoplasmic ITIM, suggesting inhibitory function, but also transmembrane domain similar to those of activating KIRs. It has been reported that CD158d serves as an inhibitory receptor for peripheral and uterine NK cells, but its ligation with soluble mAbs (unlike immobilized mAbs) results in activation of IFN-γ secretion. CD158d also binds both membrane form and soluble form of its ligand HLA-G.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
NK3.3 cells and KIR2DL4-Ig fusion protein
Applications:
FC
Additional Info:
The mouse monoclonal antibody mAb#33 (also known as mAb 33 or 33) recognizes extracellular portion of CD158d / KIR2DL4, a 45 kDa NK cell marker. Cell surface expression and function of CD158d / KIR2DL4 depends on genotype of particular individuals.
Clone number:
mAb#33
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD158d / KIR2DL4 is a KIR family member that shares structural features with both activating and inhibitory receptors and may mediate different functions under different circumstances. It contains cytoplasmic ITIM, suggesting inhibitory function, but also transmembrane domain similar to those of activating KIRs. It has been reported that CD158d serves as an inhibitory receptor for peripheral and uterine NK cells, but its ligation with soluble mAbs (unlike immobilized mAbs) results in activation of IFN-γ secretion. CD158d also binds both membrane form and soluble form of its ligand HLA-G.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
NK3.3 cells and KIR2DL4-Ig fusion protein
Applications:
FC
Additional Info:
The mouse monoclonal antibody mAb#33 (also known as mAb 33 or 33) recognizes extracellular portion of CD158d / KIR2DL4, a 45 kDa NK cell marker. Cell surface expression and function of CD158d / KIR2DL4 depends on genotype of particular individuals.
Clone number:
mAb#33
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
Killer cell immunoglobulin-like receptors (KIRs) are polymorphic transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. They are classified by the number of extracellular immunoglobulin domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain (such as CD158a / KIR2DL1) transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain (such as CD158g / KIR2DS5, CD158h / KIR2DS1, or KIR2DS3) lack the ITIM motif and instead associate with the TYRO protein tyrosine kinase binding protein to transduce activating signals. The ligands for CD158 isoforms are subsets of MHC class I molecules.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human NK cell line LB2
Applications:
FC
Additional Info:
The mouse monoclonal antibody HP-MA4 recognizes an extracellular epitope of CD158 isoforms KIR2DL1 (CD158a), KIR2DS5 (CD158g), KIR2DS1 (CD158h), and KIRDS3. It does not recognize the isoforms CD158b1,d,f,i,j.
Clone number:
HP-MA4
Antibody Isotype:
IgG2b k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD157 (cADPr hydrolase 2) is a GPI-anchored ectoenzyme possessing ADP-ribosyl cyclase and cyclic ADP-ribose hydrolase activity. It uses NAD and cADP-ribose as substrates. CD157 is expressed on granulocytes, monocytes, macrophages, follicular dendritic cells, bone marrow stromal cells and human umbilical cord vein endothelial cells. In case of rheumatoid arthritis is expression is often higher and it is also differentially expressed in the myeloid leukemias. It may also have a signaling role.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human CD157
Applications:
FC
Additional Info:
The mouse monoclonal antibody SY11B5 recognizes CD157, an approximately 45 kDa GPI-anchored extracellular protein expressed mainly on monocytes, macrophages, granulocytes and bone marrow stromal cells.
Clone number:
SY11B5
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD157 (cADPr hydrolase 2) is a GPI-anchored ectoenzyme possessing ADP-ribosyl cyclase and cyclic ADP-ribose hydrolase activity. It uses NAD and cADP-ribose as substrates. CD157 is expressed on granulocytes, monocytes, macrophages, follicular dendritic cells, bone marrow stromal cells and human umbilical cord vein endothelial cells. In case of rheumatoid arthritis is expression is often higher and it is also differentially expressed in the myeloid leukemias. It may also have a signaling role.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human CD157
Applications:
FC
Additional Info:
The mouse monoclonal antibody SY11B5 recognizes CD157, an approximately 45 kDa GPI-anchored extracellular protein expressed mainly on monocytes, macrophages, granulocytes and bone marrow stromal cells.
Clone number:
SY11B5
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD154 / CD40L (CD40 ligand) is a member of the tumor necrosis factor family, and is expressed primarily on activated CD4+ lymphocytes, but also on mast cells, basophils, eosinophils and human dendritic cells. Its counter-receptor CD40 is expressed on antigen presenting cells, including dendritic cells, macrophages, and B cells, and also on fibroblasts. Triggering of CD40 by CD40L causes maturation of dendritic cells and upregulation of antigen presentation in functions of the MHC and costimulatory molecules. CD40L also functions as a direct stimulating factor for T cells. CD40L plays also roles e.g. in antibody class switching and modulation of apoptosis in the germinal center.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human CD154 fusion protein
Applications:
FC
Additional Info:
The mouse monoclonal antibody 24-31 detects an extracellular epitope of CD154 / CD40L (CD40-ligand), a 39 kDa cell surface type II glycoprotein expressed predominantly on activated CD4+ lymphocytes.
Clone number:
24-31
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD152 / CTLA-4 is a homodimeric transmembrane protein similar to CD28 and binding the same ligands, i.e. CD80 (B7.1) and CD86 (B7.2), but with higher affinity. Unlike CD28 with important costimulating functions, CD152 acts as an important inhibitory receptor essential for modulation of the immune system. CD152 / CTLA-4 becomes transiently expressed on activated T cells and its malfunction can cause autoimmune diseases, such as insulin-dependent diabetes mellitus, Graves disease, Hashimoto thyroiditis, celiac disease, systemic lupus erythematosus, or thyroid-associated orbitopathy.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human CD152-IgG heavy chain fusion protein
Applications:
FC
Additional Info:
The mouse monoclonal antibody BNI3 recognizes an extracellular domain of human CD152 / CTLA4, an approximately 45 kDa type I transmembrane protein serving as a negative regulator of T cell responses.
Clone number:
BNI3
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 4 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (0.4 ml) is sufficient for 100 tests.
CD152 / CTLA-4 is a homodimeric transmembrane protein similar to CD28 and binding the same ligands, i.e. CD80 (B7.1) and CD86 (B7.2), but with higher affinity. Unlike CD28 with important costimulating functions, CD152 acts as an important inhibitory receptor essential for modulation of the immune system. CD152 / CTLA-4 becomes transiently expressed on activated T cells and its malfunction can cause autoimmune diseases, such as insulin-dependent diabetes mellitus, Graves disease, Hashimoto thyroiditis, celiac disease, systemic lupus erythematosus, or thyroid-associated orbitopathy.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human CD152-IgG heavy chain fusion protein
Applications:
FC
Additional Info:
The mouse monoclonal antibody BNI3 recognizes an extracellular domain of human CD152 / CTLA4, an approximately 45 kDa type I transmembrane protein serving as a negative regulator of T cell responses.
Clone number:
BNI3
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD152 / CTLA-4 is a homodimeric transmembrane protein similar to CD28 and binding the same ligands, i.e. CD80 (B7.1) and CD86 (B7.2), but with higher affinity. Unlike CD28 with important costimulating functions, CD152 acts as an important inhibitory receptor essential for modulation of the immune system. CD152 / CTLA-4 becomes transiently expressed on activated T cells and its malfunction can cause autoimmune diseases, such as insulin-dependent diabetes mellitus, Graves disease, Hashimoto thyroiditis, celiac disease, systemic lupus erythematosus, or thyroid-associated orbitopathy.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human CD152-IgG heavy chain fusion protein
Applications:
FC
Additional Info:
The mouse monoclonal antibody BNI3 recognizes an extracellular domain of human CD152 / CTLA4, an approximately 45 kDa type I transmembrane protein serving as a negative regulator of T cell responses.
Clone number:
BNI3
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD151, also known as PETA-3 (platelet-endothelial tetraspan antigen), is a four-pass transmembrane glycoprotein with short cytoplasmic N- and C-termini. CD151 is expressed mainly in platelets and megakaryocytes, immature hematopoietic cells, activated T cells, in endothelium, muscle cells, and epithelial cells. It associates with CD9, CD181, and integrin complexes alpha 3 / beta 1 (CD49c / CD29), alpha 5 / beta 1 (CD49e / CD29), and alpha 6 / beta 4 (CD49f / CD104). CD151 appears to be involved in cell adhesion and migration, including metastasis.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human epidermoid carcinoma cell line Hep-3
Applications:
FC
Additional Info:
The mouse monoclonal antibody CD151 recognizes an extracellular epitope of CD151 (also known as PETA-3), a 29 kDa transmembrane protein of tetraspanin family, expressed in many cell types.
Clone number:
50-6
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD150, also known as SLAM (signaling lymphocyte activation molecule) is a 70-95 kDa single chain transmembrane phosphoglycoprotein of the CD2 family. Its extracellular part contains eight potential N-glycosylation sites, and the intracellular tail contains three unique tyrosine-based motifs. These binding sites can be recognized by SH2-binding phosphatases and the adaptor proteins, such as SAP/SH2D1A or EAT-2. The SLAM family receptors are involved in leucocyte activation and contribute to the effective germinal center formation, generation of high-affinity antibody-secreting plasma cells, and memory T and B cells, thereby facilitating long-term immune response. CD150 expression is upregulated after cell activation.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human CD150-transfected 300.19 cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody SLAM.4 recognizes an extracellular epitope of CD150, a cell surface molecule expressed on lymphocytes and involved in their activation.
Clone number:
SLAM.4
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD150, also known as SLAM (signaling lymphocyte activation molecule) is a 70-95 kDa single chain transmembrane phosphoglycoprotein of the CD2 family. Its extracellular part contains eight potential N-glycosylation sites, and the intracellular tail contains three unique tyrosine-based motifs. These binding sites can be recognized by SH2-binding phosphatases and the adaptor proteins, such as SAP/SH2D1A or EAT-2. The SLAM family receptors are involved in leucocyte activation and contribute to the effective germinal center formation, generation of high-affinity antibody-secreting plasma cells, and memory T and B cells, thereby facilitating long-term immune response. CD150 expression is upregulated after cell activation.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human CD150-transfected 300.19 cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody SLAM.4 recognizes an extracellular epitope of CD150, a cell surface molecule expressed on lymphocytes and involved in their activation.
Clone number:
SLAM.4
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD15 (Lewis x), also known as stage specific embryonic antigen-1 (SSEA-1) is a trisacharide determinant (3-fucosyl-N-acetyllactosamine) expressed on several glycolipids, glycoproteins and proteoglycans of various cell types, e.g. granulocytes, mast cells, monocytes, macrophages, cells of gastric mucosa, nervous system or various tumour cells. There are several structural relatives of Lewis x, e.g. sialyl-Lewis x or sulphated Lewis x. Cells with high surface expression of Le(x) antigen exhibit strong self-aggregation, based on calcium-dependent Le(x)-Le(x) interaction. This process is involved for example in embryo compaction or in autoaggregation of teratocarcinoma cells. Sialyl-Le(x) and its isomer sialyl-Le(a) are ligands of selectins. CD15 expression has been extensively used to confirm diagnosis of Hodgkin´s disease.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human granulocytes
Applications:
FC
Additional Info:
The antibody MEM-158 reacts with CD15, a cell membrane molecule 3-fucosyl-N-acetyllactosamine (3-FAL) strongly expressed on the surface of granulocytes, monocytes, macrophages, mast cells; it is also present on Langerhans cells and some myeloid precursors cells.
Clone number:
MEM-158
Antibody Isotype:
IgM
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD15 (Lewis x), also known as stage specific embryonic antigen-1 (SSEA-1) is a trisacharide determinant (3-fucosyl-N-acetyllactosamine) expressed on several glycolipids, glycoproteins and proteoglycans of various cell types, e.g. granulocytes, mast cells, monocytes, macrophages, cells of gastric mucosa, nervous system or various tumour cells. There are several structural relatives of Lewis x, e.g. sialyl-Lewis x or sulphated Lewis x. Cells with high surface expression of Le(x) antigen exhibit strong self-aggregation, based on calcium-dependent Le(x)-Le(x) interaction. This process is involved for example in embryo compaction or in autoaggregation of teratocarcinoma cells. Sialyl-Le(x) and its isomer sialyl-Le(a) are ligands of selectins. CD15 expression has been extensively used to confirm diagnosis of Hodgkin´s disease.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
U937 histiocytic lymphoma cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody MMA reacts with an extracellular epitope of CD15, a cell membrane 3-fucosyl-N-acetyllactosamine (3-FAL) strongly expressed on granulocytes, monocytes, macrophages, mast cells; it is also present on Langerhans cells and some myeloid precursors cells. This antibody is a superior reagent for identifying of Hodgkin´s lymphoma.
Clone number:
MMA
Antibody Isotype:
IgM k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 4 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (0.4 ml) is sufficient for 100 tests.
CD15 (Lewis x), also known as stage specific embryonic antigen-1 (SSEA-1) is a trisacharide determinant (3-fucosyl-N-acetyllactosamine) expressed on several glycolipids, glycoproteins and proteoglycans of various cell types, e.g. granulocytes, mast cells, monocytes, macrophages, cells of gastric mucosa, nervous system or various tumour cells. There are several structural relatives of Lewis x, e.g. sialyl-Lewis x or sulphated Lewis x. Cells with high surface expression of Le(x) antigen exhibit strong self-aggregation, based on calcium-dependent Le(x)-Le(x) interaction. This process is involved for example in embryo compaction or in autoaggregation of teratocarcinoma cells. Sialyl-Le(x) and its isomer sialyl-Le(a) are ligands of selectins. CD15 expression has been extensively used to confirm diagnosis of Hodgkin´s disease.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human granulocytes
Applications:
FC
Additional Info:
The antibody MEM-158 reacts with CD15, a cell membrane molecule 3-fucosyl-N-acetyllactosamine (3-FAL) strongly expressed on the surface of granulocytes, monocytes, macrophages, mast cells; it is also present on Langerhans cells and some myeloid precursors cells.
Clone number:
MEM-158
Antibody Isotype:
IgM
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD15 (Lewis x), also known as stage specific embryonic antigen-1 (SSEA-1) is a trisacharide determinant (3-fucosyl-N-acetyllactosamine) expressed on several glycolipids, glycoproteins and proteoglycans of various cell types, e.g. granulocytes, mast cells, monocytes, macrophages, cells of gastric mucosa, nervous system or various tumour cells. There are several structural relatives of Lewis x, e.g. sialyl-Lewis x or sulphated Lewis x. Cells with high surface expression of Le(x) antigen exhibit strong self-aggregation, based on calcium-dependent Le(x)-Le(x) interaction. This process is involved for example in embryo compaction or in autoaggregation of teratocarcinoma cells. Sialyl-Le(x) and its isomer sialyl-Le(a) are ligands of selectins. CD15 expression has been extensively used to confirm diagnosis of Hodgkin´s disease.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
U937 histiocytic lymphoma cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody MMA reacts with an extracellular epitope of CD15, a cell membrane 3-fucosyl-N-acetyllactosamine (3-FAL) strongly expressed on granulocytes, monocytes, macrophages, mast cells; it is also present on Langerhans cells and some myeloid precursors cells. This antibody is a superior reagent for identifying of Hodgkin´s lymphoma.
Clone number:
MMA
Antibody Isotype:
IgM k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD15 (Lewis x), also known as stage specific embryonic antigen-1 (SSEA-1) is a trisacharide determinant (3-fucosyl-N-acetyllactosamine) expressed on several glycolipids, glycoproteins and proteoglycans of various cell types, e.g. granulocytes, mast cells, monocytes, macrophages, cells of gastric mucosa, nervous system or various tumour cells. There are several structural relatives of Lewis x, e.g. sialyl-Lewis x or sulphated Lewis x. Cells with high surface expression of Le(x) antigen exhibit strong self-aggregation, based on calcium-dependent Le(x)-Le(x) interaction. This process is involved for example in embryo compaction or in autoaggregation of teratocarcinoma cells. Sialyl-Le(x) and its isomer sialyl-Le(a) are ligands of selectins. CD15 expression has been extensively used to confirm diagnosis of Hodgkin´s disease.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human granulocytes
Applications:
FC
Additional Info:
The antibody MEM-158 reacts with CD15, a cell membrane molecule 3-fucosyl-N-acetyllactosamine (3-FAL) strongly expressed on the surface of granulocytes, monocytes, macrophages, mast cells; it is also present on Langerhans cells and some myeloid precursors cells.
Clone number:
MEM-158
Antibody Isotype:
IgM
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD148 (also known as HPTP-eta or DEP-1) is a transmembrane protein tyrosin phosphatase, containing eight fibronectin type III extracellular domains. This protein is known to inhibit transduction of mitogenic signals in non-hematopoietic cells (fibroblasts, epithelial cells), and signal transduction downstream of T cell receptor, however, it also augments immunoreceptor signaling in B cells and macrophages via dephosphorylating C-terminal tyrosine of Src-family tyrosine kinases. CD148 expression increases after in vitro activation of peripheral blood leucocytes. It can be also used as marker of the most mature human thymocytes, and leukemic cells corresponding to this stadium of thymocyte differentiation. In contrast, in mice the CD148 expression sharply drops through the double positive stage to the single positive thymocytes.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human recombinant CD148 (amino acids 1-444)
Applications:
FC
Additional Info:
The mouse monoclonal antibody MEM-CD148/05 recognizes an extracellular epitope of CD148, a highly glycosylated up to 250 kDa receptor-like protein tyrosin phosphatase expressed mainly in lymphocytes, myeloid cells and epithelial cells.
Clone number:
MEM-CD148/05
Antibody Isotype:
IgG2b
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD148 (also known as HPTP-eta or DEP-1) is a transmembrane protein tyrosin phosphatase, containing eight fibronectin type III extracellular domains. This protein is known to inhibit transduction of mitogenic signals in non-hematopoietic cells (fibroblasts, epithelial cells), and signal transduction downstream of T cell receptor, however, it also augments immunoreceptor signaling in B cells and macrophages via dephosphorylating C-terminal tyrosine of Src-family tyrosine kinases. CD148 expression increases after in vitro activation of peripheral blood leucocytes. It can be also used as marker of the most mature human thymocytes, and leukemic cells corresponding to this stadium of thymocyte differentiation. In contrast, in mice the CD148 expression sharply drops through the double positive stage to the single positive thymocytes.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human recombinant CD148 (amino acids 1-444)
Applications:
FC
Additional Info:
The mouse monoclonal antibody MEM-CD148/05 recognizes an extracellular epitope of CD148, a highly glycosylated up to 250 kDa receptor-like protein tyrosin phosphatase expressed mainly in lymphocytes, myeloid cells and epithelial cells.
Clone number:
MEM-CD148/05
Antibody Isotype:
IgG2b
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD147 (basigin, neurothelin, OX-47, 5A11, CE9, M6) also known as EMMPRIN (extracellular matrix metalloproteinase inducer) or TCSF (tumour cell-derived collagenase-stimulatory factor) is an ubiquitously expressed cell surface protein with multiple glycosylated forms. The highest level of CD147 expression is on metabolically active cells, such as lymphoblasts, inflammatory cells, brown adipocytes and malignant tumour cells. CD147 has multiple functions, including facilitating of cell surface expression of monocarboxylate transporter proteins and extracellular matrix metalloproteinases, regulation of integrin functions, it plays roles in cell development and activation, fetal development or retinal function.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Protein A-CR purified soluble recombinant form of CD147, CD147Rg, which consists of the cDNA coding for the hinge region, CH2-and CH3 domain of human IgG1 (CD147Rg is secreted by transfectants as a dimer).
Applications:
FC
Additional Info:
The antibody MEM-M6/1 recognizes an extracellular epitope in the N-terminal Ig domain (D1) of CD147 (Neurothelin), a 50-60 kDa type I transmembrane glycoprotein primarily expressed on all leukocytes, red blood cells, platelets and endothelial cells; it is not expressed by resting lymphocytes.
The antibody MEM-M6/1 is a high-affinity antibody capable of binding to unstimulated peripheral blood T cells.
Clone number:
MEM-M6/1
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD147 (basigin, neurothelin, OX-47, 5A11, CE9, M6) also known as EMMPRIN (extracellular matrix metalloproteinase inducer) or TCSF (tumour cell-derived collagenase-stimulatory factor) is an ubiquitously expressed cell surface protein with multiple glycosylated forms. The highest level of CD147 expression is on metabolically active cells, such as lymphoblasts, inflammatory cells, brown adipocytes and malignant tumour cells. CD147 has multiple functions, including facilitating of cell surface expression of monocarboxylate transporter proteins and extracellular matrix metalloproteinases, regulation of integrin functions, it plays roles in cell development and activation, fetal development or retinal function.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Protein A-CR purified soluble recombinant form of CD147, CD147Rg, which consists of the cDNA coding for the hinge region, CH2-and CH3 domain of human IgG1 (CD147Rg is secreted by transfectants as a dimer).
Applications:
FC
Additional Info:
The antibody MEM-M6/1 recognizes an extracellular epitope in the N-terminal Ig domain (D1) of CD147 (Neurothelin), a 50-60 kDa type I transmembrane glycoprotein primarily expressed on all leukocytes, red blood cells, platelets and endothelial cells; it is not expressed by resting lymphocytes.
The antibody MEM-M6/1 is a high-affinity antibody capable of binding to unstimulated peripheral blood T cells.
Clone number:
MEM-M6/1
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD146, also known as MCAM (melanoma cell adhesion molecule) or MUC18, is a heavily glycosylated transmembrane glycoprotein with more than 50% of the mass from carbohydrates. It is expressed on epithelial and endothelial cells, fibroblasts, multipotent mesenchymal stromal cells, activated T cells and activated keratinocytes, and on some cancer cells, especially melanoma. The presence of CD146 on circulating blood cells has been confined to the activated T cells rather than circulating endothelial cells. CD146 mediates heterophilic cell adhesion and regulates monocyte transendothelial migration.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
cultured human umbilical cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody P1H12 recognizes an extracellular epitope of CD146, a 118 kDa transmembrane glycoprotein expressed on epithelial and endothelial cells, fibroblasts, multipotent mesenchymal stromal cells, melanoma cells, activated T cells and activated keratinocytes.
Clone number:
P1H12
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD146, also known as MCAM (melanoma cell adhesion molecule) or MUC18, is a heavily glycosylated transmembrane glycoprotein with more than 50% of the mass from carbohydrates. It is expressed on epithelial and endothelial cells, fibroblasts, multipotent mesenchymal stromal cells, activated T cells and activated keratinocytes, and on some cancer cells, especially melanoma. The presence of CD146 on circulating blood cells has been confined to the activated T cells rather than circulating endothelial cells. CD146 mediates heterophilic cell adhesion and regulates monocyte transendothelial migration.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
cultured human umbilical cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody P1H12 recognizes an extracellular epitope of CD146, a 118 kDa transmembrane glycoprotein expressed on epithelial and endothelial cells, fibroblasts, multipotent mesenchymal stromal cells, melanoma cells, activated T cells and activated keratinocytes.
Clone number:
P1H12
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD144 / VE-cadherin (cadherin 5) is the major cadherin that is present at endothelial junctions. It is also strictly endothelial specific. Under vascular permeability increasing conditions (and also in capillaries and veins) CD144 is being phosphorylated, which promotes its rapid and reversible internalization. On the contrary, binding of p120 catenin (delta1 catenin) maintains CD144 localization at the plasma membrane, which stabilizes the junction and reduces vascular permeability.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human endothelial cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 55-7H1 recognizes a calcium-independent extracellular epitope on CD144 (VE-cadherin, cadherin 5), an adhesion molecule expressed on endothelial cells.
Clone number:
55-7H1
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 4 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (0.4 ml) is sufficient for 100 tests.
CD144 / VE-cadherin (cadherin 5) is the major cadherin that is present at endothelial junctions. It is also strictly endothelial specific. Under vascular permeability increasing conditions (and also in capillaries and veins) CD144 is being phosphorylated, which promotes its rapid and reversible internalization. On the contrary, binding of p120 catenin (delta1 catenin) maintains CD144 localization at the plasma membrane, which stabilizes the junction and reduces vascular permeability.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human endothelial cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 55-7H1 recognizes a calcium-independent extracellular epitope on CD144 (VE-cadherin, cadherin 5), an adhesion molecule expressed on endothelial cells.
Clone number:
55-7H1
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD143, also known as ACE (angiotensin-converting enzyme), carboxycathepsin, kininase II, peptidase P, or peptidyl dipeptidase 1, is a transmembrane zinc metallopeptidase catalyzing the conversion of angiotensin I into the physiologically active angiotensin II, which is a potent vasopressor and aldosterone-stimulating peptide that controls blood pressure and fluid-electrolyte balance. This enzyme plays a key role in the renin-angiotensin system. Multiple alternatively spliced transcript variants encoding different isoforms have been identified, and two most abundant spliced variants encode the somatic form and the testicular form, that are equally active. CD143 is expressed mainly on endothelial cells, but it can be found also e.g. on activated macrophages and histiocytes.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
dendritic cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 5-369 recognizes an extracellular epitope of CD143, a 171 kDa type I transmembrane glycoprotein with metallopeptidase activity, expressed mainly on endothelial cells.
Clone number:
5-369
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD142, also known as coagulation factor III, tissue thromboplastin, and tissue factor. It is a transmembrane glycoprotein, which enables cells to initiate the blood coagulation cascades, and functions as the high-affinity receptor for the coagulation factor VII. The resulting complex provides a catalytic event that is responsible for initiation of the coagulation protease cascades by specific limited proteolysis. Unlike the other cofactors of these protease cascades, which circulate as nonfunctional precursors, this factor is a potent initiator that is fully functional when expressed on cell surfaces. It is the only one factor in the coagulation pathway for which a congenital deficiency has not been described.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human brain tissue factor (CD142)
Applications:
FC
Additional Info:
The mouse monoclonal antibody HTF-1, also known as HTF1-7B8, recognizes an extracellular epitope of CD142 (tissue factor, coagulation factor III), a type I glycoprotein expressed on endothelial cells, monocytes, macrophages, and platelets upon induction by inflammatory mediators, and expressed constitutively by some tumors, the vasculature, placenta, kidney, and central nervous system.
Clone number:
HTF-1
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD140b / PDGF-RB (platelet-derived growth factor receptor beta) is a cell surface receptor for members of platelet-derived growth factor family, whose intracellular part contains a tyrosine kinase domain. CD140b forms homodimers, or heterodimerizes with CD140a / PDGF-RA. Whereas CD140a can have both pro-proliferative or anti-proliferative effects, the CD140b induces in various cell types their proliferation and migration. CD140b has also developmental roles in the cardiovascular system and is preferentially expressed on some tumours such as medulloblastoma.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
CD140b-transfected NIH 3T3 cells
Applications:
FC
Additional Info:
The monoclonal antibody 18A2 recognizes an extracellular epitope of CD140b / PDGF-RB, the 180-190 kDa beta chain of platelet-derived growth factor receptor, which is widely expressed on a variety of mesenchymal-derived cells and plays pro-proliferative roles.
Clone number:
18A2
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD140b / PDGF-RB (platelet-derived growth factor receptor beta) is a cell surface receptor for members of platelet-derived growth factor family, whose intracellular part contains a tyrosine kinase domain. CD140b forms homodimers, or heterodimerizes with CD140a / PDGF-RA. Whereas CD140a can have both pro-proliferative or anti-proliferative effects, the CD140b induces in various cell types their proliferation and migration. CD140b has also developmental roles in the cardiovascular system and is preferentially expressed on some tumours such as medulloblastoma.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
CD140b-transfected NIH 3T3 cells
Applications:
FC
Additional Info:
The monoclonal antibody 18A2 recognizes an extracellular epitope of CD140b / PDGF-RB, the 180-190 kDa beta chain of platelet-derived growth factor receptor, which is widely expressed on a variety of mesenchymal-derived cells and plays pro-proliferative roles.
Clone number:
18A2
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD140a / PDGF-RA (platelet-derived growth factor receptor alpha) is a cell surface receptor for members of platelet-derived growth factor family, whose intracellular part contains a tyrosine kinase domain. CD140a forms homodimers, or heterodimerizes with CD140b / PDGF-RB. Whereas CD140b induces in different cell types their proliferation and migration, the role of CD140a is more controversial, with pro-proliferative or anti-proliferative effects. CD140a has early developmental functions, mediates mesodermal cell migration, and later acts in signaling associated in epithelial-mesenchymal interactions.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
CD140a-transfected NIH 3T3 cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 16A1 recognizes an extracellular epitope of CD140a / PDGF-RA, the 170 kDa alpha chain of platelet-derived growth factor receptor, which is widely expressed on a variety of mesenchymal-derived cells and plays pro-proliferative or anti-proliferative roles in various tumours.
Clone number:
16A1
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
The antibody MEM-136 recognizes common epitope on beta-chain of human HLA-DR and HLA-DP. It reacts with alpha/beta dimer as well as with dissociated beta-subunit. DR and DP are the isotypes of human MHC Class II molecules expressed on antigen-presenting cells (APC; dendritic cells, B lymphocytes, monocytes, macrophages).
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
PHA-activated peripheral blood lymphocytes.
Applications:
FC
Additional Info:
The antibody MEM-136 recognizes a common extracellular epitope on beta-chain of human HLA-DR and HLA-DP. It reacts with alpha/beta dimer as well as with dissociated beta-subunit. DR and DP are the isotypes of human MHC Class II molecules expressed on antigen-presenting cells (APC; dendritic cells, B lymphocytes, monocytes, macrophages).
Clone number:
MEM-136
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
HLA-DR, a member of MHC class II glycoproteins, that bind intracellularly processed peptides and present them to the Th cells, is composed of 36 kDa alpha chain and 27 kDa beta chain, both anchored in the plasma membrane. Together with other MHC II molecules HLA-DR plays a central role in the immune system.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
thymocyte membrane
Applications:
FC
Additional Info:
The antibody MEM-12 recognizes a common extracellular epitope on human HLA-DR which is dependent on the association of alpha and beta chains. DR is the isotype of human MHC Class II molecules expressed on antigen-presenting cells (APC; dendritic cells, B lymphocytes, monocytes, macrophages).
Clone number:
MEM-12
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
HLA-DR, a member of MHC class II glycoproteins, that bind intracellularly processed peptides and present them to the Th cells, is composed of 36 kDa alpha chain and 27 kDa beta chain, both anchored in the plasma membrane. Together with other MHC II molecules HLA-DR plays a central role in the immune system.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human B lymphocytes
Applications:
FC
Additional Info:
The mouse monoclonal antibody L243 recognizes specifically an extracellular epitope on HLA-DR molecules, both peptide-loaded and empty.
Clone number:
L243
Antibody Isotype:
IgG2a k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
HLA-DR, a member of MHC class II glycoproteins, that bind intracellularly processed peptides and present them to the Th cells, is composed of 36 kDa alpha chain and 27 kDa beta chain, both anchored in the plasma membrane. Together with other MHC II molecules HLA-DR plays a central role in the immune system.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
thymocyte membrane
Applications:
FC
Additional Info:
The antibody MEM-12 recognizes a common extracellular epitope on human HLA-DR which is dependent on the association of alpha and beta chains. DR is the isotype of human MHC Class II molecules expressed on antigen-presenting cells (APC; dendritic cells, B lymphocytes, monocytes, macrophages).
Clone number:
MEM-12
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
HLA-DR, a member of MHC class II glycoproteins, that bind intracellularly processed peptides and present them to the Th cells, is composed of 36 kDa alpha chain and 27 kDa beta chain, both anchored in the plasma membrane. Together with other MHC II molecules HLA-DR plays a central role in the immune system.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human B lymphocytes
Applications:
FC
Additional Info:
The mouse monoclonal antibody L243 recognizes specifically an extracellular epitope on HLA-DR molecules, both peptide-loaded and empty.
Clone number:
L243
Antibody Isotype:
IgG2a k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
HLA-DR, a member of MHC class II glycoproteins, that bind intracellularly processed peptides and present them to the Th cells, is composed of 36 kDa alpha chain and 27 kDa beta chain, both anchored in the plasma membrane. Together with other MHC II molecules HLA-DR plays a central role in the immune system.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
thymocyte membrane
Applications:
FC
Additional Info:
The antibody MEM-12 recognizes a common extracellular epitope on human HLA-DR which is dependent on the association of alpha and beta chains. DR is the isotype of human MHC Class II molecules expressed on antigen-presenting cells (APC; dendritic cells, B lymphocytes, monocytes, macrophages).
Clone number:
MEM-12
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
HLA-B7 allele of human HLA class I major histocompatibility (MHC) antigen indicates higher risk of breast cancer and cervical cancer. Expression of HLA-B7 together with HLA-B27 is associated with increased susceptibility to spondyloarthropaties. Flow cytometry detection of these two alleles is being used to screen for patients, who suffer from inflammatory disorders affecting the sacroiliac and intervertebral joints, such as ankylosing spondylosis (AS). The HLA-B7 antigen (11 alleles) is expressed in 22% of healthy Caucasian individuals.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Papain solubilised HLA-A2, B7
Applications:
FC
Additional Info:
The mouse monoclonal antibody BB7.1 recognizes an extracellular antigen of HLA-B7 antigen. Although highly specific, it can cross-react with HLA-B42 antigen.
Clone number:
BB7.1
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
HLA-A2 (44 kDa) is the most frequent HLA-A allele in human ethnic populations. HLA-A, together with HLA-B and HLA-C, represent human HLA class I major histocompatibility (MHC) antigens. These intrinsic membrane glycoproteins are expressed on nucleated cells and noncovalently associate with an invariant beta2 microglobulin. They carry foreign determinants important for immune recognition by cytotoxic T cells, thus important for anti-viral and anti-tumour defence.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
HLA-A2 solubilised by papain
Applications:
FC
Additional Info:
The antibody BB7.2 recognizes an extracellular epitope at the C-terminus of alpha-2 helix and a turn on one of the underlying beta strands within the human HLA-A2 histocompatibility antigen.
Clone number:
BB7.2
Antibody Isotype:
IgG2b
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
GRAP2/GADS (Grb2-related adaptor protein 2 / Grb2-related adaptor downstream of Shc) is a cytoplasmic adaptor protein containing N- and C-terminal SH3 domains flanking a central SH2 domain and a proline/glutamine-rich region. It is expressed predominantly in lymphoid tissue and hematopoietic cells, particularly in T cells. GRAP2/GADS plays a pivotal role during the early events of T cell signal transduction by recruiting the adaptor protein SLP-76 and its associated molecules, such as Vav, Nck, Itk, and ADAP, to the transmembrane adaptor protein LAT. GRAP2/GADS also binds several other signaling proteins, namely Gab2, HPK1 (hematopoietic progenitor kinase 1), and Cbl. Unlike similar adaptor protein Grb2, GRAP2/GADS shows higher selectivity when binding to the particular phosphorylated tyrosines of LAT adaptor.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
GST-fusion human GRAP2/GADS protein
Applications:
FC
Additional Info:
The mouse monoclonal antibody UW40 recognizes GRAP2/GADS, a 41 kDa cytoplasmic adaptor protein that plays a pivotal role during the early events of signal transduction in T cells.
GRAP2/GADS (Grb2-related adaptor protein 2 / Grb2-related adaptor downstream of Shc) is a cytoplasmic adaptor protein containing N- and C-terminal SH3 domains flanking a central SH2 domain and a proline/glutamine-rich region. It is expressed predominantly in lymphoid tissue and hematopoietic cells, particularly in T cells. GRAP2/GADS plays a pivotal role during the early events of T cell signal transduction by recruiting the adaptor protein SLP-76 and its associated molecules, such as Vav, Nck, Itk, and ADAP, to the transmembrane adaptor protein LAT. GRAP2/GADS also binds several other signaling proteins, namely Gab2, HPK1 (hematopoietic progenitor kinase 1), and Cbl. Unlike similar adaptor protein Grb2, GRAP2/GADS shows higher selectivity when binding to the particular phosphorylated tyrosines of LAT adaptor.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
GST-fusion human GRAP2/GADS protein
Applications:
FC
Additional Info:
The mouse monoclonal antibody UW40 recognizes GRAP2/GADS, a 41 kDa cytoplasmic adaptor protein that plays a pivotal role during the early events of signal transduction in T cells.
CD133 (prominin 1) is a 5-transmembrane glycoprotein with extracellular N- and intracellular C-terminus. CD133 function remains to be elucidated, but it can be used as a cancer stem cell marker. Its expression pattern in progenitor cells is similar to CD34, i.e. on hematopoietic stem cells in bone marrow, cord blood, neural stem cells, retinoblastoma, or endothelial precursor cells (not mature endothelial cells). It is being used for identification and isolation of hematopoietic stem cells, including isolation for stem cell transplantation. Expression of CD133 correlates with differentiation of human colon cancer cells.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human CD133 transfectants
Applications:
FC
Additional Info:
The mouse monoclonal antibody 293C3 recognizes the extracellular epitope 2 on human CD133 (CD133/2), a 120 kDa glycoprotein of prominin family, expressed e.g. on progenitor cells. This antibody is important for identification of human renal progenitors.
Clone number:
293C3
Antibody Isotype:
IgG2b
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD133 (prominin 1) is a 5-transmembrane glycoprotein with extracellular N- and intracellular C-terminus. CD133 function remains to be elucidated, but it can be used as a cancer stem cell marker. Its expression pattern in progenitor cells is similar to CD34, i.e. on hematopoietic stem cells in bone marrow, cord blood, neural stem cells, retinoblastoma, or endothelial precursor cells (not mature endothelial cells). It is being used for identification and isolation of hematopoietic stem cells, including isolation for stem cell transplantation. Expression of CD133 correlates with differentiation of human colon cancer cells.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
WERI-RB-1 retinoblastoma cell line
Applications:
FC
Additional Info:
The mouse monoclonal antibody W6B3C1 recognizes the extracellular glycosylated epitope 1 on human CD133 (CD133/1), a 120 kDa glycoprotein of prominin family, expressed e.g. on progenitor cells. This antibody is important for identification of stem cells and tumor cells.
Clone number:
W6B3C1
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD133 (prominin 1) is a 5-transmembrane glycoprotein with extracellular N- and intracellular C-terminus. CD133 function remains to be elucidated, but it can be used as a cancer stem cell marker. Its expression pattern in progenitor cells is similar to CD34, i.e. on hematopoietic stem cells in bone marrow, cord blood, neural stem cells, retinoblastoma, or endothelial precursor cells (not mature endothelial cells). It is being used for identification and isolation of hematopoietic stem cells, including isolation for stem cell transplantation. Expression of CD133 correlates with differentiation of human colon cancer cells.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
WERI-RB-1 retinoblastoma cell line
Applications:
FC
Additional Info:
The mouse monoclonal antibody W6B3C1 recognizes the extracellular glycosylated epitope 1 on human CD133 (CD133/1), a 120 kDa glycoprotein of prominin family, expressed e.g. on progenitor cells. This antibody is important for identification of stem cells and tumor cells.
Clone number:
W6B3C1
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD133 (prominin 1) is a 5-transmembrane glycoprotein with extracellular N- and intracellular C-terminus. CD133 function remains to be elucidated, but it can be used as a cancer stem cell marker. Its expression pattern in progenitor cells is similar to CD34, i.e. on hematopoietic stem cells in bone marrow, cord blood, neural stem cells, retinoblastoma, or endothelial precursor cells (not mature endothelial cells). It is being used for identification and isolation of hematopoietic stem cells, including isolation for stem cell transplantation. Expression of CD133 correlates with differentiation of human colon cancer cells.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human CD133 transfectants
Applications:
FC
Additional Info:
The mouse monoclonal antibody 293C3 recognizes the extracellular epitope 2 on human CD133 (CD133/2), a 120 kDa glycoprotein of prominin family, expressed e.g. on progenitor cells. This antibody is important for identification of human renal progenitors.
Clone number:
293C3
Antibody Isotype:
IgG2b
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD132 / common gamma chain is an essential component of receptors for IL-2, IL-4, IL-7, IL-9, IL-15, and IL-21, and it is critical for development of the immune system. Its mutation causes X-linked severe combined immunodeficiency disease (XSCID). CD132 is expressed on lymphocytes, NK cells, monocytes, and granulocytes. Through its cytoplasmic part which containsfour tyrosines and an SH2 domain, CD132 transcuces signal to downstream JAK/STAT pathway.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human CD132-transfected cell line
Applications:
FC
Additional Info:
The rat monoclonal antibody TUGh4 recognizes an extracellular epitope of CD132 (the common gamma chain), a 65-70 kDa type I transmembrane glycoprotein broadly expressed by most leukocytes.
Clone number:
TUGh4
Antibody Isotype:
IgG2b k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD13 (aminopeptidase N, APN) is a 150 kDa type II transmembrane zinc-binding ectopeptidase expressed on various cell types. This metalloprotease preferentially catalyzes removal of neutral amino acids from small peptides, thus activating or inactivating bioactive peptides. CD13 has also role in extracellular matrix degradation, antigen processing and signal transduction, is important in inflammatory responses, regulates intercellular contact, cell motility and vascularization. CD13 is involved in protection of leukemic cells against apoptosis and its expression associated with poor prognosis of carcinomas.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human AML cells
Applications:
FC
Additional Info:
The antibody WM15 recognises an extracellular epitope of human CD13 cell surface glycoprotein, a 150 kDa molecule expressed on granulocytes, endothelial cells, epithelial cells and myeloid progenitors.
Clone number:
WM15
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD13 (aminopeptidase N, APN) is a 150 kDa type II transmembrane zinc-binding ectopeptidase expressed on various cell types. This metalloprotease preferentially catalyzes removal of neutral amino acids from small peptides, thus activating or inactivating bioactive peptides. CD13 has also role in extracellular matrix degradation, antigen processing and signal transduction, is important in inflammatory responses, regulates intercellular contact, cell motility and vascularization. CD13 is involved in protection of leukemic cells against apoptosis and its expression associated with poor prognosis of carcinomas.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human AML cells
Applications:
FC
Additional Info:
The antibody WM15 recognises an extracellular epitope of human CD13 cell surface glycoprotein, a 150 kDa molecule expressed on granulocytes, endothelial cells, epithelial cells and myeloid progenitors.
Clone number:
WM15
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD13 (aminopeptidase N, APN) is a 150 kDa type II transmembrane zinc-binding ectopeptidase expressed on various cell types. This metalloprotease preferentially catalyzes removal of neutral amino acids from small peptides, thus activating or inactivating bioactive peptides. CD13 has also role in extracellular matrix degradation, antigen processing and signal transduction, is important in inflammatory responses, regulates intercellular contact, cell motility and vascularization. CD13 is involved in protection of leukemic cells against apoptosis and its expression associated with poor prognosis of carcinomas.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human AML cells
Applications:
FC
Additional Info:
The antibody WM15 recognises an extracellular epitope of human CD13 cell surface glycoprotein, a 150 kDa molecule expressed on granulocytes, endothelial cells, epithelial cells and myeloid progenitors.
Clone number:
WM15
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD129 serves as the high affinity alpha subunit of IL-9 receptor. It associates with CD132, the common gamma chain shared by receptors of many different cytokines. CD129 is expressed at low levels by T and B cells, blood cell progenitors, eosinophils, mast cells, epithelial cells, muscle cells and neurons. Its signaling (through JAK/STAT pathways) results in proliferative and anti-apoptotic response, which is critical e.g. for intrathymic T cell development and survival of various cell types. The gene for CD129 is located at the pseudoautosomal regions of X and Y chromosomes and it may be related with the development of asthma.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human CD129-transfected cell line
Applications:
FC
Additional Info:
The mouse monoclonal antibody AH9R7 recognizes an extracellular epitope of CD129 / IL-9R alpha, a 57 kDa type I transmembrane glycoprotein expressed at low levels by lymphocytes, blood cell progenitors, eosinophils, mast cells, epithelial cells, muscle cells and neurons.
Clone number:
AH9R7
Antibody Isotype:
IgG2b k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD123 is the alpha chain of interleukin 3 receptor (IL-3R alpha). This subunit heterodimerizes with the interleukin 3 receptor beta chain (CD131), which is shared with other receptors. CD123 interacts with IL-3 specifically, but with low affinity, and association with the beta subunit confers high affinity binding to the receptor heterodimer. Both chains are required for signaling, but receptor activation and signal transduction depend on IL-3 binding to CD123 as the initial step.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
IL3 receptor alpha chain expressed on the surface of transiently transfected COS cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 6H6 recognizes an extracellular epitope of CD123 (interleukin 3 receptor alpha), a 60-70 kDa transmembrane protein expressed by myeloid precursors, megakaryocytes, macrophages, dendritic cells, mast cells, basophils, and some B cells. This antibody does not inhibit IL-3 binding to its receptor.
Clone number:
6H6
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD123 is the alpha chain of interleukin 3 receptor (IL-3R alpha). This subunit heterodimerizes with the interleukin 3 receptor beta chain (CD131), which is shared with other receptors. CD123 interacts with IL-3 specifically, but with low affinity, and association with the beta subunit confers high affinity binding to the receptor heterodimer. Both chains are required for signaling, but receptor activation and signal transduction depend on IL-3 binding to CD123 as the initial step.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
IL3 receptor alpha chain expressed on the surface of transiently transfected COS cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 6H6 recognizes an extracellular epitope of CD123 (interleukin 3 receptor alpha), a 60-70 kDa transmembrane protein expressed by myeloid precursors, megakaryocytes, macrophages, dendritic cells, mast cells, basophils, and some B cells. This antibody does not inhibit IL-3 binding to its receptor.
Clone number:
6H6
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD122 (IL-2/IL-15R beta) constitutes together with CD132 (common gamma chain) and with CD25 (IL-2/IL15R alpha) the intermediate (CD122+CD132) and the high affinity (CD122+CD132+CD25) IL-2 and IL-15 receptor complex. CD122 is expressed on NK cells and lymphocytes, but at low level, unless the cell is activated. The cytoplasmic part of CD122 binds to Src-family and Jak-family kinases. The biological effect of CD122 ligation depends on whether IL-2 or IL-15 is bound to the receptor complex.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
TL-Mor cell line
Applications:
FC
Additional Info:
The mouse monoclonal antibody TU27 recognizes an extracellular epitope of CD122 (IL-2R beta), a 70-75 kDa type I transmembrane glycoprotein constitutively expressed by NK cells and a T cell subset, and upregulated upon activation.
Clone number:
TU27
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD122 (IL-2/IL-15R beta) constitutes together with CD132 (common gamma chain) and with CD25 (IL-2/IL15R alpha) the intermediate (CD122+CD132) and the high affinity (CD122+CD132+CD25) IL-2 and IL-15 receptor complex. CD122 is expressed on NK cells and lymphocytes, but at low level, unless the cell is activated. The cytoplasmic part of CD122 binds to Src-family and Jak-family kinases. The biological effect of CD122 ligation depends on whether IL-2 or IL-15 is bound to the receptor complex.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
TL-Mor cell line
Applications:
FC
Additional Info:
The mouse monoclonal antibody TU27 recognizes an extracellular epitope of CD122 (IL-2R beta), a 70-75 kDa type I transmembrane glycoprotein constitutively expressed by NK cells and a T cell subset, and upregulated upon activation.
Clone number:
TU27
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD120a / TNF R1, also known as TNFR55 or TNFRSF1A, is a 55 kDa receptor for tumor necrosis factor alpha and it is expressed in most tissues. By binding its trimeric ligand the CD120a protein forms trimers and the conformation change leads to dissociation of the inhibitory factor SODD from its intracellular death domain and in formation of signaling platform. CD120a can mediate apoptosis, and function as a regulator of inflammation. Germline mutations of the extracellular domains of this receptor were found to be associated with the autosomal dominant periodic fever syndrome. The impaired receptor clearance is thought to be a mechanism of the disease.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Recombinant full length human CD120a
Applications:
FC
Additional Info:
The mouse monoclonal antibody H398 recognizes the extracellular domain of CD120a, a 55 kDa receptor for tumor necrosis factor. The antibody blocks biological activity of both natural and recombinant human TNF alpha and TNF beta.
Clone number:
H398
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
Mouse anti-Delta chain of human Immunoglobulin D, clone DRN1C (monoclonal)
Antibody Type:
Monoclonal
Host Animal:
Mouse
Species Reactivity:
human
Immunogen:
Prokaryotic recombinant protein corresponding to 222 amino acids of the N terminus of the delta heavy chain constant region of the human immunoglobulin D molecule.
IgD, together with IgM, are the major immunoglobulins expressed on the surface of B cells where it seems they may operate as mutually interacting antigen receptors for the control of lymphocyte activation and suppression. The greater susceptibility of IgD to proteolysis in combination with antigen could well be implicated in such a function. The use of PBS-based diluents may result in increased background staining. Clone DRN1C was developed to produce reduced background staining that is associated with polyclonal antibodies on paraffin sections.
Antibody Isotype:
IgG1
Monosan Range:
MONXtra
Clone:
DRN1C
Concentration:
Greater than or equal to 133 mg/L
Storage buffer:
Tissue culture supernatant with Sodium azide
Storage:
2-8°C
References 1:
Geisberger R et al. Immunology. 2006; 118:429-437
References 2:
Preudhomme J et al. Molecular Immunology. 2000; 37:871-887
References 3:
Vladutiu A. Clinical and diagnostic laboratory immunology. 2000; 7(2):131-140
Smoothelin is a constituent of the smooth muscle cell (SMC) cytoskeleton. Antibodies directed to smoothelin are useful tools to monitor SMC differentiation. Smoothelin is exclusively expressed in fully differentiated (contractile) SMCs. RNA and protein analyses revealed a broad species distribution of this protein. Smoothelin has also been detected in smooth-muscle neoplasms. Cells with SMC-like characteristics, such as myofibroblasts and myoepithelial cells, as well as skeletal and cardiac muscle do not contain smoothelin. Confocal scanning laser microscopy of tissue sections and cells in culture show a filamentous organization of smoothelin colocalizing with actin stress fibers. In immunoblots two molecular weight isoforms are detected i.e. a 59 kDa isoform specific for visceral SMC (smoothelin A), and an isoform with a molecular weight of approximately 100 kDa in vascular SMC (smoothelin B). Human smoothelin is encoded by a single copy gene which is loCated on chromosome 22.
CD45RA is a high molecular weight isoform of a receptor-type protein tyrosine phosphatase, CD45 glycoprotein. CD45 is crucial in lymphocyte development and antigen signaling, serving as an important regulator of Src-family kinases, promotes cell survival by modulating integrin-mediated signal transduction pathway and is also involved in DNA fragmentation during apoptosis. CD45 isoforms differ in their extracellular domains, whereas they share identical transmembrane and cytoplasmic domains. These isoforms differ in their ability to translocate into the glycosphingolipid-enriched membrane domains and their expression depends on cell type and physiological state of the cell. CD45RA is expressed e.g. on naïve T cells and normal plasma cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human thymocytes and T lymphocytes.
Applications:
FC
Additional Info:
The antibody MEM-56 reacts with an extracellular epitope of CD45RA, a 205-220 kDa single chain type I glycoprotein, variant of CD45 (CD45RA isoform). CD45RA is expressed on most of B lymphocytes, resting and native T lymphocytes, medullar thymocytes and monocytes.
Clone number:
MEM-56
Antibody Isotype:
IgG2b
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD318 (CUB domain containing protein 1) is a complement domains-containing transmembrane glycoprotein, which takes part in early hematopoiesis. It is expressed on CD34+CD133+ bone marrow cells, keratinocytes, and in human colorectal and breast cancers. It is being used as a marker of mesenchymal stem-like cells, neural progenitor cells, and also as an independent marker for the diagnosis of myeloid leukemias.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
NIH-3T3/CD318 cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody CUB1 recognizes an extracellular epitope of CD318, a type I transmembrane protein involved in early hematopoiesis.
CD318 (CUB domain containing protein 1) is a complement domains-containing transmembrane glycoprotein, which takes part in early hematopoiesis. It is expressed on CD34+CD133+ bone marrow cells, keratinocytes, and in human colorectal and breast cancers. It is being used as a marker of mesenchymal stem-like cells, neural progenitor cells, and also as an independent marker for the diagnosis of myeloid leukemias.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
NIH-3T3/CD318 cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody CUB1 recognizes an extracellular epitope of CD318, a type I transmembrane protein involved in early hematopoiesis.
Clone number:
CUB1
Antibody Isotype:
IgG2b
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD314, also known as NKG2D (natural killer receptor G2D) or KLRK1 (killer cell lectin-like receptor subfamily K, member 1), is a homodimeric C-type lectin-like activating receptor and costimulator with type II membrane orientation (C teminus extracellular). CD314 homodimers are associated with DAP10, a membrane adaptor protein that signals similar to CD28 by recruitment of phosphatidylinositol 3-kinase. Engagement of CD314 amplifies antigen-specific T cell responses in CD314-positive T cell populations. In NK cells, CD314 is a primary activating receptor. As CD314 ligands the MHC class-I chain-related proteins A and B (MICA, MICB) and UL16-binding proteins (ULBPs) have been identified.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
NKL cell line
Applications:
FC
Additional Info:
The mouse monoclonal antibody 1D11 recognizes an extracellular epitope of CD314 / NKG2D, a 42 kDa C-type lectin-like activating receptor expressed by NK cells, gamma/delta T cells, and CD8+ T cells.
Clone number:
1D11
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD314, also known as NKG2D (natural killer receptor G2D) or KLRK1 (killer cell lectin-like receptor subfamily K, member 1), is a homodimeric C-type lectin-like activating receptor and costimulator with type II membrane orientation (C teminus extracellular). CD314 homodimers are associated with DAP10, a membrane adaptor protein that signals similar to CD28 by recruitment of phosphatidylinositol 3-kinase. Engagement of CD314 amplifies antigen-specific T cell responses in CD314-positive T cell populations. In NK cells, CD314 is a primary activating receptor. As CD314 ligands the MHC class-I chain-related proteins A and B (MICA, MICB) and UL16-binding proteins (ULBPs) have been identified.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
NKL cell line
Applications:
FC
Additional Info:
The mouse monoclonal antibody 1D11 recognizes an extracellular epitope of CD314 / NKG2D, a 42 kDa C-type lectin-like activating receptor expressed by NK cells, gamma/delta T cells, and CD8+ T cells.
Clone number:
1D11
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD31 (platelet endothelial cell adhesion molecule-1, PECAM-1) is an inhibitory coreceptor involved in regulation of T cell and B cell signaling by a dual immunoreceptor tyrosine-based inhibitory motif (ITIM) that upon associated kinases-mediated phosphorylation provide docking sites for protein-tyrosine phosphatases. CD31 is expressed ubiquitously within the vascular compartment and is located mainly at junctions between adjacent cells. N-terminal Ig-like domain of CD31 is responsible for its homophilic binding, which plays an important role in cell-cell interactions. CD31 is a multifunctional molecule with diverse roles in modulation of integrin-mediated cell adhesion, transendothelial migration, angiogenesis, apoptosis, negative regulation of immunoreceptor signaling, autoimmunity, macrophage phagocytosis, IgE-mediated anaphylaxis and thrombosis. It is one of key regulatory molecules in vascular system.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Leukocytes of a patient suffering from LGL-type leukaemia
Applications:
FC
Additional Info:
The antibody MEM-05 reacts with an extracellular epitope of CD31 (PECAM-1), a 130-140 kDa type I transmembrane glycoprotein expressed on monocytes, platelets, granulocytes, endothelial cells and stem cells of the myeloid lineage.
Clone number:
MEM-05
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD31 (platelet endothelial cell adhesion molecule-1, PECAM-1) is an inhibitory coreceptor involved in regulation of T cell and B cell signaling by a dual immunoreceptor tyrosine-based inhibitory motif (ITIM) that upon associated kinases-mediated phosphorylation provide docking sites for protein-tyrosine phosphatases. CD31 is expressed ubiquitously within the vascular compartment and is located mainly at junctions between adjacent cells. N-terminal Ig-like domain of CD31 is responsible for its homophilic binding, which plays an important role in cell-cell interactions. CD31 is a multifunctional molecule with diverse roles in modulation of integrin-mediated cell adhesion, transendothelial migration, angiogenesis, apoptosis, negative regulation of immunoreceptor signaling, autoimmunity, macrophage phagocytosis, IgE-mediated anaphylaxis and thrombosis. It is one of key regulatory molecules in vascular system.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Leukocytes of a patient suffering from LGL-type leukaemia
Applications:
FC
Additional Info:
The antibody MEM-05 reacts with an extracellular epitope of CD31 (PECAM-1), a 130-140 kDa type I transmembrane glycoprotein expressed on monocytes, platelets, granulocytes, endothelial cells and stem cells of the myeloid lineage.
Clone number:
MEM-05
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD31 (platelet endothelial cell adhesion molecule-1, PECAM-1) is an inhibitory coreceptor involved in regulation of T cell and B cell signaling by a dual immunoreceptor tyrosine-based inhibitory motif (ITIM) that upon associated kinases-mediated phosphorylation provide docking sites for protein-tyrosine phosphatases. CD31 is expressed ubiquitously within the vascular compartment and is located mainly at junctions between adjacent cells. N-terminal Ig-like domain of CD31 is responsible for its homophilic binding, which plays an important role in cell-cell interactions. CD31 is a multifunctional molecule with diverse roles in modulation of integrin-mediated cell adhesion, transendothelial migration, angiogenesis, apoptosis, negative regulation of immunoreceptor signaling, autoimmunity, macrophage phagocytosis, IgE-mediated anaphylaxis and thrombosis. It is one of key regulatory molecules in vascular system.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Leukocytes of a patient suffering from LGL-type leukaemia
Applications:
FC
Additional Info:
The antibody MEM-05 reacts with an extracellular epitope of CD31 (PECAM-1), a 130-140 kDa type I transmembrane glycoprotein expressed on monocytes, platelets, granulocytes, endothelial cells and stem cells of the myeloid lineage.
Clone number:
MEM-05
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD307d is a type I transmembrane glycoprotein of the Fc receptor family. It contains two ITIM motifs and one ITSM motif in its cytoplasmic domain. CD307d is expressed mainly on the surface of memory B cells in mucosa-associated lymphoid tissues. It binds to aggregated immunoglobulin molecules (IgA, IgG). Defects of CD307d may play a role in HIV-induced memory B cell dysfunction.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
DNA-immunization followed by a boost with CD307d-transfected cells
Applications:
FC
Clone number:
A1
Antibody Isotype:
IgG2a k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD307c is a type I transmembrane glycoprotein of the Fc receptor family. It contains both ITAM and ITIM motifs in its cytoplasmic domain. CD307c is expressed on the surface of NK cells, and T, Treg, B and plasma cell subsets. It seems to play a role in the regulation of immune response. Defects in CD307c function can result in autoimmune diseases, e.g. rheumatoid arthritis or systemic lupus erythematosus.
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
DNA-immunization followed by a boost with CD307c transfected cells
CD307a is a type I transmembrane glycoprotein of the Fc receptor family. It contains two ITAM motifs in its cytoplasmic domain. CD307a is expressed mainly on the surface of mature B-cells, and is down-regulated in germinal center B-cells. Expression of CD307a is higher in patients with autoimmune diseases, compared with healthy controls.
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
DNA-immunization followed by a boost with the CD307a transfected cells
CD305, also known as LAIR1 (leukocyte-associated Ig-like receptor 1), is an inhibitory receptor found on many types of peripheral blood cells. It serves to suppress cell cytotoxicity, activation, proliferation, and differentiation regarding autoantigens via its two intracellular ITIM sites. CD305 belongs to the immunoglobulin superfamily and the leukocyte-associated inhibitory receptor family of proteins. It reacts with collagen ligands.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Activated NK cells and CD3- thymocytes
Applications:
FC
Additional Info:
The mouse monoclonal antibody NKTA255 recognizes an extracellular epitope of CD305 / LAIR1, a 40 kDa type I transmembrane glycoprotein expressed on NK, T, and B cells, monocytes, dendritic cells, eosinophils, basophils, mast cells, CD34+ hematopoietic progenitor cells and thymocytes.
Clone number:
NKTA255
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD305, also known as LAIR1 (leukocyte-associated Ig-like receptor 1), is an inhibitory receptor found on many types of peripheral blood cells. It serves to suppress cell cytotoxicity, activation, proliferation, and differentiation regarding autoantigens via its two intracellular ITIM sites. CD305 belongs to the immunoglobulin superfamily and the leukocyte-associated inhibitory receptor family of proteins. It reacts with collagen ligands.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Activated NK cells and CD3- thymocytes
Applications:
FC
Additional Info:
The mouse monoclonal antibody NKTA255 recognizes an extracellular epitope of CD305 / LAIR1, a 40 kDa type I transmembrane glycoprotein expressed on NK, T, and B cells, monocytes, dendritic cells, eosinophils, basophils, mast cells, CD34+ hematopoietic progenitor cells and thymocytes.
Clone number:
NKTA255
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD300e / IREM-2 (immune receptor expressed by myeloid cells 2), also known as CLM2 or LMIR6, is a monomeric transmembrane glycoprotein with a single extracellular immunoglobulin-like domain. Intracellularly it associates with DAP-12, an ITAM-containing adaptor molecule. CD300e is expressed on mature monocytes and peripheral blood myeloid dendritic cells. Its crosslinking leads to release of pro-inflammatory cytokines, and increased expression of activation markers.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
CD300e-HA-transfected cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody UP-H2 recognizes an extracellular epitope on CD300e / IREM-2, a 32 kDa glycoprotein expressed by mature monocytes and peripheral blood myeloid dendritic cells.
Clone number:
UP-H2
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD300e / IREM-2 (immune receptor expressed by myeloid cells 2), also known as CLM2 or LMIR6, is a monomeric transmembrane glycoprotein with a single extracellular immunoglobulin-like domain. Intracellularly it associates with DAP-12, an ITAM-containing adaptor molecule. CD300e is expressed on mature monocytes and peripheral blood myeloid dendritic cells. Its crosslinking leads to release of pro-inflammatory cytokines, and increased expression of activation markers.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
CD300e-HA-transfected cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody UP-H2 recognizes an extracellular epitope on CD300e / IREM-2, a 32 kDa glycoprotein expressed by mature monocytes and peripheral blood myeloid dendritic cells.
Clone number:
UP-H2
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD300a (CMRF-35H, IRp60) is a non-MHC-specific inhibitory receptor of immunoglobulin superfamily, which contains three immunoreceptor tyrosine-based inhibitory motifs (ITIMs) that associate with SH2-containing phosphatases SHP-1 and SHP-2. CD300a is expressed on many cell types including T cells, NK cells, neutrophils, eosinophils or mast cells. Its triggering inhibits activating signals such as those of IL5, GM-CSF or eotaxin, as well as supresses mast cell degranulation or NK cell cytotoxic activity.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
HPB human acute lymphoid leukemia cell line
Applications:
FC
Additional Info:
The antibody MEM-260 reacts with an extracellular epitope of CD300a, a 60 kDa leukocyte transmembrane glycoprotein expressed on human granulocytes, monocytes, neutrophils, NK cells, mast cells and dendritic cells, 25% of circulating T cells and 15% of circulating B cells.
Clone number:
MEM-260
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD300a (CMRF-35H, IRp60) is a non-MHC-specific inhibitory receptor of immunoglobulin superfamily, which contains three immunoreceptor tyrosine-based inhibitory motifs (ITIMs) that associate with SH2-containing phosphatases SHP-1 and SHP-2. CD300a is expressed on many cell types including T cells, NK cells, neutrophils, eosinophils or mast cells. Its triggering inhibits activating signals such as those of IL5, GM-CSF or eotaxin, as well as supresses mast cell degranulation or NK cell cytotoxic activity.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
HPB human acute lymphoid leukemia cell line
Applications:
FC
Additional Info:
The antibody MEM-260 reacts with an extracellular epitope of CD300a, a 60 kDa leukocyte transmembrane glycoprotein expressed on human granulocytes, monocytes, neutrophils, NK cells, mast cells and dendritic cells, 25% of circulating T cells and 15% of circulating B cells.
Clone number:
MEM-260
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD30 is a type I transmembrane glycoprotein of the TNF receptor superfamily. CD30 was originally identified as a cell surface antigen of Hodgkins and Reed-Sternberg cells using monoclonal antibody Ki-1. The ligand for CD30 is CD30L (CD153). The binding of CD30 to CD30L mediates pleiotropic effects including cell proliferation, activation, differentiation, and apoptotic cell death. CD30 has a critical role in the pathophysiology of Hodgkin's disease and other CD30+ lymphomas. CD30 acts as a costimulatory molecule in thymic negative selection. In addition to its expression on Hodgkin's and Reed-Sternberg cells, CD30 is also found in some non-Hodgkin's lymphomas (including Burkitt's lymphomas), virus-infected T and B cells, and on normal T and B cells after activation. In T cells, CD30 expression is present on a subset of T cells that produce Th2-type cytokines and on CD4+/CD8+ thymocytes that co-express CD45RO and the IL4 receptor. Soluble form of CD30 (sCD30) serves as a marker reflecting Th2 immune response.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Applications:
FC
Additional Info:
The mouse monoclonal antibody Ber-H8 recognizes extracellular part of CD30 (Ki-1 antigen), a 105 kDa single chain glycoprotein expressed on Hodgkin's and Reed-Sternberg cells; it is also found in Burkitt's lymphomas, virus-infected T and B lymphocytes, and on normal B and T lymphocytes after activation (T lymphocytes that produce Th2-type cytokines and on CD4+/CD8+ T lymphocytes that co-express CD45RO and the IL4 receptor).
Clone number:
Ber-H8
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD30 is a type I transmembrane glycoprotein of the TNF receptor superfamily. CD30 was originally identified as a cell surface antigen of Hodgkins and Reed-Sternberg cells using monoclonal antibody Ki-1. The ligand for CD30 is CD30L (CD153). The binding of CD30 to CD30L mediates pleiotropic effects including cell proliferation, activation, differentiation, and apoptotic cell death. CD30 has a critical role in the pathophysiology of Hodgkin's disease and other CD30+ lymphomas. CD30 acts as a costimulatory molecule in thymic negative selection. In addition to its expression on Hodgkin's and Reed-Sternberg cells, CD30 is also found in some non-Hodgkin's lymphomas (including Burkitt's lymphomas), virus-infected T and B cells, and on normal T and B cells after activation. In T cells, CD30 expression is present on a subset of T cells that produce Th2-type cytokines and on CD4+/CD8+ thymocytes that co-express CD45RO and the IL4 receptor. Soluble form of CD30 (sCD30) serves as a marker reflecting Th2 immune response.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
The antibody MEM-268 recognizes extracellular part of CD30 (Ki-1 antigen), a 105 kDa single chain glycoprotein expressed on Hodgkin's and Reed-Sternberg cells; it is also found in Burkitt's lymphomas, virus-infected T and B lymphocytes, and on normal B and T lymphocytes after activation (T lymphocytes that produce Th2-type cytokines and on CD4+/CD8+ T lymphocytes that co-express CD45RO and the IL4 receptor).
Clone number:
MEM-268
Antibody Isotype:
IgG
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD30 is a type I transmembrane glycoprotein of the TNF receptor superfamily. CD30 was originally identified as a cell surface antigen of Hodgkins and Reed-Sternberg cells using monoclonal antibody Ki-1. The ligand for CD30 is CD30L (CD153). The binding of CD30 to CD30L mediates pleiotropic effects including cell proliferation, activation, differentiation, and apoptotic cell death. CD30 has a critical role in the pathophysiology of Hodgkin's disease and other CD30+ lymphomas. CD30 acts as a costimulatory molecule in thymic negative selection. In addition to its expression on Hodgkin's and Reed-Sternberg cells, CD30 is also found in some non-Hodgkin's lymphomas (including Burkitt's lymphomas), virus-infected T and B cells, and on normal T and B cells after activation. In T cells, CD30 expression is present on a subset of T cells that produce Th2-type cytokines and on CD4+/CD8+ thymocytes that co-express CD45RO and the IL4 receptor. Soluble form of CD30 (sCD30) serves as a marker reflecting Th2 immune response.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
The antibody MEM-268 recognizes extracellular part of CD30 (Ki-1 antigen), a 105 kDa single chain glycoprotein expressed on Hodgkin's and Reed-Sternberg cells; it is also found in Burkitt's lymphomas, virus-infected T and B lymphocytes, and on normal B and T lymphocytes after activation (T lymphocytes that produce Th2-type cytokines and on CD4+/CD8+ T lymphocytes that co-express CD45RO and the IL4 receptor).
Clone number:
MEM-268
Antibody Isotype:
IgG
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD3 complex is crucial in transducing antigen-recognition signals into the cytoplasm of T cells and in regulating the cell surface expression of the TCR complex. T cell activation through the antigen receptor (TCR) involves the cytoplasmic tails of the CD3 subunits CD3 gamma, CD3 delta, CD3 epsilon and CD3 zeta. These CD3 subunits are structurally related members of the immunoglobulins super family encoded by closely linked genes on human chromosome 11. The CD3 components have long cytoplasmic tails that associate with cytoplasmic signal transduction molecules. This association is mediated at least in part by a double tyrosine-based motif present in a single copy in the CD3 subunits. CD3 may play a role in TCR-induced growth arrest, cell survival and proliferation. The CD3 antigen is present on 68-82% of normal peripheral blood lymphocytes, 65-85% of thymocytes and Purkynje cells in the cerebellum. It is never expressed on B or NK cells. Decreased percentages of T lymphocytes may be observed in some autoimmune diseases.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human thymocytes and T lymphocytes.
Applications:
FC
Additional Info:
The antibody MEM-57 reacts with an extracellular epitope on gamma-epsilon and delta-epsilon dimers of human CD3 complex, a part of a bigger multisubunit T cell receptor complex (CD3/TCR) expressed on peripheral blood T lymphocytes and mature thymocytes.
Clone number:
MEM-57
Antibody Isotype:
IgG2a k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD3 complex is crucial in transducing antigen-recognition signals into the cytoplasm of T cells and in regulating the cell surface expression of the TCR complex. T cell activation through the antigen receptor (TCR) involves the cytoplasmic tails of the CD3 subunits CD3 gamma, CD3 delta, CD3 epsilon and CD3 zeta. These CD3 subunits are structurally related members of the immunoglobulins super family encoded by closely linked genes on human chromosome 11. The CD3 components have long cytoplasmic tails that associate with cytoplasmic signal transduction molecules. This association is mediated at least in part by a double tyrosine-based motif present in a single copy in the CD3 subunits. CD3 may play a role in TCR-induced growth arrest, cell survival and proliferation. The CD3 antigen is present on 68-82% of normal peripheral blood lymphocytes, 65-85% of thymocytes and Purkynje cells in the cerebellum. It is never expressed on B or NK cells. Decreased percentages of T lymphocytes may be observed in some autoimmune diseases.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human thymocytes followed by Sezary T cells
Applications:
FC
Additional Info:
The antibody UCHT1 recognizes an extracellular epitope on CD3 antigen of the TCR/CD3 complex on mature human T cells. The UCHT1 antibody reacts with the epsilon chain of the CD3 complex.
Clone number:
UCHT1
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests. Extracellular and intracellular staining.
CD3 complex is crucial in transducing antigen-recognition signals into the cytoplasm of T cells and in regulating the cell surface expression of the TCR complex. T cell activation through the antigen receptor (TCR) involves the cytoplasmic tails of the CD3 subunits CD3 gamma, CD3 delta, CD3 epsilon and CD3 zeta. These CD3 subunits are structurally related members of the immunoglobulins super family encoded by closely linked genes on human chromosome 11. The CD3 components have long cytoplasmic tails that associate with cytoplasmic signal transduction molecules. This association is mediated at least in part by a double tyrosine-based motif present in a single copy in the CD3 subunits. CD3 may play a role in TCR-induced growth arrest, cell survival and proliferation. The CD3 antigen is present on 68-82% of normal peripheral blood lymphocytes, 65-85% of thymocytes and Purkynje cells in the cerebellum. It is never expressed on B or NK cells. Decreased percentages of T lymphocytes may be observed in some autoimmune diseases.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human thymocytes and T lymphocytes.
Applications:
FC
Additional Info:
The antibody MEM-57 reacts with an extracellular epitope on gamma-epsilon and delta-epsilon dimers of human CD3 complex, a part of a bigger multisubunit T cell receptor complex (CD3/TCR) expressed on peripheral blood T lymphocytes and mature thymocytes.
Clone number:
MEM-57
Antibody Isotype:
IgG2a k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD3 complex is crucial in transducing antigen-recognition signals into the cytoplasm of T cells and in regulating the cell surface expression of the TCR complex. T cell activation through the antigen receptor (TCR) involves the cytoplasmic tails of the CD3 subunits CD3 gamma, CD3 delta, CD3 epsilon and CD3 zeta. These CD3 subunits are structurally related members of the immunoglobulins super family encoded by closely linked genes on human chromosome 11. The CD3 components have long cytoplasmic tails that associate with cytoplasmic signal transduction molecules. This association is mediated at least in part by a double tyrosine-based motif present in a single copy in the CD3 subunits. CD3 may play a role in TCR-induced growth arrest, cell survival and proliferation. The CD3 antigen is present on 68-82% of normal peripheral blood lymphocytes, 65-85% of thymocytes and Purkynje cells in the cerebellum. It is never expressed on B or NK cells. Decreased percentages of T lymphocytes may be observed in some autoimmune diseases.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Applications:
FC
Additional Info:
The mouse monoclonal antibody TB3 recognizes an extracellular epitope on CD3 antigen of the TCR/CD3 complex on mature human T cells. This antibody has superior binding than the clone TB2.
Clone number:
TB3
Antibody Isotype:
IgG2b
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD3 complex is crucial in transducing antigen-recognition signals into the cytoplasm of T cells and in regulating the cell surface expression of the TCR complex. T cell activation through the antigen receptor (TCR) involves the cytoplasmic tails of the CD3 subunits CD3 gamma, CD3 delta, CD3 epsilon and CD3 zeta. These CD3 subunits are structurally related members of the immunoglobulins super family encoded by closely linked genes on human chromosome 11. The CD3 components have long cytoplasmic tails that associate with cytoplasmic signal transduction molecules. This association is mediated at least in part by a double tyrosine-based motif present in a single copy in the CD3 subunits. CD3 may play a role in TCR-induced growth arrest, cell survival and proliferation. The CD3 antigen is present on 68-82% of normal peripheral blood lymphocytes, 65-85% of thymocytes and Purkynje cells in the cerebellum. It is never expressed on B or NK cells. Decreased percentages of T lymphocytes may be observed in some autoimmune diseases.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human thymocytes followed by Sezary T cells
Applications:
FC
Additional Info:
The antibody UCHT1 recognizes an extracellular epitope on CD3 antigen of the TCR/CD3 complex on mature human T cells. The UCHT1 antibody reacts with the epsilon chain of the CD3 complex.
Clone number:
UCHT1
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests. Extracellular and intracellular staining.
CD3 complex is crucial in transducing antigen-recognition signals into the cytoplasm of T cells and in regulating the cell surface expression of the TCR complex. T cell activation through the antigen receptor (TCR) involves the cytoplasmic tails of the CD3 subunits CD3 gamma, CD3 delta, CD3 epsilon and CD3 zeta. These CD3 subunits are structurally related members of the immunoglobulins super family encoded by closely linked genes on human chromosome 11. The CD3 components have long cytoplasmic tails that associate with cytoplasmic signal transduction molecules. This association is mediated at least in part by a double tyrosine-based motif present in a single copy in the CD3 subunits. CD3 may play a role in TCR-induced growth arrest, cell survival and proliferation. The CD3 antigen is present on 68-82% of normal peripheral blood lymphocytes, 65-85% of thymocytes and Purkynje cells in the cerebellum. It is never expressed on B or NK cells. Decreased percentages of T lymphocytes may be observed in some autoimmune diseases.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human T cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody OKT3 recognizes an extracellular epitope on CD3 antigen of the TCR/CD3 complex on mature human T cells. This antibody, also known as Orthoclone OKT3 or Muromonab-CD3, has been extensively used as a drug for therapy of acute, glucocorticoid resistant rejection of allogenic renal, heart and liver transplants. It has also been investigated for use in treating T-cell acute lymphoblastic leukemia.
Clone number:
OKT3
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CLEC2 (C-type lectin-like receptor 2) functions as a platelet receptor for the lymphatic endothelial marker, PDPN, and mediates platelet activation. Besides platelets, it can be found on myeloid cells and NK cells. CLEC2 functions also as an attachment factor for HIV-1 and facilitates its capture by platelets. Platelet-aggregating snake venom protein rhodocytin also binds to CLEC2.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
A recombinant extracellular domain of human CLEC2 (amino acids 68-229)
Applications:
FC
Clone number:
AYP1
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD99 (E2, MIC2) is a transmembrane glycoprotein that is involved in regulation of T cell addhesive properties and programmed cell death distinct from typical apoptosis course. CD99 roles are specific to certain stages of T cell differentiation such as corticothymocytes. CD99R isoform expression is restricted in the haematopoietic system to T, NK and myeloid cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
HPB-ALL human peripheral blood leukemia T-cell line
Applications:
FC
Additional Info:
The antibody MEM-131 reacts with CD99R, an extracellular epitope restricted to a subset of CD99 molecule expressed on myeloid cells, NK cells and T lymphocytes.
Clone number:
MEM-131
Antibody Isotype:
IgM
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD99 is a ubiquitous transmembrane type I sialoglycoprotein of a unique and poorly characterized protein family. CD99 is heavily O-glycosylated and was described as a T cell costimulator and strong activator of integrin-mediated actin cytoskeleton assembly, promoting cell adhesion and homotypic aggregation, immediate arrest on an inflamed vascular endothelium, and cell migration through it. Ligation of CD99 under some conditions can lead to apoptosis. Originally CD99 was described as a human thymus leukemia antigen, an Ewing´s sarcoma-specific membrane marker, and an adhesion molecule involved in spontaneous rosette formation of T cells with erythrocytes.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human thymocytes
Applications:
FC
Additional Info:
The mouse monoclonal antibody 3B2/TA8 recognizes CD99, an approximately 32 kDa sialoglycoprotein expressed on the surface of many cell types, with particularly strong expression on Ewing´s sarcoma and peripheral primitive neuroectodermal tumors. Within the hematopoietic system, CD99 is expressed on virtually all cell types except granulocytes.
Clone number:
3B2/TA8
Antibody Isotype:
IgG2a k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD99 is a ubiquitous transmembrane type I sialoglycoprotein of a unique and poorly characterized protein family. CD99 is heavily O-glycosylated and was described as a T cell costimulator and strong activator of integrin-mediated actin cytoskeleton assembly, promoting cell adhesion and homotypic aggregation, immediate arrest on an inflamed vascular endothelium, and cell migration through it. Ligation of CD99 under some conditions can lead to apoptosis. Originally CD99 was described as a human thymus leukemia antigen, an Ewing´s sarcoma-specific membrane marker, and an adhesion molecule involved in spontaneous rosette formation of T cells with erythrocytes.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human thymocytes
Applications:
FC
Additional Info:
The mouse monoclonal antibody 3B2/TA8 recognizes CD99, an approximately 32 kDa sialoglycoprotein expressed on the surface of many cell types, with particularly strong expression on Ewing´s sarcoma and peripheral primitive neuroectodermal tumors. Within the hematopoietic system, CD99 is expressed on virtually all cell types except granulocytes.
Clone number:
3B2/TA8
Antibody Isotype:
IgG2a k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD98 (4F2) is a type II transmembrane glycoprotein which serves as the heavy chain of the heterodimeric amino acid transporters (HATs). CD98, linked to various light chains by disulfide bond, is responsible for cell surface expression and basolateral localization of this transporter complex in polarized epithelial cells and also interacts with beta1 integrins and increases their affinity for ligand. Besides its roles in amino acid transport, CD98 is thus involved in cell fusion and activation. It is implicated in regulation of cellular differentiation, growth and apoptosis.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
RAJI human Burkitt's lymphoma cell line
Applications:
FC
Additional Info:
The antibody MEM-108 reacts with an extracellular epitope of CD98, a 125 kDa disulfide-linked heterodimer (80 kDa glycosylated heavy chain + 45 kDa non-glykosylated light chain). CD98 is expressed on T lymphocytes (upon activation) and activated NK cells; it is also present at low levels on B lymphocytes, NK cells, monocytes and platelets.
Clone number:
MEM-108
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD95 (Fas, APO-1), a 46 kDa transmembrane glycoprotein, is a cell death receptor of the TNFR superfamily. Stimulation of CD95 results in aggregation of its intracellular death domains, formation of the death-inducing signaling complex (DISC) and activation of caspases. In type I cells caspase 3 is activated by high amounts of caspase 8 generated at the DISC, in type II cells low concentration of caspase 8 activates pathway leading to the release of cytochrome c from mitochondria and activation of caspase 3 by cytochom c. Besides its roles in induction of apoptosis, Fas also triggers pro-inflammatory cytokine responses.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
HUT-78 human T cell lymphoma cell line
Applications:
FC
Additional Info:
The antibody LT95 reacts with an extracellular epitope on CD95 (Fas/APO-1), a 46 kDa single chain type I glycoprotein of the tumour necrosis factor/nerve growth factor (TNF/NGF) receptor superfamily, expressed on a variety of normal and neoplastic cells. It seems that the antibody LT95 does not induce Fas mediated apoptosis, although it cross-blocks anti-Fas DX2 antibody that recognizes a functional epitope of Fas molecule.
Clone number:
LT95
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD95 (Fas, APO-1), a 46 kDa transmembrane glycoprotein, is a cell death receptor of the TNFR superfamily. Stimulation of CD95 results in aggregation of its intracellular death domains, formation of the death-inducing signaling complex (DISC) and activation of caspases. In type I cells caspase 3 is activated by high amounts of caspase 8 generated at the DISC, in type II cells low concentration of caspase 8 activates pathway leading to the release of cytochrome c from mitochondria and activation of caspase 3 by cytochom c. Besides its roles in induction of apoptosis, Fas also triggers pro-inflammatory cytokine responses.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
HUT-78 human T cell lymphoma cell line
Applications:
FC
Additional Info:
The antibody LT95 reacts with an extracellular epitope on CD95 (Fas/APO-1), a 46 kDa single chain type I glycoprotein of the tumour necrosis factor/nerve growth factor (TNF/NGF) receptor superfamily, expressed on a variety of normal and neoplastic cells. It seems that the antibody LT95 does not induce Fas mediated apoptosis, although it cross-blocks anti-Fas DX2 antibody that recognizes a functional epitope of Fas molecule.
Clone number:
LT95
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD94, also known as KLRD1 (killer cell lectin-like receptor D1), is a transmembrane glycoprotein of the C-type lectin family, which forms disulfide-linked heterodimers with NKG2A, B, C, E, H proteins, constituting functionally distinct receptors of NK cells and related cell types. CD94/NKG2A and CD94/NKG2B heterodimers serve as inhibitory, whereas CD94/NKG2C and CD94/NKG2E as activating receptors. The ligand for CD94/NKG2 complexes has been identified as HLA-E. Extent of CD94 expression on NK cell surface can be used to demonstrate their progress through the differentiation process.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Cultured human NK cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody HP-3D9 recognizes an extracellular epitope of CD94, a 70 kDa type II transmembrane glycoprotein expressed on NK cells, NK-T cells, and subsets of CD8+ T cells and gamma/delta T cells.
Clone number:
HP-3D9
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD94, also known as KLRD1 (killer cell lectin-like receptor D1), is a transmembrane glycoprotein of the C-type lectin family, which forms disulfide-linked heterodimers with NKG2A, B, C, E, H proteins, constituting functionally distinct receptors of NK cells and related cell types. CD94/NKG2A and CD94/NKG2B heterodimers serve as inhibitory, whereas CD94/NKG2C and CD94/NKG2E as activating receptors. The ligand for CD94/NKG2 complexes has been identified as HLA-E. Extent of CD94 expression on NK cell surface can be used to demonstrate their progress through the differentiation process.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Cultured human NK cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody HP-3D9 recognizes an extracellular epitope of CD94, a 70 kDa type II transmembrane glycoprotein expressed on NK cells, NK-T cells, and subsets of CD8+ T cells and gamma/delta T cells.
Clone number:
HP-3D9
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD93 (also known as C1qR1) is a type I transmembrane glycoprotein containing extracellular N-terminal C-type lectin domain and five EGF-like domains, and an intracellular tail interacting with moesin, a protein known to play a role in linking transmembrane proteins to the cytoskeleton and in the remodelling of the cytoskeleton. CD93 was reported to serve as a receptor for complement component C1q, but this function has not been fully elucidated yet. CD93 is involved in intercellular adhesion and in the clearance of apoptotic cells.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
KG1 cell line
Applications:
FC
Additional Info:
The mouse monoclonal antibody VIMD2 recognizes an extracellular epitope on CD93, an approximately 110-120 kDa glycoprotein expressed mainly on myeloid cells and endothelial cells.
Clone number:
VIMD2
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD93 (also known as C1qR1) is a type I transmembrane glycoprotein containing extracellular N-terminal C-type lectin domain and five EGF-like domains, and an intracellular tail interacting with moesin, a protein known to play a role in linking transmembrane proteins to the cytoskeleton and in the remodelling of the cytoskeleton. CD93 was reported to serve as a receptor for complement component C1q, but this function has not been fully elucidated yet. CD93 is involved in intercellular adhesion and in the clearance of apoptotic cells.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
KG1 cell line
Applications:
FC
Additional Info:
The mouse monoclonal antibody VIMD2 recognizes an extracellular epitope on CD93, an approximately 110-120 kDa glycoprotein expressed mainly on myeloid cells and endothelial cells.
Clone number:
VIMD2
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD92 is a 70 kDa protein with ten transmembrane domains, intracellular N and C teminus, and two glycosylated larger extracellular loops. In the C-terminal domain, there is an ITIM-like sequence. This protein seems to be a choline transporter responsible for delivery of choline into the immune cells, to make it accessible for phospholipid synthesis, as well as a regulator of immune cell signaling. It is expressed mainly on human peripheral blood monocytes and neutrophils, and several myeloid and T-cell lines. It can also be found on mast cells (but not eosinophils), and weakly on peripheral blood lymphocytes, fibroblasts, epithelial cells, and endothelial cells.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
MV4-11 acute myeloid leukemia cells
Applications:
FC
Clone number:
VIM15
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD90 (Thy-1) is an 18-35 kDa GPI-anchored plasma membrane glycoprotein expressed in many cell types, such as in hematopoietic cells and neurons, connective tissues, various fibroblast and stromal cell lines, tumor endothelial cell lines and other. It is involved in T cell activation, cellular adhesion, proliferation and migration, neurite outgrowth, wound healing, apoptosis, and fibrosis. CD90 participates in multiple signaling cascades and its effects are tissue- and cell type-specific. It often functions as an important regulator of cell-cell and cell-matrix interactions.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
HEL erythroleukemia cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 5E10 recognizes CD90/Thy-1, a GPI-anchored cell surface glycoprotein expressed predominantly on thymocytes, hematopoietic stem cells and neurons.
Clone number:
50000000000
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD90 (Thy-1) is an 18-35 kDa GPI-anchored plasma membrane glycoprotein expressed in many cell types, such as in hematopoietic cells and neurons, connective tissues, various fibroblast and stromal cell lines, tumor endothelial cell lines and other. It is involved in T cell activation, cellular adhesion, proliferation and migration, neurite outgrowth, wound healing, apoptosis, and fibrosis. CD90 participates in multiple signaling cascades and its effects are tissue- and cell type-specific. It often functions as an important regulator of cell-cell and cell-matrix interactions.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
HEL erythroleukemia cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 5E10 recognizes CD90/Thy-1, a GPI-anchored cell surface glycoprotein expressed predominantly on thymocytes, hematopoietic stem cells and neurons.
Clone number:
50000000000
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD9 belongs to proteins of tetraspanin family that orchestrate cholesterol-associated tetraspanin-enriched signaling microdomains within the plasma membrane, forming complexes with each other as well as with integrins, membrane-anchored growth factors and other proteins. CD9 is involved in cell motility, osteoclastogenesis, neurite outgrowth, myotube formation, and sperm-egg fusion, plays roles in cell attachment and proliferation and is necessary for association of heterologous MHC II molecules on the dendritic cell plasma membrane which is important for effective T cell stimulation. CD9 is also considered as metastasis suppressor in solid tumors.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Pre-B cell line NALM-6.
Applications:
FC
Additional Info:
The antibody MEM-61 recognizes an epitope on second extracellular domain (EC2) of CD9 antigen, a 24 kDa transmembrane protein expressed on platelets, monocytes, pre-B lymphocytes, granulocytes and activated T lymphocytes.
Clone number:
MEM-61
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD9 belongs to proteins of tetraspanin family that orchestrate cholesterol-associated tetraspanin-enriched signaling microdomains within the plasma membrane, forming complexes with each other as well as with integrins, membrane-anchored growth factors and other proteins. CD9 is involved in cell motility, osteoclastogenesis, neurite outgrowth, myotube formation, and sperm-egg fusion, plays roles in cell attachment and proliferation and is necessary for association of heterologous MHC II molecules on the dendritic cell plasma membrane which is important for effective T cell stimulation. CD9 is also considered as metastasis suppressor in solid tumors.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Pre-B cell line NALM-6.
Applications:
FC
Additional Info:
The antibody MEM-61 recognizes an epitope on second extracellular domain (EC2) of CD9 antigen, a 24 kDa transmembrane protein expressed on platelets, monocytes, pre-B lymphocytes, granulocytes and activated T lymphocytes.
Clone number:
MEM-61
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD89 (Fc-alpha-R) is a type I transmembrane glycoprotein serving as a receptor for IgA. Soluble CD89 is detectable in serum and retains its IgA binding capacity. For signal transduction the association with FcR gamma chain homodimers is needed. CD89 is expressed on granulocytes, monocytes, macrophages, dendritic cells and myeloid cell lines. Its expression is upregulated in presence of IgA immune complexes, stimulators (such as LPS, PMA), TNF alpha, IL1 beta or GM-CSF, and it is downregulated in presence of TGF beta and suramin. Binding of IgA-opsonized targets to CD89 leads to phagocytic and cytotoxic processes of the immunologic defense.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Ag8.653 myeloma cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody A59 recognizes an extracellular epitope of CD89, a 55-100 kDa glycoprotein serving as a receptor for IgA and expressed mainly on granulocytes, monocytes and macrophages.
Clone number:
A59
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD88 / C5aR is a G protein-coupled seven membrane-spanning protein serving as a receptor for C5a component of the complement cascade, and is expressed mainly by monocytes, macrophages, neutrophils, eosinophils, and mast cells, but also e.g. by hepatocytes, glial cells, vascular endothelial cells, or cardiomyocytes. The binding of C5a to CD88 is associated with inflammatory response, including superoxide anion production, chemotaxis, and increased production of acute phase proteins. Expression of CD88 on synovial mast cells and their C5a-mediated degranulation plays a role in pathogenesis of rheumatoid arthritis.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Recombinant N-terminal peptide (Asp15-Asp27) of human C5aR
Applications:
FC
Additional Info:
The mouse monoclonal antibody S5/1 recognizes an extracellular epitope of CD88 protein, a 43 kDa receptor of C5a component of the complement cascade.
Clone number:
S5/1
Antibody Isotype:
IgG2a k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD87, the urokinase plasminogen activator receptor (UPAR), is a GPI-anchored single chain glycoprotein of a 50-68 kDa, which is expressed on granulocytes, monocytes/macrophages, dendritic cells, endothelial cells, fibroblasts and keratinocytes. The urokinase plasminogen activator bound to CD87 converts plasminogen to plasmin, and being concentrated on the leading edge of migrating cells, it plays important role in cell adhesion and chemotaxis. CD87 binds to β1, β2, and β3 integrins, and can contribute to cancer cell invasion and metastasis. This antigen can also be used to study normal and abnormal granulopoiesis.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human myeloid cell line THP-1
Applications:
FC
Additional Info:
The mouse monoclonal antibody VIM5 recognizes CD87 (urokinase plasminogen activator receptor), a 36-68 kDa single-chain GPI-anchored extracellular glycoprotein expressed on granulocytes, monocytes/macrophages, dendritic cells, endothelial cells, fibroblasts and keratinocytes.
Clone number:
VIM5
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD80 (B7-1) and CD86 (B7-2) are ligands of T cell critical costimulatory molecule CD28 and of an inhibitory receptor CTLA-4 (CD152). The both B7 molecules are expressed on professional antigen-presenting cells and are essential for T cell activation, the both molecules can also substitute for each other in this process. The question what are the differences in CD80 and CD86 competency has not been fully elucidated yet; there are still conflicts in results about their respective roles in initiation or sustaining of the T cell immune response.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
B-lymphoblastoid cell line ARH 77
Applications:
FC
Additional Info:
The mouse monoclonal antibody BU63 reacts with an extracellular epitope of CD86 (B7-2), a 70 kDa type I transmembrane glycoprotein of immunoglobulin supergene family, expressed on professional antigen-presenting cells, such as dendritic cells, macrophages or activated B lymphocytes.
Clone number:
BU63
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD80 (B7-1) and CD86 (B7-2) are ligands of T cell critical costimulatory molecule CD28 and of an inhibitory receptor CTLA-4 (CD152). The both B7 molecules are expressed on professional antigen-presenting cells and are essential for T cell activation, the both molecules can also substitute for each other in this process. The question what are the differences in CD80 and CD86 competency has not been fully elucidated yet; there are still conflicts in results about their respective roles in initiation or sustaining of the T cell immune response.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
B-lymphoblastoid cell line ARH 77
Applications:
FC
Additional Info:
The mouse monoclonal antibody BU63 reacts with an extracellular epitope of CD86 (B7-2), a 70 kDa type I transmembrane glycoprotein of immunoglobulin supergene family, expressed on professional antigen-presenting cells, such as dendritic cells, macrophages or activated B lymphocytes.
Clone number:
BU63
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD80 (B7-1) and CD86 (B7-2) are ligands of T cell critical costimulatory molecule CD28 and of an inhibitory receptor CTLA-4 (CD152). The both B7 molecules are expressed on professional antigen-presenting cells and are essential for T cell activation, the both molecules can also substitute for each other in this process. The question what are the differences in CD80 and CD86 competency has not been fully elucidated yet; there are still conflicts in results about their respective roles in initiation or sustaining of the T cell immune response.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
B-lymphoblastoid cell line ARH 77
Applications:
FC
Additional Info:
The mouse monoclonal antibody BU63 reacts with an extracellular epitope of CD86 (B7-2), a 70 kDa type I transmembrane glycoprotein of immunoglobulin supergene family, expressed on professional antigen-presenting cells, such as dendritic cells, macrophages or activated B lymphocytes.
Clone number:
BU63
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD85j, also known as ILT-2 (Ig-like transcript 2), LIR-1 (leukocyte Ig-like receptor 1), or LILRB1 (leukocyte Ig-like receptor B1), is a member of Ig superfamily transmembrane glycoproteins named CD85. The CD85j protein is expressed on several types of immune cells (plasma cells, B cells, monocytes, T and NK cell subsets) where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Hairy cell leukaemia cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody GHI/75 recognizes an extracellular epitope of CD85j / ILT2, an 110-120 kDa membrane glycoprotein expressed strongly on plasma cells, moderately on circulating B cells, and weakly on monocytes. It is also expressed on T cell and NK cell subsets (variable, individual).
Clone number:
GHI/75
Antibody Isotype:
IgG2b k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD85g / ILT7 (immunoglobulin-like transcript 7) is a cell surface protein that is expressed on plasmacytoid dendritic cells (PDCs) and modulates the function of these cells in the immune response, such as the TLR-induced interferon production. It associates with gamma subunit of the high-affinity IgE receptor to form a receptor complex which transduces the signal through ITAM-associated downstream molecules. Expression of CD85g is downregulated by interleukin 3.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Applications:
FC
Additional Info:
The mouse monoclonal antibody 17G10.2 recognizes an extracellular epitope of CD85g / ILT7, a member of leukocyte immunoglobulin-like receptor family expressed on plasmacytoid dendritic cells, but not on myeloid dendritic cells and other peripheral blood leukocytes.
Clone number:
17G10.2
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD84 is a highly glycosylated homophilic receptor of SLAM family. It is expressed on platelets and various types of leukocytes, especially following their activation. Ligation of CD84 leads to its phosphorylation on tyrosine residues within the cytoplasmic tail. These docking sites are recognized by downstream signaling molecules, such as phosphatase SHP-2 and adaptor protein SAP/SH2D1A. The function of CD84 has not been fully elucidated yet. Although predominantly activating receptor, its modulating activity was also demonstrated.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
CD84-transfected 300.19 cell line
Applications:
FC
Additional Info:
The mouse monoclonal antibody CD84.1.21 recognizes an extracellular epitope of CD84, a single chain cell surface glycoprotein of 64-82 kDa, predominantly expressed B cells, monocytes, platelets and some T cells.
Clone number:
CD84.1.21
Antibody Isotype:
IgG2a k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD84 is a highly glycosylated homophilic receptor of SLAM family. It is expressed on platelets and various types of leukocytes, especially following their activation. Ligation of CD84 leads to its phosphorylation on tyrosine residues within the cytoplasmic tail. These docking sites are recognized by downstream signaling molecules, such as phosphatase SHP-2 and adaptor protein SAP/SH2D1A. The function of CD84 has not been fully elucidated yet. Although predominantly activating receptor, its modulating activity was also demonstrated.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
CD84-transfected 300.19 cell line
Applications:
FC
Additional Info:
The mouse monoclonal antibody CD84.1.21 recognizes an extracellular epitope of CD84, a single chain cell surface glycoprotein of 64-82 kDa, predominantly expressed B cells, monocytes, platelets and some T cells.
Clone number:
CD84.1.21
Antibody Isotype:
IgG2a k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD83 is a 40-45 kDa heavily glycosylated type I cell surface glycoprotein of immunoglobulin family. It is expressed on the surface of mature dendritic cells, Langerhans cells in the skin, and interdigitating reticulum cells in the lymphoid tissues. Low expression of CD83 has been reported in activated T and B cells. Cytoplasmic expression of CD83 can be detected also in monocytes and macrophages. CD83 is involved in modulation of antigen presentation. Soluble CD83 has immunoregulatory functions, it is able to down-regulate dendritic cell maturation and stimulation of T cells. In the developing immune system, release of soluble CD83 from dendritic cells upon stimulation by gram-positive or gram-negative bacteria has anti-allergic effect. Herpes simplex virus, on the other hand, causes CD83 degradation in mature dendritic cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human CD83-transfected Cos cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody HB15e recognizes an extracellular epitope of CD83, a 40-45 kDa type I glycoprotein expressed on mature dendritic cells.
Clone number:
HB15e
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD83 is a 40-45 kDa heavily glycosylated type I cell surface glycoprotein of immunoglobulin family. It is expressed on the surface of mature dendritic cells, Langerhans cells in the skin, and interdigitating reticulum cells in the lymphoid tissues. Low expression of CD83 has been reported in activated T and B cells. Cytoplasmic expression of CD83 can be detected also in monocytes and macrophages. CD83 is involved in modulation of antigen presentation. Soluble CD83 has immunoregulatory functions, it is able to down-regulate dendritic cell maturation and stimulation of T cells. In the developing immune system, release of soluble CD83 from dendritic cells upon stimulation by gram-positive or gram-negative bacteria has anti-allergic effect. Herpes simplex virus, on the other hand, causes CD83 degradation in mature dendritic cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human CD83-transfected Cos cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody HB15e recognizes an extracellular epitope of CD83, a 40-45 kDa type I glycoprotein expressed on mature dendritic cells.
Clone number:
HB15e
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD3 complex is crucial in transducing antigen-recognition signals into the cytoplasm of T cells and in regulating the cell surface expression of the TCR complex. T cell activation through the antigen receptor (TCR) involves the cytoplasmic tails of the CD3 subunits CD3 gamma, CD3 delta, CD3 epsilon and CD3 zeta. These CD3 subunits are structurally related members of the immunoglobulins super family encoded by closely linked genes on human chromosome 11. The CD3 components have long cytoplasmic tails that associate with cytoplasmic signal transduction molecules. This association is mediated at least in part by a double tyrosine-based motif present in a single copy in the CD3 subunits. CD3 may play a role in TCR-induced growth arrest, cell survival and proliferation. The CD3 antigen is present on 68-82% of normal peripheral blood lymphocytes, 65-85% of thymocytes and Purkynje cells in the cerebellum. It is never expressed on B or NK cells. Decreased percentages of T lymphocytes may be observed in some autoimmune diseases.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human thymocytes followed by Sezary T cells
Applications:
FC
Additional Info:
The antibody UCHT1 recognizes an extracellular epitope on CD3 antigen of the TCR/CD3 complex on mature human T cells. The UCHT1 antibody reacts with the epsilon chain of the CD3 complex.
Clone number:
UCHT1
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests. Extracellular and intracellular staining.
CD3 complex is crucial in transducing antigen-recognition signals into the cytoplasm of T cells and in regulating the cell surface expression of the TCR complex. T cell activation through the antigen receptor (TCR) involves the cytoplasmic tails of the CD3 subunits CD3 gamma, CD3 delta, CD3 epsilon and CD3 zeta. These CD3 subunits are structurally related members of the immunoglobulins super family encoded by closely linked genes on human chromosome 11. The CD3 components have long cytoplasmic tails that associate with cytoplasmic signal transduction molecules. This association is mediated at least in part by a double tyrosine-based motif present in a single copy in the CD3 subunits. CD3 may play a role in TCR-induced growth arrest, cell survival and proliferation. The CD3 antigen is present on 68-82% of normal peripheral blood lymphocytes, 65-85% of thymocytes and Purkynje cells in the cerebellum. It is never expressed on B or NK cells. Decreased percentages of T lymphocytes may be observed in some autoimmune diseases.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human T cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody OKT3 recognizes an extracellular epitope on CD3 antigen of the TCR/CD3 complex on mature human T cells. This antibody, also known as Orthoclone OKT3 or Muromonab-CD3, has been extensively used as a drug for therapy of acute, glucocorticoid resistant rejection of allogenic renal, heart and liver transplants. It has also been investigated for use in treating T-cell acute lymphoblastic leukemia.
Clone number:
OKT3
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD3 complex is crucial in transducing antigen-recognition signals into the cytoplasm of T cells and in regulating the cell surface expression of the TCR complex. T cell activation through the antigen receptor (TCR) involves the cytoplasmic tails of the CD3 subunits CD3 gamma, CD3 delta, CD3 epsilon and CD3 zeta. These CD3 subunits are structurally related members of the immunoglobulins super family encoded by closely linked genes on human chromosome 11. The CD3 components have long cytoplasmic tails that associate with cytoplasmic signal transduction molecules. This association is mediated at least in part by a double tyrosine-based motif present in a single copy in the CD3 subunits. CD3 may play a role in TCR-induced growth arrest, cell survival and proliferation. The CD3 antigen is present on 68-82% of normal peripheral blood lymphocytes, 65-85% of thymocytes and Purkynje cells in the cerebellum. It is never expressed on B or NK cells. Decreased percentages of T lymphocytes may be observed in some autoimmune diseases.
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
CD3 complex is crucial in transducing antigen-recognition signals into the cytoplasm of T cells and in regulating the cell surface expression of the TCR complex. T cell activation through the antigen receptor (TCR) involves the cytoplasmic tails of the CD3 subunits CD3 gamma, CD3 delta, CD3 epsilon and CD3 zeta. These CD3 subunits are structurally related members of the immunoglobulins super family encoded by closely linked genes on human chromosome 11. The CD3 components have long cytoplasmic tails that associate with cytoplasmic signal transduction molecules. This association is mediated at least in part by a double tyrosine-based motif present in a single copy in the CD3 subunits. CD3 may play a role in TCR-induced growth arrest, cell survival and proliferation. The CD3 antigen is present on 68-82% of normal peripheral blood lymphocytes, 65-85% of thymocytes and Purkynje cells in the cerebellum. It is never expressed on B or NK cells. Decreased percentages of T lymphocytes may be observed in some autoimmune diseases.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human thymocytes and T lymphocytes.
Applications:
FC
Additional Info:
The antibody MEM-57 reacts with an extracellular epitope on gamma-epsilon and delta-epsilon dimers of human CD3 complex, a part of a bigger multisubunit T cell receptor complex (CD3/TCR) expressed on peripheral blood T lymphocytes and mature thymocytes.
Clone number:
MEM-57
Antibody Isotype:
IgG2a k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD29 (beta1 integrin subunit, GPIIa) forms non-covalently linked heterodimers with at least 6 different alpha chains (alpha1-alpha6, CD49a-f) determining the binding properties of beta1 (VLA) integrins. These integrins mediate cell adhesion to collagen, fibronectin, laminin and other extracellular matrix (ECM) components. This interaction hinders cell death, whereas disruption of anchorage to ECM leads to apoptosis. Decreased expression of most beta1 integrins correlates with acquiring multidrug resistance of tumour cells during selection in presence of antitumour drug. In platelets, translocation of intracellular pool of beta1 integrins to the plasma membrane following thrombin stimulation. These integrins are also up-regulated in leukocytes during emigration and extravascular migration and appear to be critically involved in regulating the immune cell trafficking from blood to tissue, as well as in regulating tissue damage and disease symptoms related to inflammatory bowel disease. Through a beta1 integrin-dependent mechanism, fibronectin and type I collagen enhance cytokine secretion of human airway smooth muscle in response to IL-1beta.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Raji Burkitt's lymphoma cell line
Applications:
FC
Additional Info:
The antibody MEM-101A reacts with an extracellular epitope of CD29 (integrin beta1 chain), a 130 kDa single chain type I glycoprotein expressed as a heterodimer (non-covalently associated with the integrin alpha subunits 1-6). CD29 is broadly expressed on majority of hematopoietic and non-hematopoietic cells (leukocytes, platelets, fibroblasts, endothelial cells, epithelial cells and mast cells).
Clone number:
MEM-101A
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD29 (beta1 integrin subunit, GPIIa) forms non-covalently linked heterodimers with at least 6 different alpha chains (alpha1-alpha6, CD49a-f) determining the binding properties of beta1 (VLA) integrins. These integrins mediate cell adhesion to collagen, fibronectin, laminin and other extracellular matrix (ECM) components. This interaction hinders cell death, whereas disruption of anchorage to ECM leads to apoptosis. Decreased expression of most beta1 integrins correlates with acquiring multidrug resistance of tumour cells during selection in presence of antitumour drug. In platelets, translocation of intracellular pool of beta1 integrins to the plasma membrane following thrombin stimulation. These integrins are also up-regulated in leukocytes during emigration and extravascular migration and appear to be critically involved in regulating the immune cell trafficking from blood to tissue, as well as in regulating tissue damage and disease symptoms related to inflammatory bowel disease. Through a beta1 integrin-dependent mechanism, fibronectin and type I collagen enhance cytokine secretion of human airway smooth muscle in response to IL-1beta.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Raji Burkitt's lymphoma cell line
Applications:
FC
Additional Info:
The antibody MEM-101A reacts with an extracellular epitope of CD29 (integrin beta1 chain), a 130 kDa single chain type I glycoprotein expressed as a heterodimer (non-covalently associated with the integrin alpha subunits 1-6). CD29 is broadly expressed on majority of hematopoietic and non-hematopoietic cells (leukocytes, platelets, fibroblasts, endothelial cells, epithelial cells and mast cells).
Clone number:
MEM-101A
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD28 is the critical T cell costimulatory receptor which provides to the cell the important second activation signal by binding CD80 and CD86 that are expressed by antigen presenting cells. Besides its costimulation role CD28 functions in preventing T cells from anergic hyporesponsive state or from undergoing premature apoptotic cell death. CD28 is also expressed on human fetal NK cells and some NK cell lines, whereas on murine NK cells the CD28 expression is much broader.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
DC28.1.3.3 murine T cell hybridoma transfected with human CD28 cDNA
Applications:
FC
Additional Info:
The mouse monoclonal antibody CD28.2 recognizes an extracellular epitope of CD28, a disulfide-linked homodimeric type I glycoprotein (monomer of Mw 44 kDa) which is a critical costimulatory receptor of T cells.
Clone number:
CD28.2
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD28 is the critical T cell costimulatory receptor which provides to the cell the important second activation signal by binding CD80 and CD86 that are expressed by antigen presenting cells. Besides its costimulation role CD28 functions in preventing T cells from anergic hyporesponsive state or from undergoing premature apoptotic cell death. CD28 is also expressed on human fetal NK cells and some NK cell lines, whereas on murine NK cells the CD28 expression is much broader.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
DC28.1.3.3 murine T cell hybridoma transfected with human CD28 cDNA
Applications:
FC
Additional Info:
The mouse monoclonal antibody CD28.2 recognizes an extracellular epitope of CD28, a disulfide-linked homodimeric type I glycoprotein (monomer of Mw 44 kDa) which is a critical costimulatory receptor of T cells.
Clone number:
CD28.2
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD28 is the critical T cell costimulatory receptor which provides to the cell the important second activation signal by binding CD80 and CD86 that are expressed by antigen presenting cells. Besides its costimulation role CD28 functions in preventing T cells from anergic hyporesponsive state or from undergoing premature apoptotic cell death. CD28 is also expressed on human fetal NK cells and some NK cell lines, whereas on murine NK cells the CD28 expression is much broader.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
DC28.1.3.3 murine T cell hybridoma transfected with human CD28 cDNA
Applications:
FC
Additional Info:
The mouse monoclonal antibody CD28.2 recognizes an extracellular epitope of CD28, a disulfide-linked homodimeric type I glycoprotein (monomer of Mw 44 kDa) which is a critical costimulatory receptor of T cells.
Clone number:
CD28.2
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD279 / PD-1 (programmed cell death 1), a transmembrane protein of CD28/CTLA-4 family. It is expressed inducibly mainly on activated T, B, and myeloid cells and plays a role in maintaining peripheral self-tolerance. Binding to its ligands CD273 and CD274 is associated with inhibition of T cell proliferation and induction of their anergy. It is also expressed during thymic development. Some variants of CD279 are associated with susceptibility to systemic lupus erythematosus, type 1 diabetes, and rheumatoid arthritis.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
recombinant human CD279
Applications:
FC
Additional Info:
The mouse monoclonal antibody EH12.2H7 recognizes an extracellular epitope of CD279 / PD-1 (programmed cell death 1), a 55 kDa type I transmembrane protein expressed above all during T cell development, on activated T cells, activated B cells, and activated monocytes.
Clone number:
EH12.2H7
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD279 / PD-1 (programmed cell death 1), a transmembrane protein of CD28/CTLA-4 family. It is expressed inducibly mainly on activated T, B, and myeloid cells and plays a role in maintaining peripheral self-tolerance. Binding to its ligands CD273 and CD274 is associated with inhibition of T cell proliferation and induction of their anergy. It is also expressed during thymic development. Some variants of CD279 are associated with susceptibility to systemic lupus erythematosus, type 1 diabetes, and rheumatoid arthritis.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
recombinant human CD279
Applications:
FC
Additional Info:
The mouse monoclonal antibody EH12.2H7 recognizes an extracellular epitope of CD279 / PD-1 (programmed cell death 1), a 55 kDa type I transmembrane protein expressed above all during T cell development, on activated T cells, activated B cells, and activated monocytes.
Clone number:
EH12.2H7
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD274 / PD-L1 (programmed death ligand-1), also known as B7-H1, is a member of the B7 family of regulatory proteins. It can act as both costimulatory and coinhibitory molecule for T cells. Interaction with its receptor CD279 (PD1) appears to be important in the maintenance of peripheral tolerance and in prevention of tumor rejection. Even pathogens (e.g. Schistosoma) may exploit CD274 to evade an immune response. Besides CD279, existence of other receptor(s) for CD274 is likely.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Full length human CD274
Applications:
FC
Additional Info:
The mouse monoclonal antibody 29E.2A3 recognizes an extracellular epitope of CD274 / PD-L1 (also known as B7-H1), a 40 kDa type I transmembrane protein expressed by dendritic cells, activated T cells, activated monocytes, and in various tissues, above all in heart and skeletal muscle, placenta and lung, and in many cancer cells, including T cell lymphomas, melanomas, and glioblastomas.
Clone number:
29E.2A3
Antibody Isotype:
IgG2b k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD274 / PD-L1 (programmed death ligand-1), also known as B7-H1, is a member of the B7 family of regulatory proteins. It can act as both costimulatory and coinhibitory molecule for T cells. Interaction with its receptor CD279 (PD1) appears to be important in the maintenance of peripheral tolerance and in prevention of tumor rejection. Even pathogens (e.g. Schistosoma) may exploit CD274 to evade an immune response. Besides CD279, existence of other receptor(s) for CD274 is likely.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Full length human CD274
Applications:
FC
Additional Info:
The mouse monoclonal antibody 29E.2A3 recognizes an extracellular epitope of CD274 / PD-L1 (also known as B7-H1), a 40 kDa type I transmembrane protein expressed by dendritic cells, activated T cells, activated monocytes, and in various tissues, above all in heart and skeletal muscle, placenta and lung, and in many cancer cells, including T cell lymphomas, melanomas, and glioblastomas.
Clone number:
29E.2A3
Antibody Isotype:
IgG2b k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD267 / TACI (transmembrane activator calcium modulator and cyclophilin ligand interactor), a TNFR superfamily transmembrane protein, is expressed on B cells (predominantly on CD27+ memory cells), multiple myeloma cells and B cell chronic lymphocytic leukemia (B-CLL). Its triggering leads to activation of the transcription factors NFAT, AP1, and NF-kappa-B. It plays a crucial role in humoral immunity. Mutations in CD267 are associated with common variable immunodeficiency and IgA deficiency.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
CD267-transfected RBL cells
Applications:
FC
Additional Info:
The rat monoclonal antibody 1A1 recognizes an extracellular epitope of CD267 / TACI, a 32 kDa type III transmembrane protein expressed by B cells and possibly by some activated T cells.
Clone number:
1A1
Antibody Isotype:
IgG2a k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD267 / TACI (transmembrane activator calcium modulator and cyclophilin ligand interactor), a TNFR superfamily transmembrane protein, is expressed on B cells (predominantly on CD27+ memory cells), multiple myeloma cells and B cell chronic lymphocytic leukemia (B-CLL). Its triggering leads to activation of the transcription factors NFAT, AP1, and NF-kappa-B. It plays a crucial role in humoral immunity. Mutations in CD267 are associated with common variable immunodeficiency and IgA deficiency.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
CD267-transfected RBL cells
Applications:
FC
Additional Info:
The rat monoclonal antibody 1A1 recognizes an extracellular epitope of CD267 / TACI, a 32 kDa type III transmembrane protein expressed by B cells and possibly by some activated T cells.
Clone number:
1A1
Antibody Isotype:
IgG2a k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD266 / TWEAK R (TNFRSF12A), also known as FN14 (fibroblast growth factor-inducible 14) is a receptor for CD255 / TWEAK, the TNF-like weak inducer of apoptosis. CD266 is expressed on endothelial cells, as well as on some cancer tissues, and plays a role in CD255-induced endothelial cell migration, proliferation, and angiogenesis. The CD255-CD266 interaction, or antibody-mediated triggering of CD266 is also able to induce apoptosis and necrosis in CD266-positive cells (including tumor cells), which might have therapeutic potential.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human CD266-transfected P815 cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody ITEM-4 recognizes an extracellular epitope of CD266 / TWEAK R, a TNFR superfamily receptor for CD255 / TWEAK, a TNF-like weak inducer of apoptosis.
TRAIL-R4 (CD264, TR4, DcR2, TRUNDD), expressed mainly on CD8+ and NK cells, belongs to receptors of TRAIL, a TNF-like membrane toxic protein that induces apoptosis in many tumour cells, but not in normal cells. TRAIL-R4, however, contains partially truncated death domain, thus it is unable to induce apoptosis and serves as a negative regulator of apoptotic signaling by impairment death-inducing signaling complex (DISC) processing. TRAIL-R4 interacts with death receptor 5 (DR5) in the native DISC in a TRAIL-dependent manner and prevents its corecruitment with death receptor 4 (DR4).
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
TRAIL-R4 (aa 1-210) - hIgGhc fusion protein
Applications:
FC
Additional Info:
The antibody TRAIL-R4-01 reacts with an extracellular epitope of TRAIL-R4, a 42 kDa transmembrane protein expressed on various blood cells.
TRAIL-R3 (CD263, TR3, DcR1, LIT, TRID), expressed mainly on neutrophils, belongs to receptors of TRAIL, a TNF-like membrane cytotoxic protein that induces apoptosis in many tumour cells, but not in normal cells. TRAIL-R3, however, is a GPI-anchored protein that lacks cytoplasmic death domain, thus it is unable to induce apoptosis and serves as a negative regulator of apoptotic signaling by competing for binding of TRAIL with death receptor 5 (DR5).
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
TRAIL-R3-hIgGhc fusion protein
Applications:
FC
Additional Info:
The antibody TRAIL-R3-02 reacts with TRAIL-R3, a 35 kDa GPI-anchored extracellular membrane protein expressed mainly on neutrophils.
TRAIL-R2 (CD262, DR5) is one of two TNF superfamily member intracellular death domain containing receptors for TRAIL (APO2L). Apoptosis, or programmed cell death, occurs during normal cellular differentiation and development of multicellular organisms. Apoptosis is induced by certain cytokines including tumor necrosis factor (TNF) and Fas ligand in the TNF family through their death domain containing receptors, TNF receptor 1 (TNFR1) and Fas, respectively. Another member in the TNF family has been identified and designated TRAIL (for TNF related apoptosis inducing ligand) and Apo2L (for Apo2 ligand). Receptors for TRAIL include two death domain containing receptors, DR4 and DR5, as well as two decoy receptors, DcR1 and DcR2, lacking the intracellular signaling death domain. DcR1 (also called TRID), like the related death receptors DR4 and DR5, contains two extracellular cysteine rich domains. However, DcR1 contains no intracellular death domain and is thus incapable of signaling apoptosis. It has been suggested DcR1 is responsible for TRAIL resistance in normal human tissues including heart, placenta, lung, liver, kidney, spleen, and bone marrow. DR5 is a member of the TNF receptor superfamily, and contains an intracellular death domain. This receptor can be activated by tumor necrosis factor related apoptosis inducing ligand (TNFSF10/TRAIL/APO2L), and transduces apoptosis signal. Studies with FADD deficient mice suggested that FADD, a death domain containing adaptor protein, is required for the apoptosis mediated by this protein.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Recombinant fusion protein of human IgG heavy chain and extracellular domain of DR5.
Applications:
FC
Additional Info:
The mouse monoclonal antibody DR5-01-1 recognizes an extracellular domain of TRAIL-R2 (DR5). TRAIL-R2 is one of two TNF superfamily members that contain death domain for TRAIL (APO2L).
Clone number:
DR5-01-1
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: Recommended dilution: 1-5 ?g/ml; positive control: JURKAT human peripheral blood leukemia T cell line.
CD26, also known as dipeptidyl peptidase IV (DPP-IV), is a homodimeric cell surface serine peptidase that degradates IFN-gamma-induced cytokines, acts as a T cell costimulatory molecule, and participates in multiple immunopathological roles in leukocyte homing and inflammation. Alterations in its peptidase activity are characteristic of malignant transformation. The enzymatic activity increases dramatically with tumour grade and severity. CD26 is expressed in various blood cell types, but also e.g. in cells that are histogenetically related to activated fibroblasts. Alterations in CD26 density have been reported on circulating monocytes and CD4+ T cells during rheumatoid arthritis and systemic lupus erythematosus.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
A human T cell clone
Applications:
FC
Additional Info:
The mouse monoclonal antibody BA5b recognizes an extracellular epitope of CD26, a 110 kDa type II transmembrane glycoprotein, which is a peptidase expressed on mature thymocytes, T cells (especially activated), B cells, NK cells and macrophages.
Clone number:
BA5b
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD26, also known as dipeptidyl peptidase IV (DPP-IV), is a homodimeric cell surface serine peptidase that degradates IFN-gamma-induced cytokines, acts as a T cell costimulatory molecule, and participates in multiple immunopathological roles in leukocyte homing and inflammation. Alterations in its peptidase activity are characteristic of malignant transformation. The enzymatic activity increases dramatically with tumour grade and severity. CD26 is expressed in various blood cell types, but also e.g. in cells that are histogenetically related to activated fibroblasts. Alterations in CD26 density have been reported on circulating monocytes and CD4+ T cells during rheumatoid arthritis and systemic lupus erythematosus.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
A human T cell clone
Applications:
FC
Additional Info:
The mouse monoclonal antibody BA5b recognizes an extracellular epitope of CD26, a 110 kDa type II transmembrane glycoprotein, which is a peptidase expressed on mature thymocytes, T cells (especially activated), B cells, NK cells and macrophages.
Clone number:
BA5b
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD255 / TWEAK (TNF-related weak inducer of apoptosis), a type II transmembrane protein expressed as membrane-bound and secreted form, can induce apoptosis in many tissues and cell lines through its receptor CD266 / TWEAK R. On the other hand, in endothelial cells this interaction can induce proliferation and promote angiogenesis including neovascularization of tumours. CD255 can act in a juxtacrine manner to initiate cellular responses, and induces secretion of pro-inflammatory cytokines. Besides CD266, CD255 may also bind to DR3.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human CD255-transfected 2PK-3 cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody CARL-1 recognizes an extracellular epitope of CD255 / TWEAK, a type II transmembrane protein of the TNF superfamily able to induce apoptosis weakly in many cell types.
Clone number:
CARL-1
Antibody Isotype:
IgG3 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
Human CD253 / TRAIL (TNF-related apoptosis inducing ligand), also called Apo2, is a type II membrane protein from the TNF family. TRAIL is a cytotoxic protein which activates rapid apoptosis in tumor cells, but not in normal cells. TRAIL-induced apotosis, is achieved through binding to two dealth-signaling receptors, DR4 (CD261 / TRAIL-R1) and DR5 (CD262 / TRAIL-R2).
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Recombinant soluble fragment (aa 95-281) of human TRAIL.
Applications:
FC
Additional Info:
The antibody 2E5 reacts with an extracellular epitope within C-terminal half of TRAIL (APO-2L), a 21 kDa cytotoxic protein, activator of rapid apoptosis in tumor cells. TRAIL is mainly expressed in spleen, lung, prostate and also in many other tissues.
Human CD253 / TRAIL (TNF-related apoptosis inducing ligand), also called Apo2, is a type II membrane protein from the TNF family. TRAIL is a cytotoxic protein which activates rapid apoptosis in tumor cells, but not in normal cells. TRAIL-induced apotosis, is achieved through binding to two dealth-signaling receptors, DR4 (CD261 / TRAIL-R1) and DR5 (CD262 / TRAIL-R2).
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Recombinant soluble fragment (aa 95-281) of human TRAIL.
Applications:
FC
Additional Info:
The antibody 2E5 reacts with an extracellular epitope within C-terminal half of TRAIL (APO-2L), a 21 kDa cytotoxic protein, activator of rapid apoptosis in tumor cells. TRAIL is mainly expressed in spleen, lung, prostate and also in many other tissues.
CD25 (IL2Ralpha, Tac) is a ligand-binding alpha subunit of interleukin 2 receptor (IL2R). Together with beta and gamma subunit CD25 constitues the high affinity IL2R, whereas CD25 alone serves as the low affinity IL2R. CD25 expression rapidly increases upon T cell activation. The 55 kDa CD25 molecule is enzymatically cleaved and shed from the cell surface as a soluble 45 kDa s-Tac, whose concentration in serum can be used as a marker of T cell activation. Expression of CD25 indicates the neoplastic phenotype of mast cells. Humanized anti CD25 antibodies represent a useful tool to reduce the incidence of allograft rejection as well as the severity of graft versus host reaction, and radioimmunoconjugates of anti-CD25 antibodies can be used against CD25 expressing lymphomas.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
PHA-activated peripheral blood leucocytes
Applications:
FC
Additional Info:
The antibody MEM-181 reacts with an extracellular epitope of CD25 (Interleukin-2 receptor alpha chain), a 55 kDa type I transmembrane glycoprotein expressed on activated B and T lymphocytes, activated monocytes/macrophages and on CD4+ T lymphocytes (T regulatory cells); it is lost on resting B and T lymphocytes.
Clone number:
MEM-181
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD25 (IL2Ralpha, Tac) is a ligand-binding alpha subunit of interleukin 2 receptor (IL2R). Together with beta and gamma subunit CD25 constitues the high affinity IL2R, whereas CD25 alone serves as the low affinity IL2R. CD25 expression rapidly increases upon T cell activation. The 55 kDa CD25 molecule is enzymatically cleaved and shed from the cell surface as a soluble 45 kDa s-Tac, whose concentration in serum can be used as a marker of T cell activation. Expression of CD25 indicates the neoplastic phenotype of mast cells. Humanized anti CD25 antibodies represent a useful tool to reduce the incidence of allograft rejection as well as the severity of graft versus host reaction, and radioimmunoconjugates of anti-CD25 antibodies can be used against CD25 expressing lymphomas.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
PHA-activated peripheral blood leucocytes
Applications:
FC
Additional Info:
The antibody MEM-181 reacts with an extracellular epitope of CD25 (Interleukin-2 receptor alpha chain), a 55 kDa type I transmembrane glycoprotein expressed on activated B and T lymphocytes, activated monocytes/macrophages and on CD4+ T lymphocytes (T regulatory cells); it is lost on resting B and T lymphocytes.
Clone number:
MEM-181
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD25 (IL2Ralpha, Tac) is a ligand-binding alpha subunit of interleukin 2 receptor (IL2R). Together with beta and gamma subunit CD25 constitues the high affinity IL2R, whereas CD25 alone serves as the low affinity IL2R. CD25 expression rapidly increases upon T cell activation. The 55 kDa CD25 molecule is enzymatically cleaved and shed from the cell surface as a soluble 45 kDa s-Tac, whose concentration in serum can be used as a marker of T cell activation. Expression of CD25 indicates the neoplastic phenotype of mast cells. Humanized anti CD25 antibodies represent a useful tool to reduce the incidence of allograft rejection as well as the severity of graft versus host reaction, and radioimmunoconjugates of anti-CD25 antibodies can be used against CD25 expressing lymphomas.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
PHA-activated peripheral blood leucocytes
Applications:
FC
Additional Info:
The antibody MEM-181 reacts with an extracellular epitope of CD25 (Interleukin-2 receptor alpha chain), a 55 kDa type I transmembrane glycoprotein expressed on activated B and T lymphocytes, activated monocytes/macrophages and on CD4+ T lymphocytes (T regulatory cells); it is lost on resting B and T lymphocytes.
Clone number:
MEM-181
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD243, also known as multidrug resistant protein 1 (MDR-1) or P-glycoprotein (Pgp) is an ATP binding cassette (ABC)-containing efflux transporter for xenobiotic lipophilic compounds with broad substrate specificity. It is responsible for decreased drug accumulation in multidrug-resistant cells and often mediates the development of resistance to anticancer drugs. This protein also functions as a transporter in the blood-brain barrier. It is expressed in many tissues, including the brain, liver, pancreas, testes, kidney, and blood (B, T, NK cells, but not monocytes).
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
NIH 3T3 cells transfected with human CD243 (MDR-1) cDNA
Applications:
FC
Additional Info:
The mouse monoclonal antibody UIC2 recognizes an extracellular epitope on CD243 (MDR-1), an approximately 170 kDa ABC transporter expressed on hematopoietic stem cells, B, T, and NK cells, or on many multidrug resistant cancer cells. This antibody preferentially recognizes CD243 in the process of transporting substrate.
Clone number:
UIC2
Antibody Isotype:
IgG2a k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD243, also known as multidrug resistant protein 1 (MDR-1) or P-glycoprotein (Pgp) is an ATP binding cassette (ABC)-containing efflux transporter for xenobiotic lipophilic compounds with broad substrate specificity. It is responsible for decreased drug accumulation in multidrug-resistant cells and often mediates the development of resistance to anticancer drugs. This protein also functions as a transporter in the blood-brain barrier. It is expressed in many tissues, including the brain, liver, pancreas, testes, kidney, and blood (B, T, NK cells, but not monocytes).
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
NIH 3T3 cells transfected with human CD243 (MDR-1) cDNA
Applications:
FC
Additional Info:
The mouse monoclonal antibody UIC2 recognizes an extracellular epitope on CD243 (MDR-1), an approximately 170 kDa ABC transporter expressed on hematopoietic stem cells, B, T, and NK cells, or on many multidrug resistant cancer cells. This antibody preferentially recognizes CD243 in the process of transporting substrate.
Clone number:
UIC2
Antibody Isotype:
IgG2a k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD24, also known as heat-stable antigen (HSA) or nectadorin, is a small mucin-like GPI-anchored extracellular membrane glycoprotein expressed on several cell types, including B cells. When B cells are activated and induced to further maturation, however, CD24 begins to disappear. CD24 seems to act as a gate-keeper for lipid rafts, thereby regulating the activity of integrins and other proteins such as the chemokine receptor CXCR4; it is also a ligand for P-selectin. CD24 triggering induces apoptosis of B cell precursors but not in mature resting B cells, where it instead inhibits their ability to proliferate in response to activation. CD24 expression is associated with invasiveness and poorer prognosis of carcinomas and is a marker of exosomes secreted into urine and amniotic fluid.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Glycoproteins purified from human NALM-1 cell line.
Applications:
FC
Additional Info:
The antibody SN3 reacts with CD24, a 35-45 kDa heavily glycosylated cell surface antigen. CD24 is expressed by granulocytes, B lymphocytes and by some activated T cells and T cell malignancies. It is not expressed on human thymocytes.
Clone number:
SN3
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD24, also known as heat-stable antigen (HSA) or nectadorin, is a small mucin-like GPI-anchored extracellular membrane glycoprotein expressed on several cell types, including B cells. When B cells are activated and induced to further maturation, however, CD24 begins to disappear. CD24 seems to act as a gate-keeper for lipid rafts, thereby regulating the activity of integrins and other proteins such as the chemokine receptor CXCR4; it is also a ligand for P-selectin. CD24 triggering induces apoptosis of B cell precursors but not in mature resting B cells, where it instead inhibits their ability to proliferate in response to activation. CD24 expression is associated with invasiveness and poorer prognosis of carcinomas and is a marker of exosomes secreted into urine and amniotic fluid.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Glycoproteins purified from human NALM-1 cell line.
Applications:
FC
Additional Info:
The antibody SN3 reacts with CD24, a 35-45 kDa heavily glycosylated cell surface antigen. CD24 is expressed by granulocytes, B lymphocytes and by some activated T cells and T cell malignancies. It is not expressed on human thymocytes.
Clone number:
SN3
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD235a (Glycophorin A, GPA) is a transmembrane sialoglycoprotein expressed on erythrocytes and their precursors. Similarly to glycophorin B (GPB), these molecules provide the cells with a large mucin-like surface, which minimalizes aggregation between erythrocytes in the circulation. GPA is the carrier of blood group M and N specificities, while GPB accounts for S, s and U specificities. CD235a is a receptor of Hsa, an Streptococcus adhesin.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Synthetic peptide (Human, N-terminal)
Applications:
FC
Additional Info:
The mouse monoclonal antibody HIR2 recognizes the N-terminal (extracellular) portion of glycophorin A (and weakly of glycophorin B). Its antigen is expressed on early erythroblasts, late erythroblasts, erythroblasts, mature erythrocytes and the cells of erythroid cell lines K562 and HEL, but not on all other cells.
Clone number:
HIR2
Antibody Isotype:
IgG2b
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD235a (Glycophorin A, GPA) is a transmembrane sialoglycoprotein expressed on erythrocytes and their precursors. Similarly to glycophorin B (GPB), these molecules provide the cells with a large mucin-like surface, which minimalizes aggregation between erythrocytes in the circulation. GPA is the carrier of blood group M and N specificities, while GPB accounts for S, s and U specificities. CD235a is a receptor of Hsa, an Streptococcus adhesin.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Membrane preparation from splenic hairy cell leukemia
Applications:
FC
Additional Info:
The mouse monoclonal antibody JC159 recognizes an epitope between amino acids 27 and 40 of the extracellular portion of CD235a (glycophorin A), a sialoglycoprotein expressed on early erythroblasts, late erythroblasts, erythroblasts, mature erythrocytes and the cells of erythroid cell lines K562 and HEL. The antibody does not react with glycophorin B.
Clone number:
JC159
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD235a (Glycophorin A, GPA) is a transmembrane sialoglycoprotein expressed on erythrocytes and their precursors. Similarly to glycophorin B (GPB), these molecules provide the cells with a large mucin-like surface, which minimalizes aggregation between erythrocytes in the circulation. GPA is the carrier of blood group M and N specificities, while GPB accounts for S, s and U specificities. CD235a is a receptor of Hsa, an Streptococcus adhesin.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Membrane preparation from splenic hairy cell leukemia
Applications:
FC
Additional Info:
The mouse monoclonal antibody JC159 recognizes an epitope between amino acids 27 and 40 of the extracellular portion of CD235a (glycophorin A), a sialoglycoprotein expressed on early erythroblasts, late erythroblasts, erythroblasts, mature erythrocytes and the cells of erythroid cell lines K562 and HEL. The antibody does not react with glycophorin B.
Clone number:
JC159
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD231 (TALLA-1, T-ALL-asociated antigen 1), also known as tetraspanin 7, is a 150 kDa (under reducing conditions 32-45 kDa) transmembrane glycoprotein of tetraspanin family, expressed in T-type acute lymphoblastic leukemia, neuroblastoma, and neuronal tissue. Mutations of CD231 gene are associated with X-linked mental retardation, Huntington´s chorea, and myotonic dystrophy. CD231 interacts with integrins and may have a role in the control of neurite outgrowth. Antibodies to CD231 are important for detection of T-ALL and are potential targets of its treatment.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human T-ALL cell line THP-6
Applications:
FC
Additional Info:
The mouse monoclonal antibody B2D recognizes an extracellular epitope of CD231 (TALLA-1, tetraspanin 7), a transmembrane glycoprotein expressed in neuronal tissue and T-ALL.
Clone number:
B2D
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD231 (TALLA-1, T-ALL-asociated antigen 1), also known as tetraspanin 7, is a 150 kDa (under reducing conditions 32-45 kDa) transmembrane glycoprotein of tetraspanin family, expressed in T-type acute lymphoblastic leukemia, neuroblastoma, and neuronal tissue. Mutations of CD231 gene are associated with X-linked mental retardation, Huntington´s chorea, and myotonic dystrophy. CD231 interacts with integrins and may have a role in the control of neurite outgrowth. Antibodies to CD231 are important for detection of T-ALL and are potential targets of its treatment.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human T-ALL cell line THP-6
Applications:
FC
Additional Info:
The mouse monoclonal antibody B2D recognizes an extracellular epitope of CD231 (TALLA-1, tetraspanin 7), a transmembrane glycoprotein expressed in neuronal tissue and T-ALL.
Clone number:
B2D
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD229 (Ly9) is a cell surface receptor of the CD150 family, which includes also e.g. CD48 and CD224. Receptors of this family regulate cytokine production and cytotoxicity of lymphocytes and NK cells. High levels of CD229 are found on T and B cells, where its expression increases during their maturation. It is absent on granulocytes, bone marrow-derived dendritic cells, platelets and erythrocytes. CD229 has been also reported on mouse monocytes and NK cells. CD229 interacts homophilically through its N-terminal domain and localizes to the contact site between T cells and antigen presenting B cells during antigen-dependent immune synapse formation.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
CD299-transfected 300.19 pre-B cell line
Applications:
FC
Additional Info:
The mouse monoclonal antibody HLy9.25 (also known as HLy9.1.25) recognizes an extracellular epitope of CD229 / Ly9, a 100-120 kDa cell surface glycoprotein expressed on T and B cells.
Clone number:
HLy9.25
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD229 (Ly9) is a cell surface receptor of the CD150 family, which includes also e.g. CD48 and CD224. Receptors of this family regulate cytokine production and cytotoxicity of lymphocytes and NK cells. High levels of CD229 are found on T and B cells, where its expression increases during their maturation. It is absent on granulocytes, bone marrow-derived dendritic cells, platelets and erythrocytes. CD229 has been also reported on mouse monocytes and NK cells. CD229 interacts homophilically through its N-terminal domain and localizes to the contact site between T cells and antigen presenting B cells during antigen-dependent immune synapse formation.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
CD299-transfected 300.19 pre-B cell line
Applications:
FC
Additional Info:
The mouse monoclonal antibody HLy9.25 (also known as HLy9.1.25) recognizes an extracellular epitope of CD229 / Ly9, a 100-120 kDa cell surface glycoprotein expressed on T and B cells.
Clone number:
HLy9.25
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD222 (CIMPR, cation-independent mannose 6-phosphate receptor; IGF2 receptor) is a ubiquitously expressed 250 kDa transmembrane protein. No more than 10% of CD222 is present on the cell surface where it serves as a multifunctional receptor. Intracellular (major) fraction of CD222 is involved in transport of newly synthesized lysosomal enzymes modified by mannose 6-phosphate from Golgi apparatus to lysosomes. The cell surface CD222 binds and internalizes exogeneous mannose 6-phosphate-containing ligands. Importantly, CD222 is crutial for internalization and degradation of insulin-like growth factor 2, thus controling cell growth. CD222 also complexes CD87 (urokinase-type plasminogen-activator receptor), plasminogen and latent TGF-beta, last but not least CD222 serves as a receptor for heparanase and even for Listeria.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Recombinant Vaccinia virus encoding CD222.
Applications:
FC
Additional Info:
The antibody MEM-238 recognizes an extracellular epitope between amino acids 698-1262 of CD222 (IGF2 receptor), a ubiquitously expressed 250 kDa multifunctional type I transmembrane protein. The majority of CD222 is found in the late endosomal/prelysosomal compartment, 5-10% in the plasma membrane and the truncated (220 kDa) form of CD222 is present in human and bovine serum.
Clone number:
MEM-240
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests. Extracellular and intracellular staining.
CD222 (CIMPR, cation-independent mannose 6-phosphate receptor; IGF2 receptor) is a ubiquitously expressed 250 kDa transmembrane protein. No more than 10% of CD222 is present on the cell surface where it serves as a multifunctional receptor. Intracellular (major) fraction of CD222 is involved in transport of newly synthesized lysosomal enzymes modified by mannose 6-phosphate from Golgi apparatus to lysosomes. The cell surface CD222 binds and internalizes exogeneous mannose 6-phosphate-containing ligands. Importantly, CD222 is crutial for internalization and degradation of insulin-like growth factor 2, thus controling cell growth. CD222 also complexes CD87 (urokinase-type plasminogen-activator receptor), plasminogen and latent TGF-beta, last but not least CD222 serves as a receptor for heparanase and even for Listeria.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Recombinant Vaccinia virus encoding CD222.
Applications:
FC
Additional Info:
The antibody MEM-238 recognizes an extracellular epitope between amino acids 192-697 of CD222 (IGF2 receptor), a ubiquitously expressed 250 kDa multifunctional type I transmembrane protein. The majority of CD222 is found in the late endosomal/prelysosomal compartment, 5-10% in the plasma membrane and the truncated (220 kDa) form of CD222 is present in human and bovine serum.
Clone number:
MEM-238
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests. Extracellular and intracellular staining.
CD222 (CIMPR, cation-independent mannose 6-phosphate receptor; IGF2 receptor) is a ubiquitously expressed 250 kDa transmembrane protein. No more than 10% of CD222 is present on the cell surface where it serves as a multifunctional receptor. Intracellular (major) fraction of CD222 is involved in transport of newly synthesized lysosomal enzymes modified by mannose 6-phosphate from Golgi apparatus to lysosomes. The cell surface CD222 binds and internalizes exogeneous mannose 6-phosphate-containing ligands. Importantly, CD222 is crutial for internalization and degradation of insulin-like growth factor 2, thus controling cell growth. CD222 also complexes CD87 (urokinase-type plasminogen-activator receptor), plasminogen and latent TGF-beta, last but not least CD222 serves as a receptor for heparanase and even for Listeria.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Recombinant Vaccinia virus encoding CD222.
Applications:
FC
Additional Info:
The antibody MEM-238 recognizes an extracellular epitope between amino acids 192-697 of CD222 (IGF2 receptor), a ubiquitously expressed 250 kDa multifunctional type I transmembrane protein. The majority of CD222 is found in the late endosomal/prelysosomal compartment, 5-10% in the plasma membrane and the truncated (220 kDa) form of CD222 is present in human and bovine serum.
Clone number:
MEM-238
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests. Extracellular and intracellular staining.
CD22, also known as Siglec-2 (sialic acid-binding immunoglobulin-like lectin-2) is a transmembrane glycoprotein binding alpha2,6-linked sialic acid-bearing ligands. Intracellular domain of CD22 recruits protein tyrosine phosphatase SHP-1 through the immunoreceptor tyrosine-based inhibitory motifs (ITIMs), thus setting a treshold for B cell receptor-mediated activation. CD22 also regulates B-cell response by involvement in controlling the CD19/CD21-Src-family protein tyrosine kinase amplification pathway and CD40 signaling. CD22 exhibits hallmarks of clathrin-mediated endocytic pathway.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Raji Burkitt's lymphoma cell line
Applications:
FC
Additional Info:
The antibody MEM-01 reacts with an extracellular epitope of CD22 (BL-CAM), a 130 kDa type I transmembrane glycoprotein (immunoglobulin superfamily) expressed in the cytoplasm of pro-B and pre-B lymphocytes, and on the surface of mature and activated B lymphocytes; it is lost on plasma cells, peripheral blood T lymphocytes, granulocytes and monocytes. The antibody MEM-01 cross-blocks the antibody OTH228 that recognizes uniquely epitope "E"; it does not cross-block antibodies RFB-4, CLB22/1 and CLB-BLy1.
Clone number:
MEM-01
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD22, also known as Siglec-2 (sialic acid-binding immunoglobulin-like lectin-2) is a transmembrane glycoprotein binding alpha2,6-linked sialic acid-bearing ligands. Intracellular domain of CD22 recruits protein tyrosine phosphatase SHP-1 through the immunoreceptor tyrosine-based inhibitory motifs (ITIMs), thus setting a treshold for B cell receptor-mediated activation. CD22 also regulates B-cell response by involvement in controlling the CD19/CD21-Src-family protein tyrosine kinase amplification pathway and CD40 signaling. CD22 exhibits hallmarks of clathrin-mediated endocytic pathway.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human cell line Reh
Applications:
FC
Additional Info:
The antibody IS7 reacts with an extracellular epitope of CD22 (BL-CAM), a 130 kDa type I transmembrane glycoprotein (immunoglobulin superfamily) expressed in the cytoplasm of pro-B and pre-B lymphocytes, and on the surface of mature and activated B lymphocytes; it is lost on plasma cells, peripheral blood T lymphocytes, granulocytes and monocytes.
Clone number:
IS7
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD22, also known as Siglec-2 (sialic acid-binding immunoglobulin-like lectin-2) is a transmembrane glycoprotein binding alpha2,6-linked sialic acid-bearing ligands. Intracellular domain of CD22 recruits protein tyrosine phosphatase SHP-1 through the immunoreceptor tyrosine-based inhibitory motifs (ITIMs), thus setting a treshold for B cell receptor-mediated activation. CD22 also regulates B-cell response by involvement in controlling the CD19/CD21-Src-family protein tyrosine kinase amplification pathway and CD40 signaling. CD22 exhibits hallmarks of clathrin-mediated endocytic pathway.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human cell line Reh
Applications:
FC
Additional Info:
The antibody IS7 reacts with an extracellular epitope of CD22 (BL-CAM), a 130 kDa type I transmembrane glycoprotein (immunoglobulin superfamily) expressed in the cytoplasm of pro-B and pre-B lymphocytes, and on the surface of mature and activated B lymphocytes; it is lost on plasma cells, peripheral blood T lymphocytes, granulocytes and monocytes.
Clone number:
IS7
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD21 (complement receptor 2, CR2) binds C3 complement fragments, especially its breakdown fragments, which remain covalently attached to complement activating surfaces or antigen. CD21 has important roles in uptake and retention of immunocomplexes, survival of memory B cells and in development and maintenance of the humoral response to T-dependent antigens. CD21 also serves as a key receptor for Epstein-Barr virus binding and is involved in targeting prions to folicular dendritic cells and expediting neuroinvasion following peripheral exposure to prions. A soluble form of the CD21 (sCD21) is shed from the lymphocyte surface and retains its ability to bind respective ligands.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
IM9 human B-lymphoblastoid cell line
Applications:
FC
Additional Info:
The antibody LT21 reacts with an extracellular epitope of CD21 (CR2), a 145 kDa transmembrane glycoprotein (complement C3d receptor - C3dR) expressed on B lymphocytes, follicular dendritic cells, some epithelial cells and a subsets of T lymphocytes. It is not expressed on immature B cells.
Clone number:
LT21
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD21 (complement receptor 2, CR2) binds C3 complement fragments, especially its breakdown fragments, which remain covalently attached to complement activating surfaces or antigen. CD21 has important roles in uptake and retention of immunocomplexes, survival of memory B cells and in development and maintenance of the humoral response to T-dependent antigens. CD21 also serves as a key receptor for Epstein-Barr virus binding and is involved in targeting prions to folicular dendritic cells and expediting neuroinvasion following peripheral exposure to prions. A soluble form of the CD21 (sCD21) is shed from the lymphocyte surface and retains its ability to bind respective ligands.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
IM9 human B-lymphoblastoid cell line
Applications:
FC
Additional Info:
The antibody LT21 reacts with an extracellular epitope of CD21 (CR2), a 145 kDa transmembrane glycoprotein (complement C3d receptor - C3dR) expressed on B lymphocytes, follicular dendritic cells, some epithelial cells and a subsets of T lymphocytes. It is not expressed on immature B cells.
Clone number:
LT21
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD209, also known as DC-SIGN (dendritic cell-specific ICAM-3-grabbing nonintegrin) is a transmembrane receptor expressed on the surface of dendritic cells and macrophages, which recognizes numerous pathogens ranging from parasites to viruses. Its N-terminal domain is transmembrane, whereas a tandem-repeat neck domain and the C terminal C-type lectin carbohydrate recognition domain have dual function as a pathogen recognition receptor and a cell adhesion receptor. The neck region is responsible for homo-oligomerization which allows the receptor to bind multivalent ligands with high avidity. A ligand of CD209 is also CD50 (ICAM-3).
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
CD209-His-tagged fusion protein
Applications:
FC
Additional Info:
The mouse monoclonal antibody UW60.1 recognizes an extracellular epitope of human CD209 (DC-SIGN), a 44 kDa transmembrane receptor, expressed on the surface of dendritic cells and macrophages.
Clone number:
UW60.1
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD209, also known as DC-SIGN (dendritic cell-specific ICAM-3-grabbing nonintegrin) is a transmembrane receptor expressed on the surface of dendritic cells and macrophages, which recognizes numerous pathogens ranging from parasites to viruses. Its N-terminal domain is transmembrane, whereas a tandem-repeat neck domain and the C terminal C-type lectin carbohydrate recognition domain have dual function as a pathogen recognition receptor and a cell adhesion receptor. The neck region is responsible for homo-oligomerization which allows the receptor to bind multivalent ligands with high avidity. A ligand of CD209 is also CD50 (ICAM-3).
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
CD209-His-tagged fusion protein
Applications:
FC
Additional Info:
The mouse monoclonal antibody UW60.1 recognizes an extracellular epitope of human CD209 (DC-SIGN), a 44 kDa transmembrane receptor, expressed on the surface of dendritic cells and macrophages.
Clone number:
UW60.1
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD206 (macrophage mannose receptor, MMR), also known as mannose receptor C1 (MRC1), is a type I transmembrane glycoprotein serving as pattern recognition receptor for carbogydrate groups on the surface of bacteria, fungi and other pathogens. Expressed mainly on tissue macrophages and dendritic cells, CD206 mediates endocytosis of these pathogens and presentation of their antigens to the adaptive immune system. CD206 can also be detected in a soluble form in human plasma and is elevated in patients with acute sepsis.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Purified human mannose receptor
Applications:
FC
Additional Info:
The mouse monoclonal antibody 15-2 (also known as MR15-2) recognizes an extracellular epitope of CD206 (macrophage mannose receptor, MMR), a 162-175 kDa type I transmembrane protein expressed mainly on macrophages, dendritic cells and hepatic or lymphatic endothelial cells, but not on monocytes.
Clone number:
15-2
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD206 (macrophage mannose receptor, MMR), also known as mannose receptor C1 (MRC1), is a type I transmembrane glycoprotein serving as pattern recognition receptor for carbogydrate groups on the surface of bacteria, fungi and other pathogens. Expressed mainly on tissue macrophages and dendritic cells, CD206 mediates endocytosis of these pathogens and presentation of their antigens to the adaptive immune system. CD206 can also be detected in a soluble form in human plasma and is elevated in patients with acute sepsis.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Purified human mannose receptor
Applications:
FC
Additional Info:
The mouse monoclonal antibody 15-2 (also known as MR15-2) recognizes an extracellular epitope of CD206 (macrophage mannose receptor, MMR), a 162-175 kDa type I transmembrane protein expressed mainly on macrophages, dendritic cells and hepatic or lymphatic endothelial cells, but not on monocytes.
Clone number:
15-2
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD205, also known as DEC-205, is an endocytic receptor of macrophage mannose receptor family. This 205 kDa C-type lectin transmembrane protein mediates adsorptive uptake and its intracellular domain contains coated pit localization sequence and distal acidic motif, which is required for recycling beyond early endosomes through deeper MHC II+ late endosomes and lysosomes. This unique pathway of receptor-mediated uptake proves to be necessary for presentation of antigenic peptides at low doses of ligand. CD205 is responsible for uptake and processing of captured antigens for dendritic cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Recombinant Fc-tagged human CD205
Applications:
FC
Additional Info:
The mouse monoclonal antibody HD30 recognizes an extracellular epitope of CD205, an approx. 200 kDa C-type lectin transmembrane protein of the MMR (macrophage mannose receptor) family, expressed at high levels on dendritic cells and thymic epithelial cells, and at low levels on lymphocytes, NK cells and monocytes.
Clone number:
HD30
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD205, also known as DEC-205, is an endocytic receptor of macrophage mannose receptor family. This 205 kDa C-type lectin transmembrane protein mediates adsorptive uptake and its intracellular domain contains coated pit localization sequence and distal acidic motif, which is required for recycling beyond early endosomes through deeper MHC II+ late endosomes and lysosomes. This unique pathway of receptor-mediated uptake proves to be necessary for presentation of antigenic peptides at low doses of ligand. CD205 is responsible for uptake and processing of captured antigens for dendritic cells.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Recombinant Fc-tagged human CD205
Applications:
FC
Additional Info:
The mouse monoclonal antibody HD30 recognizes an extracellular epitope of CD205, an approx. 200 kDa C-type lectin transmembrane protein of the MMR (macrophage mannose receptor) family, expressed at high levels on dendritic cells and thymic epithelial cells, and at low levels on lymphocytes, NK cells and monocytes.
Clone number:
HD30
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD203c, also known as ENPP-3, is integral membrane ectoenzyme (ectonucleotide pyrophosphatase/phosphodiesterase 3), that hydrolyses nucleotide triphosphates and thus modulates purinergic signaling. CD203c is expressed mainly on activated basophils and mast cells. CD203c is upregulated in response to IgE-receptor cross-linking and is overexpressed on neoplastic mast cells in patients with systemic mastocytosis. Measurement of its induced enhancement on the plasma membrane is useful for diagnostics of allergies.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
HEK-293 cells transfected with human CD203c
Applications:
FC,ICC
Additional Info:
The mouse monoclonal antibody NP4D6 reacts with an extracellular epitope of CD203c, a transmembrane ectoenzyme expressed on basophils and mast cells, and overexpressed upon their activation.
Clone number:
NP4D6
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests. Extracellular and intracellular staining.
CD203c, also known as ENPP-3, is integral membrane ectoenzyme (ectonucleotide pyrophosphatase/phosphodiesterase 3), that hydrolyses nucleotide triphosphates and thus modulates purinergic signaling. CD203c is expressed mainly on activated basophils and mast cells. CD203c is upregulated in response to IgE-receptor cross-linking and is overexpressed on neoplastic mast cells in patients with systemic mastocytosis. Measurement of its induced enhancement on the plasma membrane is useful for diagnostics of allergies.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
HEK-293 cells transfected with human CD203c
Applications:
FC
Additional Info:
The mouse monoclonal antibody NP4D6 reacts with an extracellular epitope of CD203c, a transmembrane ectoenzyme expressed on basophils and mast cells, and overexpressed upon their activation.
Clone number:
NP4D6
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests. Extracellular and intracellular staining.
CD200R is a transmembrane glycoprotein, expressed on the surface of myeloid cells. Its interaction with CD200 leads in these cells to a downregulatory signal. This interaction may control myeloid function in a tissue-specific manner. Alternative splicing of CD200R gene results in multiple transcript variants. These isoforms may play a role in differentiation, e.g. regards tolerogenic dendritic cells. Besides myeloid cells, CD200R can be found also on a T cell subset.
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
CD200 (also known as OX2 or MRC) is a type-1 membrane glycoprotein, which contains two extracellular immunoglobulin domains, transmembrane domain and cytoplasmic domain. It is expressed by neuronal cells, B and T cell subsets, follicular dendritic cells, keratinocytes, and ovarian cells. The interaction between CD200 and its receptor CD200R results in macrophage activation (IL-6 production), inhibition of mast cell degranulation along with reduced TNF-alpha and IL-13 secretion and overall attenuation of the activation status of lymphocytes. It seems CD200 is also involved in maternal tolerance and its decreased expression in hair follicle correlates with follicular miniaturization.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
recombinant human CD200
Applications:
FC
Additional Info:
The mouse monoclonal antibody OX-104 recognizes an extracellular epitope of CD200, a type-1 glycoprotein of the immunoglobulin superfamily, which is expressed in neurons, B and T cell subsets, keratinocytes, follicular dendritic cells, and ovarian cells.
Clone number:
OX-104
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD200 (also known as OX2 or MRC) is a type-1 membrane glycoprotein, which contains two extracellular immunoglobulin domains, transmembrane domain and cytoplasmic domain. It is expressed by neuronal cells, B and T cell subsets, follicular dendritic cells, keratinocytes, and ovarian cells. The interaction between CD200 and its receptor CD200R results in macrophage activation (IL-6 production), inhibition of mast cell degranulation along with reduced TNF-alpha and IL-13 secretion and overall attenuation of the activation status of lymphocytes. It seems CD200 is also involved in maternal tolerance and its decreased expression in hair follicle correlates with follicular miniaturization.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
recombinant human CD200
Applications:
FC
Additional Info:
The mouse monoclonal antibody OX-104 recognizes an extracellular epitope of CD200, a type-1 glycoprotein of the immunoglobulin superfamily, which is expressed in neurons, B and T cell subsets, keratinocytes, follicular dendritic cells, and ovarian cells.
Clone number:
OX-104
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD20 is a cell surface 33-37 (depending on the degree of phosphorylation) kDa non-glycosylated surface phosphoprotein expressed on mature and most malignant B cells, but not stem cells or plasma cells (low number of the CD20 has been also detected on a subpopulation of T lymphocytes and it can be expressed on follicular dendritic cells). Its expression on B cells is synchronous with the expression of surface IgM. CD20 regulates transmembrane calcium conductance (probably functioning as a component of store-operated calcium channel), cell cycle progression and B-cell proliferation. It is associated with lipid rafts, but the intensity of this association depends on extracellular triggering, employing CD20 conformational change and/or BCR (B cell antigen receptor) aggregation. After the receptor ligation, BCR and CD20 colocalize and then rapidly dissociate before BCR endocytosis, whereas CD20 remains at the cell surface. CD20 serves as a useful target for antibody-mediated therapeutic depletion of B cells, as it is expressed at high levels on most B-cell malignancies, but does not become internalized or shed from the plasma membrane following mAb treatment.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human tonsillar B cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 2H7 recognizes an extracellular epitope on CD20 (B1, Bp35), a 33-37 kDa non-glycosylated membrane receptor with four transmembrane domains, expressed on pre-B lymphocytes, resting and activated B cells (not plasma cells), follicular dendritic cells, and at low levels on peripheral blood T lymphocytes.
Clone number:
2H7
Antibody Isotype:
IgG2b k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD20 is a cell surface 33-37 (depending on the degree of phosphorylation) kDa non-glycosylated surface phosphoprotein expressed on mature and most malignant B cells, but not stem cells or plasma cells (low number of the CD20 has been also detected on a subpopulation of T lymphocytes and it can be expressed on follicular dendritic cells). Its expression on B cells is synchronous with the expression of surface IgM. CD20 regulates transmembrane calcium conductance (probably functioning as a component of store-operated calcium channel), cell cycle progression and B-cell proliferation. It is associated with lipid rafts, but the intensity of this association depends on extracellular triggering, employing CD20 conformational change and/or BCR (B cell antigen receptor) aggregation. After the receptor ligation, BCR and CD20 colocalize and then rapidly dissociate before BCR endocytosis, whereas CD20 remains at the cell surface. CD20 serves as a useful target for antibody-mediated therapeutic depletion of B cells, as it is expressed at high levels on most B-cell malignancies, but does not become internalized or shed from the plasma membrane following mAb treatment.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human tonsillar B cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 2H7 recognizes an extracellular epitope on CD20 (B1, Bp35), a 33-37 kDa non-glycosylated membrane receptor with four transmembrane domains, expressed on pre-B lymphocytes, resting and activated B cells (not plasma cells), follicular dendritic cells, and at low levels on peripheral blood T lymphocytes.
Clone number:
2H7
Antibody Isotype:
IgG2b k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD20 is a cell surface 33-37 (depending on the degree of phosphorylation) kDa non-glycosylated surface phosphoprotein expressed on mature and most malignant B cells, but not stem cells or plasma cells (low number of the CD20 has been also detected on a subpopulation of T lymphocytes and it can be expressed on follicular dendritic cells). Its expression on B cells is synchronous with the expression of surface IgM. CD20 regulates transmembrane calcium conductance (probably functioning as a component of store-operated calcium channel), cell cycle progression and B-cell proliferation. It is associated with lipid rafts, but the intensity of this association depends on extracellular triggering, employing CD20 conformational change and/or BCR (B cell antigen receptor) aggregation. After the receptor ligation, BCR and CD20 colocalize and then rapidly dissociate before BCR endocytosis, whereas CD20 remains at the cell surface. CD20 serves as a useful target for antibody-mediated therapeutic depletion of B cells, as it is expressed at high levels on most B-cell malignancies, but does not become internalized or shed from the plasma membrane following mAb treatment.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Normal human lymphocytes from lymph node.
Applications:
FC
Additional Info:
The antibody LT20 reacts with an extracellular epitope of CD20 (Bp35), a 33-37 kDa non-glycosylated membrane receptor with four transmembrane domains, expressed on B lymphocytes (it is lost on plasma cells), follicular dendritic cells, and at low levels on peripheral blood T lymphocytes.
Clone number:
LT20
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD20 is a cell surface 33-37 (depending on the degree of phosphorylation) kDa non-glycosylated surface phosphoprotein expressed on mature and most malignant B cells, but not stem cells or plasma cells (low number of the CD20 has been also detected on a subpopulation of T lymphocytes and it can be expressed on follicular dendritic cells). Its expression on B cells is synchronous with the expression of surface IgM. CD20 regulates transmembrane calcium conductance (probably functioning as a component of store-operated calcium channel), cell cycle progression and B-cell proliferation. It is associated with lipid rafts, but the intensity of this association depends on extracellular triggering, employing CD20 conformational change and/or BCR (B cell antigen receptor) aggregation. After the receptor ligation, BCR and CD20 colocalize and then rapidly dissociate before BCR endocytosis, whereas CD20 remains at the cell surface. CD20 serves as a useful target for antibody-mediated therapeutic depletion of B cells, as it is expressed at high levels on most B-cell malignancies, but does not become internalized or shed from the plasma membrane following mAb treatment.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human tonsillar B cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 2H7 recognizes an extracellular epitope on CD20 (B1, Bp35), a 33-37 kDa non-glycosylated membrane receptor with four transmembrane domains, expressed on pre-B lymphocytes, resting and activated B cells (not plasma cells), follicular dendritic cells, and at low levels on peripheral blood T lymphocytes.
Clone number:
2H7
Antibody Isotype:
IgG2b k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD2 belongs to T lymphocyte glycoproteins of immunoglobulin superfamily. Its interaction with CD58 stabilizes adhesion between T cells and antigen presenting or target cells. Relatively low affinity of CD2 to CD58 (as measured in solution) is compensated within the two-dimensional cell-cell interface to provide tight adhesion. Moreover, T cell activation induces increased CD2 expression and its lateral mobility, making easier contact between CD2 and CD58. Subsequently, T cell activation causes fixation of CD58-CD2 at sites of cell-cell contact, thereby strengthening intercellular adhesion. CD2 deficiency reduces intestinal inflammation and helps to control infection.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Cytotoxic T lymphocytes
Applications:
FC
Additional Info:
The mouse monoclonal antibody TS1/8 recognizes an extracellular epitope of CD2, a 50 kDa glycoprotein present on the human peripheral blood T lymphocytes and NK cells; also expressed by all thymocytes.
Clone number:
TS1/8
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD2 belongs to T lymphocyte glycoproteins of immunoglobulin superfamily. Its interaction with CD58 stabilizes adhesion between T cells and antigen presenting or target cells. Relatively low affinity of CD2 to CD58 (as measured in solution) is compensated within the two-dimensional cell-cell interface to provide tight adhesion. Moreover, T cell activation induces increased CD2 expression and its lateral mobility, making easier contact between CD2 and CD58. Subsequently, T cell activation causes fixation of CD58-CD2 at sites of cell-cell contact, thereby strengthening intercellular adhesion. CD2 deficiency reduces intestinal inflammation and helps to control infection.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human peripheral T cells.
Applications:
FC
Additional Info:
The antibody MEM-65 recognizes a unique extracellular epitope of CD2, a 50 kDa glycoprotein present on the human peripheral blood T-lymphocytes and NK cells; also expressed by all thymocytes.
Clone number:
MEM-65
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD2 belongs to T lymphocyte glycoproteins of immunoglobulin superfamily. Its interaction with CD58 stabilizes adhesion between T cells and antigen presenting or target cells. Relatively low affinity of CD2 to CD58 (as measured in solution) is compensated within the two-dimensional cell-cell interface to provide tight adhesion. Moreover, T cell activation induces increased CD2 expression and its lateral mobility, making easier contact between CD2 and CD58. Subsequently, T cell activation causes fixation of CD58-CD2 at sites of cell-cell contact, thereby strengthening intercellular adhesion. CD2 deficiency reduces intestinal inflammation and helps to control infection.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Normal human blood lymphocytes.
Applications:
FC
Additional Info:
The antibody LT2 reacts with an extracellular epitope of CD2, a 50 kDa glycoprotein present on the human peripheral blood T lymphocytes and NK cells; also expressed by all thymocytes.
Clone number:
LT2
Antibody Isotype:
IgG2b
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD2 belongs to T lymphocyte glycoproteins of immunoglobulin superfamily. Its interaction with CD58 stabilizes adhesion between T cells and antigen presenting or target cells. Relatively low affinity of CD2 to CD58 (as measured in solution) is compensated within the two-dimensional cell-cell interface to provide tight adhesion. Moreover, T cell activation induces increased CD2 expression and its lateral mobility, making easier contact between CD2 and CD58. Subsequently, T cell activation causes fixation of CD58-CD2 at sites of cell-cell contact, thereby strengthening intercellular adhesion. CD2 deficiency reduces intestinal inflammation and helps to control infection.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Normal human blood lymphocytes.
Applications:
FC
Additional Info:
The antibody LT2 reacts with an extracellular epitope of CD2, a 50 kDa glycoprotein present on the human peripheral blood T lymphocytes and NK cells; also expressed by all thymocytes.
Clone number:
LT2
Antibody Isotype:
IgG2b
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD1c (also known as R7 or BDCA1) together with CD1a and b, belongs to group 1 of CD1 antigens. These non-classical MHC-like glycoproteins serve as antigen-presenting molecules for a subset of T cells that responds to specific lipids and glycolipids found in the cell walls of bacterial pathogens or self-glycolipid antigens such as gangliosides, and they have also roles in antiviral immunity. The trafficking routes of the particular CD1 types differ and correspond to their ability to bind and present different groups of antigens. CD1c is unique in its ability to present e.g. mycobacterial phosphoketides and polyisoprenoids. CD1c is the only CD1 isoform that has been shown to interact both with alpha/beta and gamma/delta T cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human thymocytes
Applications:
FC
Additional Info:
The mouse monoclonal antibody L161 recognizes an extracellular epitope of CD1c, (R7), a 43 kDa type I glycoprotein associated with beta2-microglobulin. It is expressed on cortical thymocytes (strongly), Langerhans cells, dendritic cells, B and some T cells.
Clone number:
L161
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD1c (also known as R7 or BDCA1) together with CD1a and b, belongs to group 1 of CD1 antigens. These non-classical MHC-like glycoproteins serve as antigen-presenting molecules for a subset of T cells that responds to specific lipids and glycolipids found in the cell walls of bacterial pathogens or self-glycolipid antigens such as gangliosides, and they have also roles in antiviral immunity. The trafficking routes of the particular CD1 types differ and correspond to their ability to bind and present different groups of antigens. CD1c is unique in its ability to present e.g. mycobacterial phosphoketides and polyisoprenoids. CD1c is the only CD1 isoform that has been shown to interact both with alpha/beta and gamma/delta T cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human thymocytes
Applications:
FC
Additional Info:
The mouse monoclonal antibody L161 recognizes an extracellular epitope of CD1c, (R7), a 43 kDa type I glycoprotein associated with beta2-microglobulin. It is expressed on cortical thymocytes (strongly), Langerhans cells, dendritic cells, B and some T cells.
Clone number:
L161
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD1b (also known as R1) together with CD1a and c, belongs to group 1 of CD1 antigens. These non-classical MHC-like glycoproteins serve as antigen-presenting molecules for a subset of T cells that responds to specific lipids and glycolipids found in the cell walls of bacterial pathogens or self-glycolipid antigens such as gangliosides, and they have also roles in antiviral immunity. The trafficking routes of the particular CD1 types differ and correspond to their ability to bind and present different groups of antigens. Besides non-peptide glycolipid antigen presentation to CD1-restricted T cells, CD1b has been implicated in thymocyte development.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
A cell membrane antigen preparation that was isolated from normal human thymocytes
Applications:
FC
Additional Info:
The mouse monoclonal antibody SN13 (also known as K5-1B8) recognizes an extracellular epitope of CD1b, a 44 kDa type I glycoprotein associated with beta2-microglobulin. It is expressed on dendritic cells, Langerhans cells, thymocytes, and T acute lymphoblastic leukemia cells.
Clone number:
SN13
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD1a, together with CD1b and c, belongs to group 1 of CD1 glycoproteins. These proteins serve as antigen-presenting molecules for a subset of T cells that responds to specific lipids and glycolipids found in the cell walls of bacterial pathogens or self-glycolipid antigens such as gangliosides, and they have also roles in antiviral immunity. Unlike CD1b, CD1a is excluded from late endosomal compartments and instead traffics independently in the recycling pathway of the early endocytic system, and CD1a antigen presentation is independent upon vesicular acidification.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human thymocytes
Applications:
FC
Additional Info:
The antibody HI149 reacts with an extracellular epitope of CD1a (T6), a 49 kDa polypeptide associated with beta2-microglobulin expressed on cortical thymocytes (strongly), Langerhans cells, dendritic cells and some T cell leukemias and lymphomas. The antibody does not react with peripheral blood T and B lymphocytes, monocytes, granulocytes, platelets and erythrocytes.
Clone number:
HI149
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD1a, together with CD1b and c, belongs to group 1 of CD1 glycoproteins. These proteins serve as antigen-presenting molecules for a subset of T cells that responds to specific lipids and glycolipids found in the cell walls of bacterial pathogens or self-glycolipid antigens such as gangliosides, and they have also roles in antiviral immunity. Unlike CD1b, CD1a is excluded from late endosomal compartments and instead traffics independently in the recycling pathway of the early endocytic system, and CD1a antigen presentation is independent upon vesicular acidification.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human thymocytes
Applications:
FC
Additional Info:
The antibody HI149 reacts with an extracellular epitope of CD1a (T6), a 49 kDa polypeptide associated with beta2-microglobulin expressed on cortical thymocytes (strongly), Langerhans cells, dendritic cells and some T cell leukemias and lymphomas. The antibody does not react with peripheral blood T and B lymphocytes, monocytes, granulocytes, platelets and erythrocytes.
Clone number:
HI149
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD195 / CCR5 (also known as CKR-5) is a receptor for inflammatory CC-chemokines (characterized by a pair of adjacent cysteine residues), such as MIP-1 alpha, MIP-1 beta, or RANTES. It is a G protein-associated seven-pass transmembrane protein expressed on resting T cells with memory/effector phenotype, monocytes, macrophages and immature dendritic cells. This chemokine receptor regulates the activation and directed migration of leukocytes. Importantly, along with CD4, CD195 / CCR5 functions as a major receptor for HIV. Their ligand is the viral glycoprotein gp120.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
CCR5 peptide (Met1-Lys22) KLH conjugate
Applications:
FC
Additional Info:
The mouse monoclonal antibody T21/8 recognizes an extracellular epitope on the N-teminus of CD195, an approximately 45 kDa G-protein coupled receptor 1 family protein expressed on resting T cells, monocytes, macrophages, and immature dendritic cells.
Clone number:
T21/8
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD195 / CCR5 (also known as CKR-5) is a receptor for inflammatory CC-chemokines (characterized by a pair of adjacent cysteine residues), such as MIP-1 alpha, MIP-1 beta, or RANTES. It is a G protein-associated seven-pass transmembrane protein expressed on resting T cells with memory/effector phenotype, monocytes, macrophages and immature dendritic cells. This chemokine receptor regulates the activation and directed migration of leukocytes. Importantly, along with CD4, CD195 / CCR5 functions as a major receptor for HIV. Their ligand is the viral glycoprotein gp120.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
CCR5 peptide (Met1-Lys22) KLH conjugate
Applications:
FC
Additional Info:
The mouse monoclonal antibody T21/8 recognizes an extracellular epitope on the N-teminus of CD195, an approximately 45 kDa G-protein coupled receptor 1 family protein expressed on resting T cells, monocytes, macrophages, and immature dendritic cells.
Clone number:
T21/8
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD193 / CCR3 is a G-protein coupled receptor for several chemokines, namely CCL11 (eotaxin), CCL26 (eotaxin-3), CCL7 (MCP-4), or CCL5 (RANTES). It is highly expressed on eosinophils and basophils, and is also detected in TH1 and TH2 cells, as well as in airway epithelial cells. CD193 is the key eosinophil chemokine receptor responsible for regulation of eosinophil migration and function. This receptor may contribute to the accumulation and activation of eosinophils and other inflammatory cells in the allergic airway. It is also known to be an entry co-receptor for HIV-1.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human CD193 transfectants
Applications:
FC
Additional Info:
The mouse monoclonal antibody 5E8 recognizes an extracellular epitope of CD193 (chemokine receptor 3), an approximately 41 kDa protein expressed above all in eosinophils and basophils.
Clone number:
500000000
Antibody Isotype:
IgG2b k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD193 / CCR3 is a G-protein coupled receptor for several chemokines, namely CCL11 (eotaxin), CCL26 (eotaxin-3), CCL7 (MCP-4), or CCL5 (RANTES). It is highly expressed on eosinophils and basophils, and is also detected in TH1 and TH2 cells, as well as in airway epithelial cells. CD193 is the key eosinophil chemokine receptor responsible for regulation of eosinophil migration and function. This receptor may contribute to the accumulation and activation of eosinophils and other inflammatory cells in the allergic airway. It is also known to be an entry co-receptor for HIV-1.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human CD193 transfectants
Applications:
FC
Additional Info:
The mouse monoclonal antibody 5E8 recognizes an extracellular epitope of CD193 (chemokine receptor 3), an approximately 41 kDa protein expressed above all in eosinophils and basophils.
Clone number:
500000000
Antibody Isotype:
IgG2b k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD19 is a transmembrane glycoprotein of Ig superfamily expressed by B cells from the time of heavy chain rearrangement until plasma cell differentiation. It forms a tetrameric complex with CD21 (complement receptor type 2), CD81 (TAPA-1) and Leu13. Together with BCR (B cell antigen receptor), this complex signals to decrease B cell treshold for activation by the antigen. Besides being signal-amplifying coreceptor for BCR, CD19 can also signal independently of BCR coligation and it turns out to be a central regulatory component upon which multiple signaling pathways converge. Mutation of the CD19 gene results in hypogammaglobulinemia, whereas CD19 overexpression causes B cell hyperactivity.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human CCL (chronic lymphocytic leukemia) cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 4G7 recognizes an extracellular epitope of human CD19.
Clone number:
4G7
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD19 is a transmembrane glycoprotein of Ig superfamily expressed by B cells from the time of heavy chain rearrangement until plasma cell differentiation. It forms a tetrameric complex with CD21 (complement receptor type 2), CD81 (TAPA-1) and Leu13. Together with BCR (B cell antigen receptor), this complex signals to decrease B cell treshold for activation by the antigen. Besides being signal-amplifying coreceptor for BCR, CD19 can also signal independently of BCR coligation and it turns out to be a central regulatory component upon which multiple signaling pathways converge. Mutation of the CD19 gene results in hypogammaglobulinemia, whereas CD19 overexpression causes B cell hyperactivity.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Daudi human Burkitt lymphoma cell line
Applications:
FC
Additional Info:
The antibody LT19 reacts with an extracellular epitope of CD19 (B4), a 95 kDa type I transmembrane glycoprotein (immunoglobulin superfamily) expressed on B lymphocytes and follicular dendritic cells; it is lost on plasma cells.
Clone number:
LT19
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD19 is a transmembrane glycoprotein of Ig superfamily expressed by B cells from the time of heavy chain rearrangement until plasma cell differentiation. It forms a tetrameric complex with CD21 (complement receptor type 2), CD81 (TAPA-1) and Leu13. Together with BCR (B cell antigen receptor), this complex signals to decrease B cell treshold for activation by the antigen. Besides being signal-amplifying coreceptor for BCR, CD19 can also signal independently of BCR coligation and it turns out to be a central regulatory component upon which multiple signaling pathways converge. Mutation of the CD19 gene results in hypogammaglobulinemia, whereas CD19 overexpression causes B cell hyperactivity.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Daudi human Burkitt lymphoma cell line
Applications:
FC
Additional Info:
The antibody LT19 reacts with an extracellular epitope of CD19 (B4), a 95 kDa type I transmembrane glycoprotein (immunoglobulin superfamily) expressed on B lymphocytes and follicular dendritic cells; it is lost on plasma cells.
Clone number:
LT19
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD19 is a transmembrane glycoprotein of Ig superfamily expressed by B cells from the time of heavy chain rearrangement until plasma cell differentiation. It forms a tetrameric complex with CD21 (complement receptor type 2), CD81 (TAPA-1) and Leu13. Together with BCR (B cell antigen receptor), this complex signals to decrease B cell treshold for activation by the antigen. Besides being signal-amplifying coreceptor for BCR, CD19 can also signal independently of BCR coligation and it turns out to be a central regulatory component upon which multiple signaling pathways converge. Mutation of the CD19 gene results in hypogammaglobulinemia, whereas CD19 overexpression causes B cell hyperactivity.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human CCL (chronic lymphocytic leukemia) cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 4G7 recognizes an extracellular epitope of human CD19.
Clone number:
4G7
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD19 is a transmembrane glycoprotein of Ig superfamily expressed by B cells from the time of heavy chain rearrangement until plasma cell differentiation. It forms a tetrameric complex with CD21 (complement receptor type 2), CD81 (TAPA-1) and Leu13. Together with BCR (B cell antigen receptor), this complex signals to decrease B cell treshold for activation by the antigen. Besides being signal-amplifying coreceptor for BCR, CD19 can also signal independently of BCR coligation and it turns out to be a central regulatory component upon which multiple signaling pathways converge. Mutation of the CD19 gene results in hypogammaglobulinemia, whereas CD19 overexpression causes B cell hyperactivity.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Daudi human Burkitt lymphoma cell line
Applications:
FC
Additional Info:
The antibody LT19 reacts with an extracellular epitope of CD19 (B4), a 95 kDa type I transmembrane glycoprotein (immunoglobulin superfamily) expressed on B lymphocytes and follicular dendritic cells; it is lost on plasma cells.
Clone number:
LT19
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD19 is a transmembrane glycoprotein of Ig superfamily expressed by B cells from the time of heavy chain rearrangement until plasma cell differentiation. It forms a tetrameric complex with CD21 (complement receptor type 2), CD81 (TAPA-1) and Leu13. Together with BCR (B cell antigen receptor), this complex signals to decrease B cell treshold for activation by the antigen. Besides being signal-amplifying coreceptor for BCR, CD19 can also signal independently of BCR coligation and it turns out to be a central regulatory component upon which multiple signaling pathways converge. Mutation of the CD19 gene results in hypogammaglobulinemia, whereas CD19 overexpression causes B cell hyperactivity.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human CCL (chronic lymphocytic leukemia) cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 4G7 recognizes an extracellular epitope of human CD19.
Clone number:
4G7
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD187 (CXCR7) is a member of chemokine receptor family, but with discussed specificity. It is expressed in various tissues and cells, such as placenta, urinary bladder, fetal liver cells, tumor cells, activated endothelium, monocytes, lymphocytes, mature dendritic cells, and other.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Applications:
FC
Clone number:
10D1-J16
Antibody Isotype:
IgG2a k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD184, also known as CXCR4 or fusin, is a receptor for the C-X-C chemokine SDF-1. It is expressed mainly in hematopoietic cells, vascular endothelium, and neural tissue. CD184 is a G-protein coupled receptor containing extracellular N-terminal, seven transmembrane domains and intracellular C-terminal domain. It transduces signal by increasing the intracellular calcium level. CD184 plays an essential role in vascularization of the gastrointestinal tract, and is involved in cerebellar development and in hematopoiesis. It is also a coreceptor (with CD4) for HIV-1 X4 virus and a primary receptor for some HIV-2 isolates.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
CP-MAC-infected Sup-T1 cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 12G5 recognizes an extracellular epitope of CD184, a 45 kDa G-protein-linked CXC chemokine receptor widely expressed on blood and tissue cells.
Clone number:
12G5
Antibody Isotype:
IgG2a k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 4 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (0.4 ml) is sufficient for 100 tests.
CD184, also known as CXCR4 or fusin, is a receptor for the C-X-C chemokine SDF-1. It is expressed mainly in hematopoietic cells, vascular endothelium, and neural tissue. CD184 is a G-protein coupled receptor containing extracellular N-terminal, seven transmembrane domains and intracellular C-terminal domain. It transduces signal by increasing the intracellular calcium level. CD184 plays an essential role in vascularization of the gastrointestinal tract, and is involved in cerebellar development and in hematopoiesis. It is also a coreceptor (with CD4) for HIV-1 X4 virus and a primary receptor for some HIV-2 isolates.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
CP-MAC-infected Sup-T1 cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 12G5 recognizes an extracellular epitope of CD184, a 45 kDa G-protein-linked CXC chemokine receptor widely expressed on blood and tissue cells.
Clone number:
12G5
Antibody Isotype:
IgG2a k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD184, also known as CXCR4 or fusin, is a receptor for the C-X-C chemokine SDF-1. It is expressed mainly in hematopoietic cells, vascular endothelium, and neural tissue. CD184 is a G-protein coupled receptor containing extracellular N-terminal, seven transmembrane domains and intracellular C-terminal domain. It transduces signal by increasing the intracellular calcium level. CD184 plays an essential role in vascularization of the gastrointestinal tract, and is involved in cerebellar development and in hematopoiesis. It is also a coreceptor (with CD4) for HIV-1 X4 virus and a primary receptor for some HIV-2 isolates.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
CP-MAC-infected Sup-T1 cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 12G5 recognizes an extracellular epitope of CD184, a 45 kDa G-protein-linked CXC chemokine receptor widely expressed on blood and tissue cells.
Clone number:
12G5
Antibody Isotype:
IgG2a k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD46 (MCP, membrane cofactor protein) is a multifunctional cell surface transmembrane protein that binds and inactivates C3b and C4b complement fragments, regulates T cell-induced inflammatory responses by either inhibiting (CD46-1 isoform) or increasing (CD46-2 isoform) the contact hypersensitivity reaction. CD46 also serves as a receptor for several human pathogens (both bacteria and viruses), and its ligation alteres T lymphocyte polarization toward antigen-presenting cells or target cells, inhibiting lymphocyte function. CD46 is a protector of placental tissue and is also expressed on the inner acrosomal membrane of spermatozoa.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
HPB-ALL human T cell line
Applications:
FC
Additional Info:
The antibody MEM-258 recognizes an extracellular epitope on SCR4 (the membrane-proximal SCR) domain of CD46 (Membrane cofactor protein). CD46 is 56-66 kDa dimeric transmembrane protein expressed on T and B lymphocytes, platelets, monocytes, granulocytes, endothelial cells, epithelial cells and fibroblast; it is negative on erythrocytes.
Clone number:
MEM-258
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD46 (MCP, membrane cofactor protein) is a multifunctional cell surface transmembrane protein that binds and inactivates C3b and C4b complement fragments, regulates T cell-induced inflammatory responses by either inhibiting (CD46-1 isoform) or increasing (CD46-2 isoform) the contact hypersensitivity reaction. CD46 also serves as a receptor for several human pathogens (both bacteria and viruses), and its ligation alteres T lymphocyte polarization toward antigen-presenting cells or target cells, inhibiting lymphocyte function. CD46 is a protector of placental tissue and is also expressed on the inner acrosomal membrane of spermatozoa.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
HPB-ALL human T cell line
Applications:
FC
Additional Info:
The antibody MEM-258 recognizes an extracellular epitope on SCR4 (the membrane-proximal SCR) domain of CD46 (Membrane cofactor protein). CD46 is 56-66 kDa dimeric transmembrane protein expressed on T and B lymphocytes, platelets, monocytes, granulocytes, endothelial cells, epithelial cells and fibroblast; it is negative on erythrocytes.
Clone number:
MEM-258
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD45RB is an of a receptor-type protein tyrosine phosphatase, CD45 glycoprotein. CD45 is crucial in lymphocyte development and antigen signaling, serving as an important regulator of Src-family kinases, promotes cell survival by modulating integrin-mediated signal transduction pathway and is also involved in DNA fragmentation during apoptosis. CD45 isoforms differ in their extracellular domains, whereas they share identical transmembrane and cytoplasmic domains. These isoforms differ in their ability to translocate into the glycosphingolipid-enriched membrane domains and their expression depends on cell type and physiological state of the cell. CD45RB is expressed e.g. in microglia and inflammatory cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human thymocytes and T lymphocytes.
Applications:
FC
Additional Info:
The antibody MEM-55 recognizes a siliadase-sensitive extracellular epitope of CD45RB, a 180-240 kDa single chain type I membrane glycoprotein, variant of CD45 (CD45RB isoform). CD45RB is expressed on a subset of T lymphocytes, B lymphocytes, monocytes, macrophages, granulocytes and dendritic cells.
Clone number:
MEM-55
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD45RB is an of a receptor-type protein tyrosine phosphatase, CD45 glycoprotein. CD45 is crucial in lymphocyte development and antigen signaling, serving as an important regulator of Src-family kinases, promotes cell survival by modulating integrin-mediated signal transduction pathway and is also involved in DNA fragmentation during apoptosis. CD45 isoforms differ in their extracellular domains, whereas they share identical transmembrane and cytoplasmic domains. These isoforms differ in their ability to translocate into the glycosphingolipid-enriched membrane domains and their expression depends on cell type and physiological state of the cell. CD45RB is expressed e.g. in microglia and inflammatory cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human thymocytes and T lymphocytes.
Applications:
FC
Additional Info:
The antibody MEM-55 recognizes a siliadase-sensitive extracellular epitope of CD45RB, a 180-240 kDa single chain type I membrane glycoprotein, variant of CD45 (CD45RB isoform). CD45RB is expressed on a subset of T lymphocytes, B lymphocytes, monocytes, macrophages, granulocytes and dendritic cells.
Clone number:
MEM-55
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD45RA is a high molecular weight isoform of a receptor-type protein tyrosine phosphatase, CD45 glycoprotein. CD45 is crucial in lymphocyte development and antigen signaling, serving as an important regulator of Src-family kinases, promotes cell survival by modulating integrin-mediated signal transduction pathway and is also involved in DNA fragmentation during apoptosis. CD45 isoforms differ in their extracellular domains, whereas they share identical transmembrane and cytoplasmic domains. These isoforms differ in their ability to translocate into the glycosphingolipid-enriched membrane domains and their expression depends on cell type and physiological state of the cell. CD45RA is expressed e.g. on naïve T cells and normal plasma cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human thymocytes and T lymphocytes.
Applications:
FC
Additional Info:
The antibody MEM-56 reacts with an extracellular epitope of CD45RA, a 205-220 kDa single chain type I glycoprotein, variant of CD45 (CD45RA isoform). CD45RA is expressed on most of B lymphocytes, resting and native T lymphocytes, medullar thymocytes and monocytes.
Clone number:
MEM-56
Antibody Isotype:
IgG2b
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD45RA is a high molecular weight isoform of a receptor-type protein tyrosine phosphatase, CD45 glycoprotein. CD45 is crucial in lymphocyte development and antigen signaling, serving as an important regulator of Src-family kinases, promotes cell survival by modulating integrin-mediated signal transduction pathway and is also involved in DNA fragmentation during apoptosis. CD45 isoforms differ in their extracellular domains, whereas they share identical transmembrane and cytoplasmic domains. These isoforms differ in their ability to translocate into the glycosphingolipid-enriched membrane domains and their expression depends on cell type and physiological state of the cell. CD45RA is expressed e.g. on naïve T cells and normal plasma cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human thymocytes and T lymphocytes.
Applications:
FC
Additional Info:
The antibody MEM-56 reacts with an extracellular epitope of CD45RA, a 205-220 kDa single chain type I glycoprotein, variant of CD45 (CD45RA isoform). CD45RA is expressed on most of B lymphocytes, resting and native T lymphocytes, medullar thymocytes and monocytes.
Clone number:
MEM-56
Antibody Isotype:
IgG2b
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD45R0 is the shortest isoform of a receptor-type protein tyrosine phosphatase, CD45 glycoprotein. CD45 is crucial in lymphocyte development and antigen signaling, serving as an important regulator of Src-family kinases, promotes cell survival by modulating integrin-mediated signal transduction pathway and is also involved in DNA fragmentation during apoptosis. CD45 isoforms differ in their extracellular domains, whereas they share identical transmembrane and cytoplasmic domains. These isoforms differ in their ability to translocate into the glycosphingolipid-enriched membrane domains and their expression depends on cell type and physiological state of the cell. CD45R0 is expressed e.g. on macrophages, CD8+ T cells, activated T cells and myeloma cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human IL-2 dependent T cells
Applications:
FC
Additional Info:
The antibody UCHL1 recognizes an extracellular epitope of CD45R0, a 180 kDa low molecular weight isoform of the leukocyte common antigen (LCA). The antigen is expressed on a subset of memory/activated T cells and on cortical thymocytes.
Clone number:
UCHL1
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD45R0 is the shortest isoform of a receptor-type protein tyrosine phosphatase, CD45 glycoprotein. CD45 is crucial in lymphocyte development and antigen signaling, serving as an important regulator of Src-family kinases, promotes cell survival by modulating integrin-mediated signal transduction pathway and is also involved in DNA fragmentation during apoptosis. CD45 isoforms differ in their extracellular domains, whereas they share identical transmembrane and cytoplasmic domains. These isoforms differ in their ability to translocate into the glycosphingolipid-enriched membrane domains and their expression depends on cell type and physiological state of the cell. CD45R0 is expressed e.g. on macrophages, CD8+ T cells, activated T cells and myeloma cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human IL-2 dependent T cells
Applications:
FC
Additional Info:
The antibody UCHL1 recognizes an extracellular epitope of CD45R0, a 180 kDa low molecular weight isoform of the leukocyte common antigen (LCA). The antigen is expressed on a subset of memory/activated T cells and on cortical thymocytes.
Clone number:
UCHL1
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD45 (LCA, leukocyte common antigen) is a receptor-type protein tyrosine phosphatase ubiquitously expressed in all nucleated hematopoietic cells, comprising approximately 10% of all surface proteins in lymphocytes. CD45 glycoprotein is crucial in lymphocyte development and antigen signaling, serving as an important regulator of Src-family kinases. CD45 protein exists as multiple isoforms as a result of alternative splicing; these isoforms differ in their extracellular domains, whereas they share identical transmembrane and cytoplasmic domains. These isoforms differ in their ability to translocate into the glycosphingolipid-enriched membrane domains and their expression depends on cell type and physiological state of the cell. Besides the role in immunoreceptor signaling, CD45 is important in promoting cell survival by modulating integrin-mediated signal transduction pathway and is also involved in DNA fragmentation during apoptosis.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human thymocytes and T lymphocytes.
Applications:
FC
Additional Info:
The antibody MEM-28 reacts with an extracellular epitope on all alternative forms of human CD45 antigen (Leukocyte Common Antigen), a 180-220 kDa single chain type I transmembrane protein expressed at high level on all cells of hematopoietic origin, except erythrocytes and platelets.
Clone number:
MEM-28
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD45 (LCA, leukocyte common antigen) is a receptor-type protein tyrosine phosphatase ubiquitously expressed in all nucleated hematopoietic cells, comprising approximately 10% of all surface proteins in lymphocytes. CD45 glycoprotein is crucial in lymphocyte development and antigen signaling, serving as an important regulator of Src-family kinases. CD45 protein exists as multiple isoforms as a result of alternative splicing; these isoforms differ in their extracellular domains, whereas they share identical transmembrane and cytoplasmic domains. These isoforms differ in their ability to translocate into the glycosphingolipid-enriched membrane domains and their expression depends on cell type and physiological state of the cell. Besides the role in immunoreceptor signaling, CD45 is important in promoting cell survival by modulating integrin-mediated signal transduction pathway and is also involved in DNA fragmentation during apoptosis.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human peripheral blood mononuclear cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 2D1 reacts with an extracellular epitope of all alternative forms of human CD45 antigen (Leukocyte Common Antigen), a 180-220 kDa single chain type I transmembrane protein expressed at high level on all cells of hematopoietic origin, except from erythrocytes and platelets.
Clone number:
2D1
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD45 (LCA, leukocyte common antigen) is a receptor-type protein tyrosine phosphatase ubiquitously expressed in all nucleated hematopoietic cells, comprising approximately 10% of all surface proteins in lymphocytes. CD45 glycoprotein is crucial in lymphocyte development and antigen signaling, serving as an important regulator of Src-family kinases. CD45 protein exists as multiple isoforms as a result of alternative splicing; these isoforms differ in their extracellular domains, whereas they share identical transmembrane and cytoplasmic domains. These isoforms differ in their ability to translocate into the glycosphingolipid-enriched membrane domains and their expression depends on cell type and physiological state of the cell. Besides the role in immunoreceptor signaling, CD45 is important in promoting cell survival by modulating integrin-mediated signal transduction pathway and is also involved in DNA fragmentation during apoptosis.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human peripheral blood mononuclear cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 2D1 reacts with an extracellular epitope of all alternative forms of human CD45 antigen (Leukocyte Common Antigen), a 180-220 kDa single chain type I transmembrane protein expressed at high level on all cells of hematopoietic origin, except from erythrocytes and platelets.
Clone number:
2D1
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 4 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (0.4 ml) is sufficient for 100 tests.
CD45 (LCA, leukocyte common antigen) is a receptor-type protein tyrosine phosphatase ubiquitously expressed in all nucleated hematopoietic cells, comprising approximately 10% of all surface proteins in lymphocytes. CD45 glycoprotein is crucial in lymphocyte development and antigen signaling, serving as an important regulator of Src-family kinases. CD45 protein exists as multiple isoforms as a result of alternative splicing; these isoforms differ in their extracellular domains, whereas they share identical transmembrane and cytoplasmic domains. These isoforms differ in their ability to translocate into the glycosphingolipid-enriched membrane domains and their expression depends on cell type and physiological state of the cell. Besides the role in immunoreceptor signaling, CD45 is important in promoting cell survival by modulating integrin-mediated signal transduction pathway and is also involved in DNA fragmentation during apoptosis.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human thymocytes and T lymphocytes.
Applications:
FC
Additional Info:
The antibody MEM-28 reacts with an extracellular epitope on all alternative forms of human CD45 antigen (Leukocyte Common Antigen), a 180-220 kDa single chain type I transmembrane protein expressed at high level on all cells of hematopoietic origin, except erythrocytes and platelets.
Clone number:
MEM-28
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD45 (LCA, leukocyte common antigen) is a receptor-type protein tyrosine phosphatase ubiquitously expressed in all nucleated hematopoietic cells, comprising approximately 10% of all surface proteins in lymphocytes. CD45 glycoprotein is crucial in lymphocyte development and antigen signaling, serving as an important regulator of Src-family kinases. CD45 protein exists as multiple isoforms as a result of alternative splicing; these isoforms differ in their extracellular domains, whereas they share identical transmembrane and cytoplasmic domains. These isoforms differ in their ability to translocate into the glycosphingolipid-enriched membrane domains and their expression depends on cell type and physiological state of the cell. Besides the role in immunoreceptor signaling, CD45 is important in promoting cell survival by modulating integrin-mediated signal transduction pathway and is also involved in DNA fragmentation during apoptosis.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human peripheral blood mononuclear cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 2D1 reacts with an extracellular epitope of all alternative forms of human CD45 antigen (Leukocyte Common Antigen), a 180-220 kDa single chain type I transmembrane protein expressed at high level on all cells of hematopoietic origin, except from erythrocytes and platelets.
Clone number:
2D1
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD45 (LCA, leukocyte common antigen) is a receptor-type protein tyrosine phosphatase ubiquitously expressed in all nucleated hematopoietic cells, comprising approximately 10% of all surface proteins in lymphocytes. CD45 glycoprotein is crucial in lymphocyte development and antigen signaling, serving as an important regulator of Src-family kinases. CD45 protein exists as multiple isoforms as a result of alternative splicing; these isoforms differ in their extracellular domains, whereas they share identical transmembrane and cytoplasmic domains. These isoforms differ in their ability to translocate into the glycosphingolipid-enriched membrane domains and their expression depends on cell type and physiological state of the cell. Besides the role in immunoreceptor signaling, CD45 is important in promoting cell survival by modulating integrin-mediated signal transduction pathway and is also involved in DNA fragmentation during apoptosis.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human thymocytes and T lymphocytes.
Applications:
FC
Additional Info:
The antibody MEM-28 reacts with an extracellular epitope on all alternative forms of human CD45 antigen (Leukocyte Common Antigen), a 180-220 kDa single chain type I transmembrane protein expressed at high level on all cells of hematopoietic origin, except erythrocytes and platelets.
Clone number:
MEM-28
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD45 (LCA, leukocyte common antigen) is a receptor-type protein tyrosine phosphatase ubiquitously expressed in all nucleated hematopoietic cells, comprising approximately 10% of all surface proteins in lymphocytes. CD45 glycoprotein is crucial in lymphocyte development and antigen signaling, serving as an important regulator of Src-family kinases. CD45 protein exists as multiple isoforms as a result of alternative splicing; these isoforms differ in their extracellular domains, whereas they share identical transmembrane and cytoplasmic domains. These isoforms differ in their ability to translocate into the glycosphingolipid-enriched membrane domains and their expression depends on cell type and physiological state of the cell. Besides the role in immunoreceptor signaling, CD45 is important in promoting cell survival by modulating integrin-mediated signal transduction pathway and is also involved in DNA fragmentation during apoptosis.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human peripheral blood mononuclear cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 2D1 reacts with an extracellular epitope of all alternative forms of human CD45 antigen (Leukocyte Common Antigen), a 180-220 kDa single chain type I transmembrane protein expressed at high level on all cells of hematopoietic origin, except from erythrocytes and platelets.
Clone number:
2D1
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD44 is a transmembrane glycoprotein expressed on the surface of most cells, which serves as a receptor for hyaluronan. CD44 mediates angiogenesis, cell adhesion, proliferation and migration, it is thus important for lymphocyte activation, recirculation and homing, it can thus serve e.g. as a modulator of macrophage recruitment in response to pathogen. Although CD44 functions are essential for physiological activities of normal cells, elevated CD44 expression correlates with poor prognosis in many carcinomas, facilitating tumour growth and metastasis, antiapoptosis and directional motility of cancer cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Leukocytes of a patient suffering from LGL Type Leukaemia.
Applications:
FC
Additional Info:
The antibody MEM-85 reacts with an extracellular antigen of both cell surface-expressed and soluble form of CD44 antigen (Phagocyte glycoprotein 1), a 80-95 kDa transmembrane glycoprotein (hyaladherin family) present on the most of cells and tissues (leukocytes, endothelial cells, mesenchymal cells, etc.); it is negative on platelets and hepatocytes.
Clone number:
MEM-85
Antibody Isotype:
IgG2b
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD44 is a transmembrane glycoprotein expressed on the surface of most cells, which serves as a receptor for hyaluronan. CD44 mediates angiogenesis, cell adhesion, proliferation and migration, it is thus important for lymphocyte activation, recirculation and homing, it can thus serve e.g. as a modulator of macrophage recruitment in response to pathogen. Although CD44 functions are essential for physiological activities of normal cells, elevated CD44 expression correlates with poor prognosis in many carcinomas, facilitating tumour growth and metastasis, antiapoptosis and directional motility of cancer cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
COS-7 cells (African Green Monkey).
Applications:
FC
Additional Info:
The antibody MEM-263 reacts with extracellular (N-terminal) domain of standard CD44 (Phagocyte glycoprotein 1), a 80-95 kDa transmembrane glycoprotein (hyaladherin family) present on the most of cells and tissues (leukocytes, endothelial cells, mesenchymal cells, etc.); it is negative on platelets and hepatocytes.
Clone number:
MEM-263
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD44 is a transmembrane glycoprotein expressed on the surface of most cells, which serves as a receptor for hyaluronan. CD44 mediates angiogenesis, cell adhesion, proliferation and migration, it is thus important for lymphocyte activation, recirculation and homing, it can thus serve e.g. as a modulator of macrophage recruitment in response to pathogen. Although CD44 functions are essential for physiological activities of normal cells, elevated CD44 expression correlates with poor prognosis in many carcinomas, facilitating tumour growth and metastasis, antiapoptosis and directional motility of cancer cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Leukocytes of a patient suffering from LGL Type Leukaemia.
Applications:
FC
Additional Info:
The antibody MEM-85 reacts with an extracellular antigen of both cell surface-expressed and soluble form of CD44 antigen (Phagocyte glycoprotein 1), a 80-95 kDa transmembrane glycoprotein (hyaladherin family) present on the most of cells and tissues (leukocytes, endothelial cells, mesenchymal cells, etc.); it is negative on platelets and hepatocytes.
Clone number:
MEM-85
Antibody Isotype:
IgG2b
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD44 is a transmembrane glycoprotein expressed on the surface of most cells, which serves as a receptor for hyaluronan. CD44 mediates angiogenesis, cell adhesion, proliferation and migration, it is thus important for lymphocyte activation, recirculation and homing, it can thus serve e.g. as a modulator of macrophage recruitment in response to pathogen. Although CD44 functions are essential for physiological activities of normal cells, elevated CD44 expression correlates with poor prognosis in many carcinomas, facilitating tumour growth and metastasis, antiapoptosis and directional motility of cancer cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
COS-7 cells (African Green Monkey).
Applications:
FC
Additional Info:
The antibody MEM-263 reacts with extracellular (N-terminal) domain of standard CD44 (Phagocyte glycoprotein 1), a 80-95 kDa transmembrane glycoprotein (hyaladherin family) present on the most of cells and tissues (leukocytes, endothelial cells, mesenchymal cells, etc.); it is negative on platelets and hepatocytes.
Clone number:
MEM-263
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD43 (leukosialin, sialophorin) is a transmembrane mucin-like protein with high negative charge, expressed on the surface of most hematopoietic cells. CD43 contributes to a repulsive barrier that interferes with cellular adhesion, however, in certain cases also promotes leukocyte aggregation. By interaction with actin-binding proteins ezrin and moesin CD43 plays a regulatory role in remodeling T-cell morphology and regulates cell-cell interactions during lymphocyte traffic. CD43 signaling both enhances LFA-1 adhesiveness and counteracts LFA-1 induction via other receptors. Expression of CD43 causes induction of functionally active tumour suppressor p53 protein, but in case of p53 and ARF defficiency CD43 promotes tumour proliferation and viability. It appears to be an important modulator of leukocyte functions.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human T lymphocytes.
Applications:
FC
Additional Info:
The antibody MEM-59 recognizes a neuraminidase-sensitive extracellular epitope on CD43 (Leukosialin), a 95-135 kDa type I transmembrane glycoprotein (mucin-type) which is involved in lymphocyte activation. CD43 is expressed by platelets and at high levels on the surface of all leukocytes; it is negative on resting B lymphocytes and erythrocytes.
Clone number:
MEM-59
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD42b (GPIb alpha) composes together with GPIb beta, GPIX and GPV the GPIb-IX-V receptor complex critical in the process of platelet-rich thrombus formation by tethering the platelet to a thrombogenic surface. CD42b binds to von Willebrand factor (VWF) exposed at a site of vascular injury, as well as to thrombin, coagulation factors XI and XII, high molecular weight kininogen, TSP-1, integrin Mac-1 and P-selectin. The extracellular domain of CD42b by its interactions also contributes to metastasis.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human platelets
Applications:
FC
Additional Info:
The mouse monoclonal antibody AK2 recognizes an extracellular epitope of CD42b (GPIb alpha), a 135-145 kDa membrane glycoprotein expressed on platelets and megakaryocytes. CD42b and CD42c (GPIb beta) are composed in a disulfide linked heterodimer (CD42b/c; 160 kDa); CD42b/c forms a noncovalent complex with CD42a and CD42d.
Clone number:
AK2
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD42b (GPIb alpha) composes together with GPIb beta, GPIX and GPV the GPIb-IX-V receptor complex critical in the process of platelet-rich thrombus formation by tethering the platelet to a thrombogenic surface. CD42b binds to von Willebrand factor (VWF) exposed at a site of vascular injury, as well as to thrombin, coagulation factors XI and XII, high molecular weight kininogen, TSP-1, integrin Mac-1 and P-selectin. The extracellular domain of CD42b by its interactions also contributes to metastasis.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human platelets
Applications:
FC
Additional Info:
The mouse monoclonal antibody AK2 recognizes an extracellular epitope of CD42b (GPIb alpha), a 135-145 kDa membrane glycoprotein expressed on platelets and megakaryocytes. CD42b and CD42c (GPIb beta) are composed in a disulfide linked heterodimer (CD42b/c; 160 kDa); CD42b/c forms a noncovalent complex with CD42a and CD42d.
Clone number:
AK2
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD42a, also known as glycoprotein 9 (GPIX), composes together with GPIb alpha, GPIb beta and GPV the GPIb-IX-V receptor complex critical in the process of platelet-rich thrombus formation by tethering the platelet to a thrombogenic surface. CD42b binds to von Willebrand factor (VWF) exposed at a site of vascular injury, as well as to thrombin, coagulation factors XI and XII, high molecular wight kininogen, TSP-1, integrin Mac-1 and P-selectin. Defects in the gene encoding CD42a are a cause of Bernard-Soulier syndrome, also known as giant platelet disease. These patients have unusually large platelets and have a clinical bleeding tendency.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human acute lymphoblastic leukemia cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody GR-P (also known as GRP-P) recognizes an extracellular epitope of CD42a (glycoprotein 9), a 22 kDa transmembrane protein constitutively expressed on megakaryocytes and platelets.
Clone number:
GR-P
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD180, also known as RP105 (or Bgp95, LY64) is a type I membrane glycoprotein of Toll-like receptor (TLR) family. Its cytoplasmic tail is short and unlike the TLRs, it lacks the TIR domain. CD180 expression is dependent on the coexpression of its helper molecule, MD-1, and mirrors that of TLR4 on antigen-presenting cells. CD180 regulates recognition of LPS and signaling in B cells, via interacting directly with the TLR4 signaling complex, inhibiting its ability to bind microbial ligands. Ligation of CD180 by monoclonal antibodies leads to B cell activation, upregulation of CD80/CD86, and increase in cell size.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human tonsillar B cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody G28-8 recognizes an extracellular epitope of CD180, a 95-105 kDa TLR-like glycoprotein expressed on peripheral blood monocytes and dendritic cells, mantle zone B cells and marginal zone B cells, but very weakly on germinal center B cells.
Clone number:
G28-8
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD180, also known as RP105 (or Bgp95, LY64) is a type I membrane glycoprotein of Toll-like receptor (TLR) family. Its cytoplasmic tail is short and unlike the TLRs, it lacks the TIR domain. CD180 expression is dependent on the coexpression of its helper molecule, MD-1, and mirrors that of TLR4 on antigen-presenting cells. CD180 regulates recognition of LPS and signaling in B cells, via interacting directly with the TLR4 signaling complex, inhibiting its ability to bind microbial ligands. Ligation of CD180 by monoclonal antibodies leads to B cell activation, upregulation of CD80/CD86, and increase in cell size.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human tonsillar B cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody G28-8 recognizes an extracellular epitope of CD180, a 95-105 kDa TLR-like glycoprotein expressed on peripheral blood monocytes and dendritic cells, mantle zone B cells and marginal zone B cells, but very weakly on germinal center B cells.
Clone number:
G28-8
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD18, integrin beta2 subunit, forms heterodimers with four types of CD11 molecule to constitute leukocyte (beta2) integrins: alphaLbeta2 (CD11a/CD18, LFA-1), alphaMbeta2 (CD11b/CD18, Mac-1, CR3), alphaXbeta2 (CD11c/CD18) and alphaDbeta2 (CD11d/CD18). In most cases, the response mediated by the integrin is a composite of the functions of its individual subunits. These integrins are essential for proper leukocyte migration, mediating intercellular contacts. Absence of CD18 leads to leukocyte adhesion deficiency-1; severe reduction of CD18 expression leads to the development of a psoriasiform skin disease. CD18 is also a target of Mannheimia (Pasteurella) haemolytica leukotoxin and is sufficient to mediate leukotoxin-mediated cytolysis.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Leukocytes of a patient suffering from a LGL-type leukemia.
Applications:
FC
Additional Info:
The antibody MEM-48 recognizes an extracellular epitope involving residues 534-546 in cysteine-rich repeat 3 of the CD18 antigen (integrin beta2 subunit; beta2 integrin). CD18 is a 90-95 kDa type I transmembrane protein expressed on all leukocytes.
Clone number:
MEM-48
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD18, integrin beta2 subunit, forms heterodimers with four types of CD11 molecule to constitute leukocyte (beta2) integrins: alphaLbeta2 (CD11a/CD18, LFA-1), alphaMbeta2 (CD11b/CD18, Mac-1, CR3), alphaXbeta2 (CD11c/CD18) and alphaDbeta2 (CD11d/CD18). In most cases, the response mediated by the integrin is a composite of the functions of its individual subunits. These integrins are essential for proper leukocyte migration, mediating intercellular contacts. Absence of CD18 leads to leukocyte adhesion deficiency-1; severe reduction of CD18 expression leads to the development of a psoriasiform skin disease. CD18 is also a target of Mannheimia (Pasteurella) haemolytica leukotoxin and is sufficient to mediate leukotoxin-mediated cytolysis.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Peripheral blood mononuclear cells
Applications:
FC
Additional Info:
The antibody MEM-148 recognizes an extracellular epitope on CD18 which is essentially inaccessible in intact integrin molecules on resting leukocytes, but is exposed on high-affinity state of LFA-1 or on unassociated CD18. CD18 (integrin beta2 subunit; beta2 integrin) is a 90-95 kDa type I transmembrane protein expressed on all leukocytes.
Clone number:
MEM-148
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD18, integrin beta2 subunit, forms heterodimers with four types of CD11 molecule to constitute leukocyte (beta2) integrins: alphaLbeta2 (CD11a/CD18, LFA-1), alphaMbeta2 (CD11b/CD18, Mac-1, CR3), alphaXbeta2 (CD11c/CD18) and alphaDbeta2 (CD11d/CD18). In most cases, the response mediated by the integrin is a composite of the functions of its individual subunits. These integrins are essential for proper leukocyte migration, mediating intercellular contacts. Absence of CD18 leads to leukocyte adhesion deficiency-1; severe reduction of CD18 expression leads to the development of a psoriasiform skin disease. CD18 is also a target of Mannheimia (Pasteurella) haemolytica leukotoxin and is sufficient to mediate leukotoxin-mediated cytolysis.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Peripheral blood mononuclear cells
Applications:
FC
Additional Info:
The antibody MEM-148 recognizes an extracellular epitope on CD18 which is essentially inaccessible in intact integrin molecules on resting leukocytes, but is exposed on high-affinity state of LFA-1 or on unassociated CD18. CD18 (integrin beta2 subunit; beta2 integrin) is a 90-95 kDa type I transmembrane protein expressed on all leukocytes.
Clone number:
MEM-148
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD18, integrin beta2 subunit, forms heterodimers with four types of CD11 molecule to constitute leukocyte (beta2) integrins: alphaLbeta2 (CD11a/CD18, LFA-1), alphaMbeta2 (CD11b/CD18, Mac-1, CR3), alphaXbeta2 (CD11c/CD18) and alphaDbeta2 (CD11d/CD18). In most cases, the response mediated by the integrin is a composite of the functions of its individual subunits. These integrins are essential for proper leukocyte migration, mediating intercellular contacts. Absence of CD18 leads to leukocyte adhesion deficiency-1; severe reduction of CD18 expression leads to the development of a psoriasiform skin disease. CD18 is also a target of Mannheimia (Pasteurella) haemolytica leukotoxin and is sufficient to mediate leukotoxin-mediated cytolysis.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Leukocytes of a patient suffering from a LGL-type leukemia.
Applications:
FC
Additional Info:
The antibody MEM-48 recognizes an extracellular epitope involving residues 534-546 in cysteine-rich repeat 3 of the CD18 antigen (integrin beta2 subunit; beta2 integrin). CD18 is a 90-95 kDa type I transmembrane protein expressed on all leukocytes.
Clone number:
MEM-48
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD178 / Fas-L (Fas ligand, CD95L), a member of TNF family transmembrane glycoproteins, is responsible for induction of apoptosis in cells containing its receptor CD95 / Fas. The CD178-mediated apoptosis pathway has been implicated in peripheral tolerance, tissue pathology, and maintenance of the immune privileged sites. Defects in this interaction may be related to some cases of systemic lupus erythematosus (SLE). CD178 was also described as a co-stimulatory receptor for T-cell activation in mice in vivo.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
L5178Y mouse T lymphoma cells expressing recombinant human CD178
Applications:
FC
Additional Info:
The mouse monoclonal antibody NOK-1 recognizes an extracellular epitope of CD178 / Fas-L, an approximately 40 kDa transmembrane glycoprotein expressed on neutrophils, monocytes, and activated T and NK cells.
Clone number:
NOK-1
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD177 (NB1/HNA-2a and PRV-1 form) is a GPI-anchored glycoprotein present mainly on neutrophils. Its plasma membrane expression is increased during pregnancy and and inflammation or after G-CSF application. Ligand of CD177 has been identified as CD31 (PECAM-1). CD177 participates in neutrophil transmigration and seems to be also a pro-proliferative molecule. The antibodies against CD177 can be involved in neonatal alloimmune neutropenia (NAN).
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human granulocytes
Applications:
FC
Additional Info:
The antibody MEM-166 reacts with CD177 (Neutrophil specific antigen 1), a 60 kDa GPI-linked cell surface glycoprotein of uPAR family, expressed on granulocytes and in bone marrow early erythroblasts, megakaryocytes, promyelocytes and myelocytes.
Clone number:
MEM-166
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD177 (NB1/HNA-2a and PRV-1 form) is a GPI-anchored glycoprotein present mainly on neutrophils. Its plasma membrane expression is increased during pregnancy and and inflammation or after G-CSF application. Ligand of CD177 has been identified as CD31 (PECAM-1). CD177 participates in neutrophil transmigration and seems to be also a pro-proliferative molecule. The antibodies against CD177 can be involved in neonatal alloimmune neutropenia (NAN).
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human granulocytes
Applications:
FC
Additional Info:
The antibody MEM-166 reacts with CD177 (Neutrophil specific antigen 1), a 60 kDa GPI-linked cell surface glycoprotein of uPAR family, expressed on granulocytes and in bone marrow early erythroblasts, megakaryocytes, promyelocytes and myelocytes.
Clone number:
MEM-166
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD172g is a transmembrane glycoprotein, which may play a role in inter-T cellular signaling by binding CD47, and thus in influencing T cell behaviour. CD172g is expressed on mature thymocytes, CD4+ T cells, CD8+ T cells, NK cells, and some B cells. It is absent on myeloid cells. Engagement of CD172g by CD47 expressed on antigen presenting cells results in enhanced antigen-specific T cell proliferation and costimulates T cell activation.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
recombinant human CD172g
Applications:
FC
Clone number:
OX-119
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD172b, the signal-regulatory protein beta (SIRP beta) is a disulfide-linked homodimer expressed on myeloid cells including monocytes and dendritic cells. Similarly to CD172a, it serves as a negative regulator of tyrosine kinase-coupled signaling processes. Unlike CD172a, the CD172b protein does not possess the cytoplasmic domain, but instead its transmembrane domain can interact with another transmembrane protein DAP-12, which contains ITAM sequences in its intracellular domain and links CD172b to the downstream signaling molecules. The result is e.g. regulation of neutrophil transepithelial migration.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
NIH-3T3 cells transfected with human CD172b
Applications:
FC
Additional Info:
The mouse monoclonal antibody B4B6 recognizes an extracellular epitope of CD172b, an approximately 50 kDa transmembrane glycoprotein expressed on myeloid cells.
Clone number:
B4B6
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD172a, the signal-regulatory protein alpha (SIRP alpha), also known as SH2 domain-containing phosphatase substrate-1 (SHPS1), is a 75-110 kDa transmembrane glycoprotein expressed mainly on granulocytes, monocytes, macrophages, dendritic cells and neurons. Its extracellular ligand is CD47. CD172a serves as a substrate of activated receptor tyrosine kinases and upon phosphorylation it recruits SH2 domain-containing tyrosine phosphatases, thereby regulating signal transduction processes related to cell activation, transmigration and phagocytosis. CD172a is a specific marker of cardiomyocytes derived from human pluripotent stem cells and serves as a negative regulator of signaling and growth in myeloid progenitor cells. Extracellular part of CD172b is 90% identical to that of CD172a, but unlike CD172, it has dramatically reduced intracellular domain.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
NIH-3T3 / human CD172a cell line
Applications:
FC
Additional Info:
The mouse monoclonal antibody SE5A5 recognizes a common extracellular epitope on human CD172a and CD172b antigens (approx. 90 kDa and approx. 50 kDa, respectively), although its reactivity with CD172a is higher.
Clone number:
SE5A5
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD172a, the signal-regulatory protein alpha (SIRP alpha), also known as SH2 domain-containing phosphatase substrate-1 (SHPS1), is a 75-110 kDa transmembrane glycoprotein expressed mainly on granulocytes, monocytes, macrophages, dendritic cells and neurons. Its extracellular ligand is CD47. CD172a serves as a substrate of activated receptor tyrosine kinases and upon phosphorylation it recruits SH2 domain-containing tyrosine phosphatases, thereby regulating signal transduction processes related to cell activation, transmigration and phagocytosis. CD172a is a specific marker of cardiomyocytes derived from human pluripotent stem cells and serves as a negative regulator of signaling and growth in myeloid progenitor cells.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Kg-1a cell line
Applications:
FC
Additional Info:
The mouse monoclonal antibody 15-414 recognizes en extracellular epitope of CD172a (SIRP alpha), an approximately 90 kDa transmembrane glycoprotein expressed on cells of myeloid origin and neurons.
Clone number:
15-414
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD170, also known as Siglec 5 (sialic acid binding Ig-like lectin 5) is a type 1 transmembrane glycoprotein containing two cytoplasmic immunoreceptor tyrosine inhibitory motifs (ITIMs). CD170 forms homodimers and functions as an inhibitory receptor able to downregulate cell activation. It binds to alpha2,3- and alpha2,6-linked sialic acid ligands, e.g. on glycophorin A (CD235a). Aberrant expression of CD170 by CD34+ progenitor cells can be observed in case of acute myeloid leukemias.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Fusion protein composed of human CD170 extracellular domain and Fc region of human IgG1
Applications:
FC
Additional Info:
The mouse monoclonal antibody 1A5 recognizes an extracellular epitope of CD170 (Siglec-5, sialic acid binding Ig-like lectin 5), a transmembrane glycoprotein expressed strongly by neutrophils, macrophages activated during infections, monocytes, and dendritic cells. As in case with other anti-CD170 antibodies, this antibody crossreacts with Siglec-14, whose first two Ig domains are almost identical to those of CD170.
Clone number:
1A5
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD140a / PDGF-RA (platelet-derived growth factor receptor alpha) is a cell surface receptor for members of platelet-derived growth factor family, whose intracellular part contains a tyrosine kinase domain. CD140a forms homodimers, or heterodimerizes with CD140b / PDGF-RB. Whereas CD140b induces in different cell types their proliferation and migration, the role of CD140a is more controversial, with pro-proliferative or anti-proliferative effects. CD140a has early developmental functions, mediates mesodermal cell migration, and later acts in signaling associated in epithelial-mesenchymal interactions.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
CD140a-transfected NIH 3T3 cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 16A1 recognizes an extracellular epitope of CD140a / PDGF-RA, the 170 kDa alpha chain of platelet-derived growth factor receptor, which is widely expressed on a variety of mesenchymal-derived cells and plays pro-proliferative or anti-proliferative roles in various tumours.
Clone number:
16A1
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD14 is a 55 kDa GPI-anchored glycoprotein, constitutively expressed on the surface of mature monocytes, macrophages, and neutrophils, where it serves as a multifunctional lipopolysaccharide receptor. It is also released to the serum both as a secreted and enzymatically cleaved GPI-anchored form. CD14 binds lipopolysaccharide molecule in a reaction catalyzed by lipopolysaccharide-binding protein (LBP), an acute phase serum protein. The soluble sCD14 is able to discriminate slight structural differences between lipopolysaccharides and is important for neutralization of serum allochthonous lipopolysaccharides by reconstituted lipoprotein particles. CD14 affects allergic, inflammatory and infectious processes.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
A crude mixture of human urinary proteins precipitated by ammonium sulphate from the urine of a patient suffering from proteinuria.
Applications:
FC
Additional Info:
The antibody MEM-15 reacts with CD14, a 53-55 kDa GPI (glycosylphosphatidylinositol)-linked extracellular membrane glycoprotein expressed on monocytes, macrophages and weakly on granulocytes; also expressed by most tissue macrophages. The antibody MEM-15 also reacts with soluble forms of CD14 found in serum and in the urine of some nephrotic patients.
Clone number:
MEM-15
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD14 is a 55 kDa GPI-anchored glycoprotein, constitutively expressed on the surface of mature monocytes, macrophages, and neutrophils, where it serves as a multifunctional lipopolysaccharide receptor. It is also released to the serum both as a secreted and enzymatically cleaved GPI-anchored form. CD14 binds lipopolysaccharide molecule in a reaction catalyzed by lipopolysaccharide-binding protein (LBP), an acute phase serum protein. The soluble sCD14 is able to discriminate slight structural differences between lipopolysaccharides and is important for neutralization of serum allochthonous lipopolysaccharides by reconstituted lipoprotein particles. CD14 affects allergic, inflammatory and infectious processes.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
A crude mixture of human urinary proteins precipitated by ammonium sulphate from the urine of a patient suffering from proteinuria.
Applications:
FC
Additional Info:
The antibody MEM-15 reacts with CD14, a 53-55 kDa GPI (glycosylphosphatidylinositol)-linked extracellular membrane glycoprotein expressed on monocytes, macrophages and weakly on granulocytes; also expressed by most tissue macrophages. The antibody MEM-15 also reacts with soluble forms of CD14 found in serum and in the urine of some nephrotic patients.
Clone number:
MEM-15
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD14 is a 55 kDa GPI-anchored glycoprotein, constitutively expressed on the surface of mature monocytes, macrophages, and neutrophils, where it serves as a multifunctional lipopolysaccharide receptor. It is also released to the serum both as a secreted and enzymatically cleaved GPI-anchored form. CD14 binds lipopolysaccharide molecule in a reaction catalyzed by lipopolysaccharide-binding protein (LBP), an acute phase serum protein. The soluble sCD14 is able to discriminate slight structural differences between lipopolysaccharides and is important for neutralization of serum allochthonous lipopolysaccharides by reconstituted lipoprotein particles. CD14 affects allergic, inflammatory and infectious processes.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
A crude mixture of human urinary proteins precipitated by ammonium sulphate from the urine of a patient suffering from proteinuria.
Applications:
FC
Additional Info:
The antibody MEM-18 reacts with CD14, a 53-55 kDa GPI (glycosylphosphatidylinositol)-linked extracellular membrane glycoprotein expressed on monocytes, macrophages and weakly on granulocytes; also expressed by most tissue macrophages. In human, the epitope recognized by MEM-18 is located between amino acids 57-64.
Clone number:
MEM-18
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD14 is a 55 kDa GPI-anchored glycoprotein, constitutively expressed on the surface of mature monocytes, macrophages, and neutrophils, where it serves as a multifunctional lipopolysaccharide receptor. It is also released to the serum both as a secreted and enzymatically cleaved GPI-anchored form. CD14 binds lipopolysaccharide molecule in a reaction catalyzed by lipopolysaccharide-binding protein (LBP), an acute phase serum protein. The soluble sCD14 is able to discriminate slight structural differences between lipopolysaccharides and is important for neutralization of serum allochthonous lipopolysaccharides by reconstituted lipoprotein particles. CD14 affects allergic, inflammatory and infectious processes.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
A crude mixture of human urinary proteins precipitated by ammonium sulphate from the urine of a patient suffering from proteinuria.
Applications:
FC
Additional Info:
The antibody MEM-15 reacts with CD14, a 53-55 kDa GPI (glycosylphosphatidylinositol)-linked extracellular membrane glycoprotein expressed on monocytes, macrophages and weakly on granulocytes; also expressed by most tissue macrophages. The antibody MEM-15 also reacts with soluble forms of CD14 found in serum and in the urine of some nephrotic patients.
Clone number:
MEM-15
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD14 is a 55 kDa GPI-anchored glycoprotein, constitutively expressed on the surface of mature monocytes, macrophages, and neutrophils, where it serves as a multifunctional lipopolysaccharide receptor. It is also released to the serum both as a secreted and enzymatically cleaved GPI-anchored form. CD14 binds lipopolysaccharide molecule in a reaction catalyzed by lipopolysaccharide-binding protein (LBP), an acute phase serum protein. The soluble sCD14 is able to discriminate slight structural differences between lipopolysaccharides and is important for neutralization of serum allochthonous lipopolysaccharides by reconstituted lipoprotein particles. CD14 affects allergic, inflammatory and infectious processes.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
A crude mixture of human urinary proteins precipitated by ammonium sulphate from the urine of a patient suffering from proteinuria.
Applications:
FC
Additional Info:
The antibody MEM-18 reacts with CD14, a 53-55 kDa GPI (glycosylphosphatidylinositol)-linked extracellular membrane glycoprotein expressed on monocytes, macrophages and weakly on granulocytes; also expressed by most tissue macrophages. In human, the epitope recognized by MEM-18 is located between amino acids 57-64.
Clone number:
MEM-18
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD137, also known as TNFRSF9 or 4-1BB, is an inducible costimulatory molecule expressed mainly on activated T cells. Its ligand, known as 4-1BBL, is expressed on activated macrophages, mature B cells, hematopoietic stem cells, and myeloid progenitor cells. CD137 signaling leads to maintaining the survival of activated T cells and CD8+ memory T cells, and clonal expansion of T cells, but also to suppressing myelopoiesis and dendritic cell development. Triggered CD137 induces a cytokine release profile regulating peripheral monocyte survival. Soluble forms of CD137 may provide negative control mechanism for some immune responses.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Recombinant human CD137 ectodomain
Applications:
FC
Additional Info:
The mouse monoclonal antibody 4B4-1 recognizes an extracellular conformational epitope on CD137, an approximately 40 kDa type I transmembrane protein of the TNFR family expressed mainly on activated T cells.
Clone number:
4B4-1
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD137, also known as TNFRSF9 or 4-1BB, is an inducible costimulatory molecule expressed mainly on activated T cells. Its ligand, known as 4-1BBL, is expressed on activated macrophages, mature B cells, hematopoietic stem cells, and myeloid progenitor cells. CD137 signaling leads to maintaining the survival of activated T cells and CD8+ memory T cells, and clonal expansion of T cells, but also to suppressing myelopoiesis and dendritic cell development. Triggered CD137 induces a cytokine release profile regulating peripheral monocyte survival. Soluble forms of CD137 may provide negative control mechanism for some immune responses.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Recombinant human CD137 ectodomain
Applications:
FC
Additional Info:
The mouse monoclonal antibody 4B4-1 recognizes an extracellular conformational epitope on CD137, an approximately 40 kDa type I transmembrane protein of the TNFR family expressed mainly on activated T cells.
Clone number:
4B4-1
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD135 / FLT3, also known as FLK2 or STK-1 is a receptor tyrosine kinase that plays important roles in hematopoiesis. After binding of Flt3 ligand (FL), CD135 homodimerizes and stimulates proliferation, differentiation and protects the cell from apoptosis. The loss of CD90 and gain of CD135 expression marks the loss of self-renewal in hematopoietic stem cell population. Detectable CD135 expression appears first at low levels on the surface of primitive multilineage progenitor cells and disappears during defined stages of B-cell development, but is upregulated and maintained during maturation of monocytes. CD135 is also expressed on thymocytes, dendritic cell progenitors and on mature dendritic cells, as well as on various malignant hematopoietic cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
BV-173 leukemic cell line
Applications:
FC
Additional Info:
The mouse monoclonal antibody BV10A4 (BV10) reacts with an extracellular epitope of CD135 (FLT3, FLK2, STK-1), a 130-160 kDa type I transmembrane receptor tyrosine kinase that is involved in early steps of hematopoiesis.
Clone number:
BV10A4
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD135 / FLT3, also known as FLK2 or STK-1 is a receptor tyrosine kinase that plays important roles in hematopoiesis. After binding of Flt3 ligand (FL), CD135 homodimerizes and stimulates proliferation, differentiation and protects the cell from apoptosis. The loss of CD90 and gain of CD135 expression marks the loss of self-renewal in hematopoietic stem cell population. Detectable CD135 expression appears first at low levels on the surface of primitive multilineage progenitor cells and disappears during defined stages of B-cell development, but is upregulated and maintained during maturation of monocytes. CD135 is also expressed on thymocytes, dendritic cell progenitors and on mature dendritic cells, as well as on various malignant hematopoietic cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
BV-173 leukemic cell line
Applications:
FC
Additional Info:
The mouse monoclonal antibody BV10A4 (BV10) reacts with an extracellular epitope of CD135 (FLT3, FLK2, STK-1), a 130-160 kDa type I transmembrane receptor tyrosine kinase that is involved in early steps of hematopoiesis.
Clone number:
BV10A4
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD134 (TNFRSF4, also known as OX40) is a type I transmembrane glycoprotein of TNF/NGF receptor family expressed on activated T cells, fibroblasts, and hematopoietic precursors. Binding to its ligand (OX40L, TNFSF4) on antigen presenting cells gives to the T cell costimulatory signal, and this interaction results also in B cell proliferation and influences T cell memory pool. CD134 is upregulated at sites of inflammation, especially in case of multiple sclerosis and psoriatic lesions.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
HTLV 1-transformed HUT-102 cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody Ber-ACT35 (also known as ACT35) recognizes an extracellular epitope of CD134 (TNFRSF4, OX40), an approximately 50 kDa type I transmembrane glycoprotein expressed on activated T cells.
Clone number:
Ber-ACT35
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD134 (TNFRSF4, also known as OX40) is a type I transmembrane glycoprotein of TNF/NGF receptor family expressed on activated T cells, fibroblasts, and hematopoietic precursors. Binding to its ligand (OX40L, TNFSF4) on antigen presenting cells gives to the T cell costimulatory signal, and this interaction results also in B cell proliferation and influences T cell memory pool. CD134 is upregulated at sites of inflammation, especially in case of multiple sclerosis and psoriatic lesions.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
HTLV 1-transformed HUT-102 cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody Ber-ACT35 (also known as ACT35) recognizes an extracellular epitope of CD134 (TNFRSF4, OX40), an approximately 50 kDa type I transmembrane glycoprotein expressed on activated T cells.
Clone number:
Ber-ACT35
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD326 / EpCAM (also known as ESA, EGP40, EGP-2, KSA1/4, CO17-1A, GA733-2, MOC31, Ber-EP4) is a 40 kDa transmembrane glycoprotein serving as adhesion molecule in the basolateral membranes in a variety of epithelial cells. CD326 mediates calcium-independent homotypic cell-cell adhesions. CD326 over-expression has been detected in many epithelial tumours and is often associated with bad prognosis. It has been used for diagnostics of (pre-) malignancies at early stages.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human breast cancer MCF-7 cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 323/A3 recognizes an extracellular epitope of CD326 / EpCAM, a marker of epithelial lineages, that is over-expressed in many carcinomas.
Clone number:
323/A3
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD326 / EpCAM (also known as ESA, EGP40, EGP-2, KSA1/4, CO17-1A, GA733-2, MOC31, Ber-EP4) is a 40 kDa transmembrane glycoprotein serving as adhesion molecule in the basolateral membranes in a variety of epithelial cells. CD326 mediates calcium-independent homotypic cell-cell adhesions. CD326 over-expression has been detected in many epithelial tumours and is often associated with bad prognosis. It has been used for diagnostics of (pre-) malignancies at early stages.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Small cell lung carcinoma cell line H69.
Applications:
FC
Additional Info:
The mouse monoclonal antibody VU-1D9 recognizes an extracellular epitope within EGF-like domain I of CD326 / EpCAM, a marker of epithelial lineages. This antibody strongly stains various normal epithelial cells and carcinomas.
Clone number:
VU-1D9
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD326 / EpCAM (also known as ESA, EGP40, EGP-2, KSA1/4, CO17-1A, GA733-2, MOC31, Ber-EP4) is a 40 kDa transmembrane glycoprotein serving as adhesion molecule in the basolateral membranes in a variety of epithelial cells. CD326 mediates calcium-independent homotypic cell-cell adhesions. CD326 over-expression has been detected in many epithelial tumours and is often associated with bad prognosis. It has been used for diagnostics of (pre-) malignancies at early stages.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Small cell lung carcinoma cell line H69.
Applications:
FC
Additional Info:
The mouse monoclonal antibody VU-1D9 recognizes an extracellular epitope within EGF-like domain I of CD326 / EpCAM, a marker of epithelial lineages. This antibody strongly stains various normal epithelial cells and carcinomas.
Clone number:
VU-1D9
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD326 / EpCAM (also known as ESA, EGP40, EGP-2, KSA1/4, CO17-1A, GA733-2, MOC31, Ber-EP4) is a 40 kDa transmembrane glycoprotein serving as adhesion molecule in the basolateral membranes in a variety of epithelial cells. CD326 mediates calcium-independent homotypic cell-cell adhesions. CD326 over-expression has been detected in many epithelial tumours and is often associated with bad prognosis. It has been used for diagnostics of (pre-) malignancies at early stages.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human breast cancer MCF-7 cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 323/A3 recognizes an extracellular epitope of CD326 / EpCAM, a marker of epithelial lineages, that is over-expressed in many carcinomas.
Clone number:
323/A3
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD324 / E-cadherin is an epithelial cell surface molecule, which provides calcium-dependent homophilic interactions with E-cadherin of another cell. These intaractions take part in morphogenetic programs controlling the maintenance of the structural and functional integrity of epithelia and affect invasive potential of epithelial neoplasms. CD324 / E-cadherin is implicated in cell growth and differentiation, cell recognition, and sorting during developmental morphogenesis, as well as in aggregation-dependent cell survival. CD324 / E-cadherin-mediated cell adhesion system is highly regulated from inside the cell by a number of intracellular signaling pathways.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
T-47D cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 67A4 recognizes an extracellular epitope of CD324 / E-cadherin, an approximately 100 kDa epithelial cell adhesion molecule, whose detection is important for determination of invasive potential of epithelial neoplasms.
Clone number:
67A4
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD324 / E-cadherin is an epithelial cell surface molecule, which provides calcium-dependent homophilic interactions with E-cadherin of another cell. These intaractions take part in morphogenetic programs controlling the maintenance of the structural and functional integrity of epithelia and affect invasive potential of epithelial neoplasms. CD324 / E-cadherin is implicated in cell growth and differentiation, cell recognition, and sorting during developmental morphogenesis, as well as in aggregation-dependent cell survival. CD324 / E-cadherin-mediated cell adhesion system is highly regulated from inside the cell by a number of intracellular signaling pathways.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
T-47D cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 67A4 recognizes an extracellular epitope of CD324 / E-cadherin, an approximately 100 kDa epithelial cell adhesion molecule, whose detection is important for determination of invasive potential of epithelial neoplasms.
Clone number:
67A4
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD32 (FcgammaRII) is a low affinity receptor for aggregated IgG. It is strongly expressed on monocytes, granulocytes, myeloid and myeloblastic cell lines, and weakly on B cells, CD34+ bone marrow cells, and resting and activated platelets. After binding its ligand, CD32 induces IgG-mediated phagocytosis and oxidative burst in monocytes and neutrophils, whereas in B cells it mediates a negative signal. This polymorphic transmembrane glycoprotein is expressed not only in the activating (CD32a) and inhibitory isoform (CD32b), but also in individual variants with differing avidities for IgG subtypes (e.g. the CD32a131R and CD32a131H allotypes).
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
purified glycosylated recombinant human FcgammaRIIa2
Applications:
FC
Additional Info:
The mouse monoclonal antibody 3D3 recognizes an extracellular epitope of CD32, a 40 kDa polymorphic transmembrane glycoprotein serving as the low affinity receptor for aggregated IgG. This antibody recognizes CD32 on B cells of all donors, but on platelets, monocytes, and granulocytes of only some donors (131R variant, but not 131H variant).
Clone number:
3D3
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD33 is a transmembrane protein of the sialic acid-binding immunoglobulin-like lectin (Siglec) family. It belongs to the immunoreceptor tyrosine-based inhibitory motif (ITIM)-containing molecules able of recruiting protein tyrosine phosphatases SHP-1 and SHP-2 to signal assemblies; these ITIMs are also used for ubiquitin-mediated removal of the receptor from the cell surface. CD33 is expressed on cells of myelomonocytic lineage, binds sialic acid residues in N- and O-glycans on cell surfaces, and is a therapeutic target for acute myeloid leukemia.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human AML cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody WM53 reacts with an extracellular epitope of CD33, a 67 kDa type I transmembrane glycoprotein (immunoglobulin superfamily) expressed on myeloid progenitors, monocytes, granulocytes, dendritic cells and mast cells; it is absent on platelets, lymphocytes, erythrocytes and hematopoietic stem cells.
Clone number:
WM53
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
Mucins are high molecular weight glycoproteins which constitute the major component of the mucus layer that protects the gastric epithelium from chemical and mechanical aggressions. In humans, at least 14 mucin genes have been identified that code for the mucin proteins. MUC6 is a secretory mucin that is part of a family of at least 14 high molecular weight glycoproteins made by many epithelial tissues. MUC6 is preferentially expressed in non-neoplastic gastric tissue, specifically in the pyloric glands. During neoplastic transformation, mucin expression may be altered within these tissues leading to particular patterns of expression.
Antibody Isotype:
IgG1
Monosan Range:
MONOSAN Ready To Use
Clone:
MRQ-20
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Ruco LP, et al., Am J Clin Pathol. 92:273-9 (1989)
References 2:
Facchetti F, et al., Histopathology. 19:141-5 (1991)
References 3:
Do SI. et al. J of Breast Cancer. 16:152-8 (2013)
References 4:
Vergier B et al. Blood., 9597: 2212-8 (2000)
References 5:
Mino-Kenudson M, et al. Virchows Arch. 469:255-65 (2016)
Immunoglobulin D (IgD) is expressed on the surface of naive mature B cells, thus later than IgM, and is coexpressed with it then. Triggered by antigen binding, it signals through the CD79 complex to activate the B cells. Expression of IgD is lost after the isotype switch. Soluble IgD is present in very small amounts in the serum. IgD can bind to basophils and mast cells to activate them in an IgE-independent way to participate in respiratory immune defense.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human IgD
Applications:
FC
Additional Info:
The mouse monoclonal antibody IA6-2 recognizes human immunoglobulin D.
Clone number:
IA6-2
Antibody Isotype:
IgG2a k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
Immunoglobulin classes share the same basic four polypeptide chain structure of two heavy chains (five heavy chains types) and two light chains (kappa, lambda; both having a molecular weight of 22.5kDa). Kappa and lambda consist of a variable region and a constant region and can easily be differentiated by the antigenic properties of the constant region. The ratio of kappa to lambda is 70:30.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Applications:
FC
Additional Info:
The antibody 4C2 reacts with lambda light chains (22.5 kDa) of human immunoglobulin.
Clone number:
4C2
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
Immunoglobulin classes share the same basic four polypeptide chain structure of two heavy chains (five heavy chains types) and two light chains (kappa, lambda; both having a molecular weight of 22.5kDa). Kappa and lambda consist of a variable region and a constant region and can easily be differentiated by the antigenic properties of the constant region. The ratio of kappa to lambda is 70:30.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human IgA1 lambda myeloma protein
Applications:
FC
Additional Info:
The mouse monoclonal antibody 1-155-2 recognizes lambda light chains (22.5 kDa) of human immunoglobulin.
Clone number:
1-155-2
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
Immunoglobulin classes share the same basic four polypeptide chain structure of two heavy chains (five heavy chains types) and two light chains (kappa, lambda; both having a molecular weight of 22.5kDa). Kappa and lambda consist of a variable region and a constant region and can easily be differentiated by the antigenic properties of the constant region. The ratio of kappa to lambda is 70:30.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Applications:
FC
Additional Info:
The antibody 4C2 reacts with lambda light chains (22.5 kDa) of human immunoglobulin.
Clone number:
4C2
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
Immunoglobulin classes share the same basic four polypeptide chain structure of two heavy chains (five heavy chains types) and two light chains (kappa, lambda; both having a molecular weight of 22.5kDa). Kappa and lambda consist of a variable region and a constant region and can easily be differentiated by the antigenic properties of the constant region. The ratio of kappa to lambda is 70:30.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human IgA1 lambda myeloma protein
Applications:
FC
Additional Info:
The mouse monoclonal antibody 1-155-2 recognizes lambda light chains (22.5 kDa) of human immunoglobulin.
Clone number:
1-155-2
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
Immunoglobulin classes share the same basic four polypeptide chain structure of two heavy chains (five heavy chains types) and two light chains (kappa, lambda; both having a molecular weight of 22.5kDa). Kappa and lambda consist of a variable region and a constant region and can easily be differentiated by the antigenic properties of the constant region. The ratio of kappa to lambda is 70:30.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Applications:
FC
Additional Info:
The mouse monoclonal antibody A8B5 reacts with kappa light chains (22.5 kDa) of immunoglobulins.
Clone number:
A8B5
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD82 (KAI1), a member of the tetraspanin family, forms complexes with other tetraspanin proteins, integrins, coreceptors, MHC class I and II molecules. These complexes influence adhesion, morphology, activation, proliferation and differentiation of B, T and other cells. CD82 regulates cytoskeleton rearrangement and may participate in the turnover of the tetraspanin complex members. Besides in the plasma membrane, CD82 is localized also in endosome/lysosome compartments. Tumour-suppressive roles of CD82 have been demonstrated.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
C91/PL (human HTLV-1+ T cell line)
Applications:
FC
Additional Info:
The mouse monoclonal antibody C33 recognizes an extracellular/luminal epitope of CD82, a widely expressed cell surface protein of the tetraspanin family. CD82 is also found in endosome/lysosome compartments.
Clone number:
C33
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD82 (KAI1), a member of the tetraspanin family, forms complexes with other tetraspanin proteins, integrins, coreceptors, MHC class I and II molecules. These complexes influence adhesion, morphology, activation, proliferation and differentiation of B, T and other cells. CD82 regulates cytoskeleton rearrangement and may participate in the turnover of the tetraspanin complex members. Besides in the plasma membrane, CD82 is localized also in endosome/lysosome compartments. Tumour-suppressive roles of CD82 have been demonstrated.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
C91/PL (human HTLV-1+ T cell line)
Applications:
FC
Additional Info:
The mouse monoclonal antibody C33 recognizes an extracellular/luminal epitope of CD82, a widely expressed cell surface protein of the tetraspanin family. CD82 is also found in endosome/lysosome compartments.
Clone number:
C33
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD81 (TAPA-1), a member of the tetraspanin family, is expressed on virtually all nucleated cells, but above all on germinal center B cells. CD81 forms complexes with other tetraspanin proteins, integrins, coreceptors, MHC class I and II molecules, and influences adhesion, morphology, activation, proliferation and differentiation of B, T and other cells, e.g. in muscles CD81 promotes cell fusion and myotube maintenance. CD81 has been also identified as a receptor for the hepatitis C virus.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
MOLT-4 (human T-ALL cell line)
Applications:
FC
Additional Info:
The antibody M38 reacts with an extracellular epitope of CD81, a 25 kDa member of the tetraspanin family, expressed on majority of cells.
Clone number:
M38
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD81 (TAPA-1), a member of the tetraspanin family, is expressed on virtually all nucleated cells, but above all on germinal center B cells. CD81 forms complexes with other tetraspanin proteins, integrins, coreceptors, MHC class I and II molecules, and influences adhesion, morphology, activation, proliferation and differentiation of B, T and other cells, e.g. in muscles CD81 promotes cell fusion and myotube maintenance. CD81 has been also identified as a receptor for the hepatitis C virus.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
MOLT-4 (human T-ALL cell line)
Applications:
FC
Additional Info:
The antibody M38 reacts with an extracellular epitope of CD81, a 25 kDa member of the tetraspanin family, expressed on majority of cells.
Clone number:
M38
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD80 (B7-1) and CD86 (B7-2) are ligands of T cell critical costimulatory molecule CD28 and of an inhibitory receptor CTLA-4 (CD152). The both B7 molecules are expressed on professional antigen-presenting cells and are essential for T cell activation, the both molecules can also substitute for each other in this process. The question what are the differences in CD80 and CD86 competency has not been fully elucidated yet; there are still conflicts in results about their respective roles in initiation or sustaining of the T cell immune response.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Extracellular domain of human CD80 fused to human IgG1(Fc)
Applications:
FC
Additional Info:
The antibody MEM-233 reacts with an extracellular epitope of CD80 (B7-1), a 60 kDa single chain type I glycoprotein of immunoglobulin supergene family, expressed on professional antigen-presenting cells, such as dendritic cells, macrophages or activated B lymphocytes.
Clone number:
MEM-233
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD80 (B7-1) and CD86 (B7-2) are ligands of T cell critical costimulatory molecule CD28 and of an inhibitory receptor CTLA-4 (CD152). The both B7 molecules are expressed on professional antigen-presenting cells and are essential for T cell activation, the both molecules can also substitute for each other in this process. The question what are the differences in CD80 and CD86 competency has not been fully elucidated yet; there are still conflicts in results about their respective roles in initiation or sustaining of the T cell immune response.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Extracellular domain of human CD80 fused to human IgG1(Fc)
Applications:
FC
Additional Info:
The antibody MEM-233 reacts with an extracellular epitope of CD80 (B7-1), a 60 kDa single chain type I glycoprotein of immunoglobulin supergene family, expressed on professional antigen-presenting cells, such as dendritic cells, macrophages or activated B lymphocytes.
Clone number:
MEM-233
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD80 (B7-1) and CD86 (B7-2) are ligands of T cell critical costimulatory molecule CD28 and of an inhibitory receptor CTLA-4 (CD152). The both B7 molecules are expressed on professional antigen-presenting cells and are essential for T cell activation, the both molecules can also substitute for each other in this process. The question what are the differences in CD80 and CD86 competency has not been fully elucidated yet; there are still conflicts in results about their respective roles in initiation or sustaining of the T cell immune response.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Extracellular domain of human CD80 fused to human IgG1(Fc)
Applications:
FC
Additional Info:
The antibody MEM-233 reacts with an extracellular epitope of CD80 (B7-1), a 60 kDa single chain type I glycoprotein of immunoglobulin supergene family, expressed on professional antigen-presenting cells, such as dendritic cells, macrophages or activated B lymphocytes.
Clone number:
MEM-233
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
The CD8 T cell coreceptor (monomer approx. 32-34 kDa) is expressed as alpha/beta heterodimer on majority of MHC I-restricted conventional T cells and thymocytes and as alpha/alpha homodimer on subsets of memory T cells, intraepithelial lymphocytes, NK cells and dendritic cells. Regulation of CD8 beta level on T cell surface seems to be an important mechanism to control their effector function. Assembly of CD8 alpha-beta but not alpha-alpha dimers is connected with formation or localization to the lipid rafts. Recruiting triggered TCR complexes to these membrane microdomains as well as affinity of TCR to MHC I is modulated by CD8, thereby affecting the functional diversity of the TCR signaling.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Crude thymus membrane fraction.
Applications:
FC
Additional Info:
The antibody MEM-31 recognizes a conformationally-dependent extracellular epitope of CD8, a cell surface glycoprotein found on most cytotoxic T lymphocytes that mediates efficient cell-cell interactions within the immune system. CD8 is a disulfide-linked dimer and exists as a CD8 alpha/alpha homodimer or CD8 alpha/beta heterodimer (each monomer approx. 32-34 kDa). The antibody does not react with formaldehyde-fixed cells; negative in Western blotting application.
Clone number:
MEM-31
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
The CD8 T cell coreceptor (monomer approx. 32-34 kDa) is expressed as alpha/beta heterodimer on majority of MHC I-restricted conventional T cells and thymocytes and as alpha/alpha homodimer on subsets of memory T cells, intraepithelial lymphocytes, NK cells and dendritic cells. Regulation of CD8 beta level on T cell surface seems to be an important mechanism to control their effector function. Assembly of CD8 alpha-beta but not alpha-alpha dimers is connected with formation or localization to the lipid rafts. Recruiting triggered TCR complexes to these membrane microdomains as well as affinity of TCR to MHC I is modulated by CD8, thereby affecting the functional diversity of the TCR signaling.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Crude thymus membrane fraction.
Applications:
FC
Additional Info:
The antibody MEM-31 recognizes a conformationally-dependent extracellular epitope of CD8, a cell surface glycoprotein found on most cytotoxic T lymphocytes that mediates efficient cell-cell interactions within the immune system. CD8 is a disulfide-linked dimer and exists as a CD8 alpha/alpha homodimer or CD8 alpha/beta heterodimer (each monomer approx. 32-34 kDa). The antibody does not react with formaldehyde-fixed cells; negative in Western blotting application.
Clone number:
MEM-31
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
The CD8 T cell coreceptor (monomer approx. 32-34 kDa) is expressed as alpha/beta heterodimer on majority of MHC I-restricted conventional T cells and thymocytes and as alpha/alpha homodimer on subsets of memory T cells, intraepithelial lymphocytes, NK cells and dendritic cells. Regulation of CD8 beta level on T cell surface seems to be an important mechanism to control their effector function. Assembly of CD8 alpha-beta but not alpha-alpha dimers is connected with formation or localization to the lipid rafts. Recruiting triggered TCR complexes to these membrane microdomains as well as affinity of TCR to MHC I is modulated by CD8, thereby affecting the functional diversity of the TCR signaling.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human blood lymphocytes
Applications:
FC
Additional Info:
The mouse monoclonal antibody LT8 recognizes an extracellular epitope of CD8, a cell surface glycoprotein found on most cytotoxic T lymphocytes that mediates efficient cell-cell interactions within the immune system. This antibody blocks Leu2 binding.
Clone number:
LT8
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
The CD8 T cell coreceptor (monomer approx. 32-34 kDa) is expressed as alpha/beta heterodimer on majority of MHC I-restricted conventional T cells and thymocytes and as alpha/alpha homodimer on subsets of memory T cells, intraepithelial lymphocytes, NK cells and dendritic cells. Regulation of CD8 beta level on T cell surface seems to be an important mechanism to control their effector function. Assembly of CD8 alpha-beta but not alpha-alpha dimers is connected with formation or localization to the lipid rafts. Recruiting triggered TCR complexes to these membrane microdomains as well as affinity of TCR to MHC I is modulated by CD8, thereby affecting the functional diversity of the TCR signaling.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human blood lymphocytes
Applications:
FC
Additional Info:
The mouse monoclonal antibody LT8 recognizes an extracellular epitope of CD8, a cell surface glycoprotein found on most cytotoxic T lymphocytes that mediates efficient cell-cell interactions within the immune system. This antibody blocks Leu2 binding.
Clone number:
LT8
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
The CD8 T cell coreceptor (monomer approx. 32-34 kDa) is expressed as alpha/beta heterodimer on majority of MHC I-restricted conventional T cells and thymocytes and as alpha/alpha homodimer on subsets of memory T cells, intraepithelial lymphocytes, NK cells and dendritic cells. Regulation of CD8 beta level on T cell surface seems to be an important mechanism to control their effector function. Assembly of CD8 alpha-beta but not alpha-alpha dimers is connected with formation or localization to the lipid rafts. Recruiting triggered TCR complexes to these membrane microdomains as well as affinity of TCR to MHC I is modulated by CD8, thereby affecting the functional diversity of the TCR signaling.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Crude thymus membrane fraction.
Applications:
FC
Additional Info:
The antibody MEM-31 recognizes a conformationally-dependent extracellular epitope of CD8, a cell surface glycoprotein found on most cytotoxic T lymphocytes that mediates efficient cell-cell interactions within the immune system. CD8 is a disulfide-linked dimer and exists as a CD8 alpha/alpha homodimer or CD8 alpha/beta heterodimer (each monomer approx. 32-34 kDa). The antibody does not react with formaldehyde-fixed cells; negative in Western blotting application.
Clone number:
MEM-31
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD79b (Ig beta, B29) forms disulfide-linked heterodimer with CD79a (Ig alpha, MB1). They both are transmembrane proteins with extended cytoplasmic domains containing immunoreceptor tyrosine activation motives (ITAMs), and together with cell surface immunoglobulin they constitute B-cell antigen-specific receptor (BCR). CD79a and b are the first components of BCR that are expressed developmentally. They appear on pro-B cells in association with the endoplasmic reticulum chaperone calnexin. Subsequently, in pre-B cells, CD79 heterodimer is associated with lambda5-VpreB surrogate immunoglobulin and later with antigen-specific surface immunoglobulins. CD79a/b complex interacts with Src-family tyrosine kinase Lyn, which phosphorylates its cytoplasmic ITAM motives to form docking sites for downstream signaling.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Fraction of Ig-associated molecules isolated from Ramos B cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody CB3-1 recognizes an extracellular epitope of CD79b (CD79 beta, Ig beta), an approximately 38 kDa component of B cell receptor (BCR) complex.
Clone number:
CB3-1
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD79b (Ig beta, B29) forms disulfide-linked heterodimer with CD79a (Ig alpha, MB1). They both are transmembrane proteins with extended cytoplasmic domains containing immunoreceptor tyrosine activation motives (ITAMs), and together with cell surface immunoglobulin they constitute B-cell antigen-specific receptor (BCR). CD79a and b are the first components of BCR that are expressed developmentally. They appear on pro-B cells in association with the endoplasmic reticulum chaperone calnexin. Subsequently, in pre-B cells, CD79 heterodimer is associated with lambda5-VpreB surrogate immunoglobulin and later with antigen-specific surface immunoglobulins. CD79a/b complex interacts with Src-family tyrosine kinase Lyn, which phosphorylates its cytoplasmic ITAM motives to form docking sites for downstream signaling.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Fraction of Ig-associated molecules isolated from Ramos B cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody CB3-1 recognizes an extracellular epitope of CD79b (CD79 beta, Ig beta), an approximately 38 kDa component of B cell receptor (BCR) complex.
Clone number:
CB3-1
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD79a (Ig alpha, MB1) forms disulfide-linked heterodimer with CD79b (Ig beta). They both are transmembrane proteins with extended cytoplasmic domains containing immunoreceptor tyrosine activation motives (ITAMs), and together with cell surface immunoglobulin they constitute B-cell antigen-specific receptor (BCR). CD79a and b are the first components of BCR that are expressed developmentally. They appear on pro-B cells in association with the endoplasmic reticulum chaperone calnexin. Subsequently, in pre-B cells, CD79 heterodimer is associated with lambda5-VpreB surrogate immunoglobulin and later with antigen-specific surface immunoglobulins. At the plasma cell stage, CD79a is present as an intracellular component. CD79a/b complex interacts with Src-family tyrosine kinase Lyn, which phosphorylates its cytoplasmic ITAM motives to form docking sites for downstream signaling.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
IgM complex isolated from Daudi cells
Applications:
FC
Clone number:
ZL7.4
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests. Extracellular and intracellular staining.
CD79a (Ig alpha, MB1) forms disulfide-linked heterodimer with CD79b (Ig beta). They both are transmembrane proteins with extended cytoplasmic domains containing immunoreceptor tyrosine activation motives (ITAMs), and together with cell surface immunoglobulin they constitute B-cell antigen-specific receptor (BCR). CD79a and b are the first components of BCR that are expressed developmentally. They appear on pro-B cells in association with the endoplasmic reticulum chaperone calnexin. Subsequently, in pre-B cells, CD79 heterodimer is associated with lambda5-VpreB surrogate immunoglobulin and later with antigen-specific surface immunoglobulins. At the plasma cell stage, CD79a is present as an intracellular component. CD79a/b complex interacts with Src-family tyrosine kinase Lyn, which phosphorylates its cytoplasmic ITAM motives to form docking sites for downstream signaling.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Synthetic peptide corresponding to amino acids 202-216 of human CD79a
Applications:
FC
Additional Info:
The antibody HM57 interacts with intracellular domain of CD79a (Ig alpha), a 40-45 kDa subunit of B cell antigen-specific receptor (BCR) and its early developmental forms.
Clone number:
HM57
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests. Intracellular staining.
CD79a (Ig alpha, MB1) forms disulfide-linked heterodimer with CD79b (Ig beta). They both are transmembrane proteins with extended cytoplasmic domains containing immunoreceptor tyrosine activation motives (ITAMs), and together with cell surface immunoglobulin they constitute B-cell antigen-specific receptor (BCR). CD79a and b are the first components of BCR that are expressed developmentally. They appear on pro-B cells in association with the endoplasmic reticulum chaperone calnexin. Subsequently, in pre-B cells, CD79 heterodimer is associated with lambda5-VpreB surrogate immunoglobulin and later with antigen-specific surface immunoglobulins. At the plasma cell stage, CD79a is present as an intracellular component. CD79a/b complex interacts with Src-family tyrosine kinase Lyn, which phosphorylates its cytoplasmic ITAM motives to form docking sites for downstream signaling.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Synthetic peptide corresponding to C terminal amino acids 208-222 of human CD79a
Applications:
FC
Additional Info:
The mouse monoclonal antibody HM47 reacts with intracellular domain of CD79a (Ig alpha), a 40-45 kDa subunit of B cell antigen-specific receptor (BCR) and its early developmental forms.
Clone number:
HM47
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests. Intracellular staining.
CD79a (Ig alpha, MB1) forms disulfide-linked heterodimer with CD79b (Ig beta). They both are transmembrane proteins with extended cytoplasmic domains containing immunoreceptor tyrosine activation motives (ITAMs), and together with cell surface immunoglobulin they constitute B-cell antigen-specific receptor (BCR). CD79a and b are the first components of BCR that are expressed developmentally. They appear on pro-B cells in association with the endoplasmic reticulum chaperone calnexin. Subsequently, in pre-B cells, CD79 heterodimer is associated with lambda5-VpreB surrogate immunoglobulin and later with antigen-specific surface immunoglobulins. At the plasma cell stage, CD79a is present as an intracellular component. CD79a/b complex interacts with Src-family tyrosine kinase Lyn, which phosphorylates its cytoplasmic ITAM motives to form docking sites for downstream signaling.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
IgM complex isolated from Daudi cells
Applications:
FC
Clone number:
ZL7.4
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests. Extracellular and intracellular staining.
CD79a (Ig alpha, MB1) forms disulfide-linked heterodimer with CD79b (Ig beta). They both are transmembrane proteins with extended cytoplasmic domains containing immunoreceptor tyrosine activation motives (ITAMs), and together with cell surface immunoglobulin they constitute B-cell antigen-specific receptor (BCR). CD79a and b are the first components of BCR that are expressed developmentally. They appear on pro-B cells in association with the endoplasmic reticulum chaperone calnexin. Subsequently, in pre-B cells, CD79 heterodimer is associated with lambda5-VpreB surrogate immunoglobulin and later with antigen-specific surface immunoglobulins. At the plasma cell stage, CD79a is present as an intracellular component. CD79a/b complex interacts with Src-family tyrosine kinase Lyn, which phosphorylates its cytoplasmic ITAM motives to form docking sites for downstream signaling.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Synthetic peptide corresponding to C terminal amino acids 208-222 of human CD79a
Applications:
FC
Additional Info:
The mouse monoclonal antibody HM47 reacts with intracellular domain of CD79a (Ig alpha), a 40-45 kDa subunit of B cell antigen-specific receptor (BCR) and its early developmental forms.
Clone number:
HM47
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests. Intracellular staining.
CD79a (Ig alpha, MB1) forms disulfide-linked heterodimer with CD79b (Ig beta). They both are transmembrane proteins with extended cytoplasmic domains containing immunoreceptor tyrosine activation motives (ITAMs), and together with cell surface immunoglobulin they constitute B-cell antigen-specific receptor (BCR). CD79a and b are the first components of BCR that are expressed developmentally. They appear on pro-B cells in association with the endoplasmic reticulum chaperone calnexin. Subsequently, in pre-B cells, CD79 heterodimer is associated with lambda5-VpreB surrogate immunoglobulin and later with antigen-specific surface immunoglobulins. At the plasma cell stage, CD79a is present as an intracellular component. CD79a/b complex interacts with Src-family tyrosine kinase Lyn, which phosphorylates its cytoplasmic ITAM motives to form docking sites for downstream signaling.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Synthetic peptide corresponding to amino acids 202-216 of human CD79a
Applications:
FC
Additional Info:
The antibody HM57 interacts with intracellular domain of CD79a (Ig alpha), a 40-45 kDa subunit of B cell antigen-specific receptor (BCR) and its early developmental forms.
Clone number:
HM57
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests. Intracellular staining.
CD77 (globotriaosylceramide Gb3), also known as the Pk blood group antigen, BLA (Burkitt´s lymphoma associated antigen), or CTH (ceramide trihexoside) is a neutral glycosphingolipid composed of three carbohydrate molecules linked to a lipid moiety in the cell membrane (Gal-alpha1-4Gal-beta1-4Glc-beta1-Cer). It is expressed on germinal center B cells, Burkitt´s lymphoma cells, it can be induced on extrafolicular B cells and it is also found on endothelia and epithelia. CD77 may be involved in elimination of germinal center B cells that fail to produce high affinity antibodies, and serves also as receptor for shiga toxin and verotoxin.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Daudi cell line (Burkitt´s lymphoma)
Applications:
FC
Clone number:
38.13
Antibody Isotype:
IgM
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD73 (ecto-5´-nucleotidase) is a 70 kDa glycoprotein anchored to the extracellular leaflet of the plasma membrane by GPI. This ecto-enzyme catalyzes dephosphorylation of AMP to adenosine. CD73 is expressed in various types of cells, such as epithelial, muscle, and endothelial cells, neutrophils, lymphocytes and fibroblasts. Inflammatory mediators support CD73 expression and its enzymatic activity, leading to the release of adenosine, which modulates inflammation through adenosine receptors. CD73 is expressed in a variety of lymphomas and leukemias, including ALL and CLL, whereas immunodeficient patients usually express low levels of this protein.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
pre-B leukemia cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody AD2 recognizes CD73, a 70 kDa GPI-anchored 5´-nucleotidase expressed predominantly on the surface of T and B cell subsets, follicular dendritic cells and endothelial cells.
Clone number:
AD2
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 4 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (0.4 ml) is sufficient for 100 tests.
CD73 (ecto-5´-nucleotidase) is a 70 kDa glycoprotein anchored to the extracellular leaflet of the plasma membrane by GPI. This ecto-enzyme catalyzes dephosphorylation of AMP to adenosine. CD73 is expressed in various types of cells, such as epithelial, muscle, and endothelial cells, neutrophils, lymphocytes and fibroblasts. Inflammatory mediators support CD73 expression and its enzymatic activity, leading to the release of adenosine, which modulates inflammation through adenosine receptors. CD73 is expressed in a variety of lymphomas and leukemias, including ALL and CLL, whereas immunodeficient patients usually express low levels of this protein.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
pre-B leukemia cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody AD2 recognizes CD73, a 70 kDa GPI-anchored 5´-nucleotidase expressed predominantly on the surface of T and B cell subsets, follicular dendritic cells and endothelial cells.
Clone number:
AD2
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD73 (ecto-5´-nucleotidase) is a 70 kDa glycoprotein anchored to the extracellular leaflet of the plasma membrane by GPI. This ecto-enzyme catalyzes dephosphorylation of AMP to adenosine. CD73 is expressed in various types of cells, such as epithelial, muscle, and endothelial cells, neutrophils, lymphocytes and fibroblasts. Inflammatory mediators support CD73 expression and its enzymatic activity, leading to the release of adenosine, which modulates inflammation through adenosine receptors. CD73 is expressed in a variety of lymphomas and leukemias, including ALL and CLL, whereas immunodeficient patients usually express low levels of this protein.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
pre-B leukemia cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody AD2 recognizes CD73, a 70 kDa GPI-anchored 5´-nucleotidase expressed predominantly on the surface of T and B cell subsets, follicular dendritic cells and endothelial cells.
Clone number:
AD2
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD72 is a transmembrane glycoprotein expressed as a homodimer especially in B cells, but also in other antigen presenting cells such as dendritic cells and macrophages. Through one of its immunoreceptor tyrosine-based inhibitory motives (ITIMs), CD72 interacts with tyrosine phosphatase SHP-1, thereby suppressing B cell responsiveness. Binding of CD72 with its ligand CD100 (Sema4D) prevents BCR association and phosphorylation of CD72 and results in dissociation of SHP-1 from CD72, thus enables B cell activation.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Normal human lymphocytes from a lymph node.
Applications:
FC
Additional Info:
The mouse monoclonal antibody 3F3 recognizes an extracellular epitope of CD72, a 39-43 kDa type II membrane glycoprotein (C-type lectin family). CD72 is a pan-B cell marker expressed throughout the B lymphocytes diferentiation with the exception of plasma cells; it is also present on follicular dendritic cells.
Clone number:
3F3
Antibody Isotype:
IgG2b
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD71 (transferrin receptor) is a type II transmembrane glycoprotein expressed as homodimer in erythroid blood cell line and in activated leukocytes. Upon binding of holotransferrin (complex of transferrin and iron ions), CD71 is internalized by clathrin-mediated endocytosis. Acidification of endosomes by vesicular membrane proton pumps leads to dissociation of iron ions, whereas transferrin (apotransferrin) remains associated with CD71 and recycles to the cell surface, where it is released upon exposure to normal pH. CD71 is also involved in uptake of non-transferrin bound iron.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
NALM-6 human pre-B cell line
Applications:
FC
Additional Info:
The antibody MEM-75 reacts with an extracellular epitope of CD71 antigen (transferrin receptor), a 95 kDa type II homodimeric transmembrane glycoprotein expressed on activated B and T lymphocytes, macrophages and erythroid precursors; it is lost on resting blood leukocytes.
The antibody MEM-75 does not block binding of transferrin to the receptor.
Clone number:
MEM-75
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD71 (transferrin receptor) is a type II transmembrane glycoprotein expressed as homodimer in erythroid blood cell line and in activated leukocytes. Upon binding of holotransferrin (complex of transferrin and iron ions), CD71 is internalized by clathrin-mediated endocytosis. Acidification of endosomes by vesicular membrane proton pumps leads to dissociation of iron ions, whereas transferrin (apotransferrin) remains associated with CD71 and recycles to the cell surface, where it is released upon exposure to normal pH. CD71 is also involved in uptake of non-transferrin bound iron.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
NALM-6 human pre-B cell line
Applications:
FC
Additional Info:
The antibody MEM-75 reacts with an extracellular epitope of CD71 antigen (transferrin receptor), a 95 kDa type II homodimeric transmembrane glycoprotein expressed on activated B and T lymphocytes, macrophages and erythroid precursors; it is lost on resting blood leukocytes.
The antibody MEM-75 does not block binding of transferrin to the receptor.
Clone number:
MEM-75
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD70, also known as TNFSF7 or CD27L, is a 50 kDa type II transmembrane glycoprotein of the TNF superfamily. It is expressed mainly on activated lymphocytes, including NK cells, and forms trimeric structure. CD70 plays a role in T-cell activation, proliferation and differentiation, in enhancing the generation of cytolytic T cells, and in long-term maintenance of T cell memory. It is also involved in B cell differentiation induced by activated plasmacytoid dendritic cells, which also express CD70.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human L428 cell line
Applications:
FC
Additional Info:
The mouse monoclonal antibody Ki-24 recognizes an extracellular epitope of CD70, an approximately 50 kDa type II transmembrane glycoprotein expressed on activated lymphocytes and some B cell leukemias.
Clone number:
Ki-24
Antibody Isotype:
IgG3 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD7, also known as gp40, is a member of the immunoglobulin superfamily found on T cells, NK cells, thymocytes, hematopoietic progenitors, and monocytes (weakly). CD7 is also expressed on acute lymphocytic leukemia (ALL). CD7 crosslinking induces a calcium flux in T lymphocytes, presumably as a result of cytoplasmic domain association with PI3-kinase. CD7 co-stimulation can induce cytokine secretion and modulate cellular adhesion. A ligand of CD7, epithelial cell secreted protein K12, is produced in thymus to regulate thymocyte signaling and cytokine release. In lung microvascular endothelial cells CD7 serves as an IgM Fc receptor. Expression of CD7 is an important marker used in leukemia diagnostics.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human acute myelogenous leukaemia cell line KG-1.
Applications:
FC
Additional Info:
The antibody MEM-186 reacts with an extracellular epitope of CD7, a 40 kD type I transmembrane glycoprotein expressed on peripheral blood T lymphocytes, NK-cells, hematopoietic progenitors, monocytes (weakly) and also on acute lymphocytic leukemia.
Clone number:
MEM-186
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD7, also known as gp40, is a member of the immunoglobulin superfamily found on T cells, NK cells, thymocytes, hematopoietic progenitors, and monocytes (weakly). CD7 is also expressed on acute lymphocytic leukemia (ALL). CD7 crosslinking induces a calcium flux in T lymphocytes, presumably as a result of cytoplasmic domain association with PI3-kinase. CD7 co-stimulation can induce cytokine secretion and modulate cellular adhesion. A ligand of CD7, epithelial cell secreted protein K12, is produced in thymus to regulate thymocyte signaling and cytokine release. In lung microvascular endothelial cells CD7 serves as an IgM Fc receptor. Expression of CD7 is an important marker used in leukemia diagnostics.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
not available
Applications:
FC
Additional Info:
The mouse monoclonal antibody 124-1D1 recognizes an extracellular epitope of CD7, a 40 kD type I transmembrane glycoprotein expressed on peripheral blood T lymphocytes, NK-cells, hematopoietic progenitors, monocytes (weakly) and also on acute lymphocytic leukemia.
Clone number:
124-1D1
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 4 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (0.4 ml) is sufficient for 100 tests.
CD7, also known as gp40, is a member of the immunoglobulin superfamily found on T cells, NK cells, thymocytes, hematopoietic progenitors, and monocytes (weakly). CD7 is also expressed on acute lymphocytic leukemia (ALL). CD7 crosslinking induces a calcium flux in T lymphocytes, presumably as a result of cytoplasmic domain association with PI3-kinase. CD7 co-stimulation can induce cytokine secretion and modulate cellular adhesion. A ligand of CD7, epithelial cell secreted protein K12, is produced in thymus to regulate thymocyte signaling and cytokine release. In lung microvascular endothelial cells CD7 serves as an IgM Fc receptor. Expression of CD7 is an important marker used in leukemia diagnostics.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
not available
Applications:
FC
Additional Info:
The mouse monoclonal antibody 124-1D1 recognizes an extracellular epitope of CD7, a 40 kD type I transmembrane glycoprotein expressed on peripheral blood T lymphocytes, NK-cells, hematopoietic progenitors, monocytes (weakly) and also on acute lymphocytic leukemia.
Clone number:
124-1D1
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD7, also known as gp40, is a member of the immunoglobulin superfamily found on T cells, NK cells, thymocytes, hematopoietic progenitors, and monocytes (weakly). CD7 is also expressed on acute lymphocytic leukemia (ALL). CD7 crosslinking induces a calcium flux in T lymphocytes, presumably as a result of cytoplasmic domain association with PI3-kinase. CD7 co-stimulation can induce cytokine secretion and modulate cellular adhesion. A ligand of CD7, epithelial cell secreted protein K12, is produced in thymus to regulate thymocyte signaling and cytokine release. In lung microvascular endothelial cells CD7 serves as an IgM Fc receptor. Expression of CD7 is an important marker used in leukemia diagnostics.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human acute myelogenous leukaemia cell line KG-1.
Applications:
FC
Additional Info:
The antibody MEM-186 reacts with an extracellular epitope of CD7, a 40 kD type I transmembrane glycoprotein expressed on peripheral blood T lymphocytes, NK-cells, hematopoietic progenitors, monocytes (weakly) and also on acute lymphocytic leukemia.
Clone number:
MEM-186
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD7, also known as gp40, is a member of the immunoglobulin superfamily found on T cells, NK cells, thymocytes, hematopoietic progenitors, and monocytes (weakly). CD7 is also expressed on acute lymphocytic leukemia (ALL). CD7 crosslinking induces a calcium flux in T lymphocytes, presumably as a result of cytoplasmic domain association with PI3-kinase. CD7 co-stimulation can induce cytokine secretion and modulate cellular adhesion. A ligand of CD7, epithelial cell secreted protein K12, is produced in thymus to regulate thymocyte signaling and cytokine release. In lung microvascular endothelial cells CD7 serves as an IgM Fc receptor. Expression of CD7 is an important marker used in leukemia diagnostics.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human acute myelogenous leukaemia cell line KG-1.
Applications:
FC
Additional Info:
The antibody MEM-186 reacts with an extracellular epitope of CD7, a 40 kD type I transmembrane glycoprotein expressed on peripheral blood T lymphocytes, NK-cells, hematopoietic progenitors, monocytes (weakly) and also on acute lymphocytic leukemia.
Clone number:
MEM-186
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD7, also known as gp40, is a member of the immunoglobulin superfamily found on T cells, NK cells, thymocytes, hematopoietic progenitors, and monocytes (weakly). CD7 is also expressed on acute lymphocytic leukemia (ALL). CD7 crosslinking induces a calcium flux in T lymphocytes, presumably as a result of cytoplasmic domain association with PI3-kinase. CD7 co-stimulation can induce cytokine secretion and modulate cellular adhesion. A ligand of CD7, epithelial cell secreted protein K12, is produced in thymus to regulate thymocyte signaling and cytokine release. In lung microvascular endothelial cells CD7 serves as an IgM Fc receptor. Expression of CD7 is an important marker used in leukemia diagnostics.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
not available
Applications:
FC
Additional Info:
The mouse monoclonal antibody 124-1D1 recognizes an extracellular epitope of CD7, a 40 kD type I transmembrane glycoprotein expressed on peripheral blood T lymphocytes, NK-cells, hematopoietic progenitors, monocytes (weakly) and also on acute lymphocytic leukemia.
Clone number:
124-1D1
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD69 (C-type lectin domain family 2 C, CLEC2C, also known as AIM) is one of the earliest inducible cell surface molecules acquired during leukocyte activation. This glycoprotein serves as a lectin-type receptor in lymphocytes, NK cells and platelets; it is involved in lymphocyte proliferation. CD69 expression is counteracted on T cells in the AIDS stage of HIV infection, and may be also predictive for clinical response to chemoimmunotherapy.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
anti-µ-stimulated human B lymphocytes
Applications:
FC
Additional Info:
The mouse monoclonal antibody FN50 recognizes an extracellular epitope of CD69, an lymphocyte early activation marker.
Clone number:
FN50
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD69 (C-type lectin domain family 2 C, CLEC2C, also known as AIM) is one of the earliest inducible cell surface molecules acquired during leukocyte activation. This glycoprotein serves as a lectin-type receptor in lymphocytes, NK cells and platelets; it is involved in lymphocyte proliferation. CD69 expression is counteracted on T cells in the AIDS stage of HIV infection, and may be also predictive for clinical response to chemoimmunotherapy.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
anti-µ-stimulated human B lymphocytes
Applications:
FC
Additional Info:
The mouse monoclonal antibody FN50 recognizes an extracellular epitope of CD69, an lymphocyte early activation marker.
Clone number:
FN50
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD69 (C-type lectin domain family 2 C, CLEC2C, also known as AIM) is one of the earliest inducible cell surface molecules acquired during leukocyte activation. This glycoprotein serves as a lectin-type receptor in lymphocytes, NK cells and platelets; it is involved in lymphocyte proliferation. CD69 expression is counteracted on T cells in the AIDS stage of HIV infection, and may be also predictive for clinical response to chemoimmunotherapy.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
anti-µ-stimulated human B lymphocytes
Applications:
FC
Additional Info:
The mouse monoclonal antibody FN50 recognizes an extracellular epitope of CD69, an lymphocyte early activation marker.
Clone number:
FN50
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD68 (also known as LAMP4 or SCARD1) is a 110 kDa type I transmembrane glycoprotein of the lysosomal/endosomal-associated membrane glycoprotein (LAMP) family and the scavenger receptor family. Although CD68 primarily localizes to lysosomes and endosomes, its fraction circulates to the cell surface. By the heavily glycosylated extracellular domain CD68 binds to tissue- and organ-specific lectins or selectins. It is expressed mainly in cytoplasmic granules of monocytes/macrophages, granulocytes, and dendritic cells, but also e.g. in a proportion of epithelial tumours (diagnosis of poorly differentiated neoplasms).
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Lysosomal contents of lung macrophages
Applications:
FC
Additional Info:
The mouse monoclonal antibody Y1/82A recognizes CD68 (LAMP4), a 110 kDa glycoprotein expressed mainly in cytoplasmic granules of monocytes/macrophages, granulocytes, and dendritic cells.
Clone number:
Y1/82A
Antibody Isotype:
IgG2b
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests. Extracellular and intracellular staining.
CD68 (also known as LAMP4 or SCARD1) is a 110 kDa type I transmembrane glycoprotein of the lysosomal/endosomal-associated membrane glycoprotein (LAMP) family and the scavenger receptor family. Although CD68 primarily localizes to lysosomes and endosomes, its fraction circulates to the cell surface. By the heavily glycosylated extracellular domain CD68 binds to tissue- and organ-specific lectins or selectins. It is expressed mainly in cytoplasmic granules of monocytes/macrophages, granulocytes, and dendritic cells, but also e.g. in a proportion of epithelial tumours (diagnosis of poorly differentiated neoplasms).
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Lysosomal contents of lung macrophages
Applications:
FC
Additional Info:
The mouse monoclonal antibody Y1/82A recognizes CD68 (LAMP4), a 110 kDa glycoprotein expressed mainly in cytoplasmic granules of monocytes/macrophages, granulocytes, and dendritic cells.
Clone number:
Y1/82A
Antibody Isotype:
IgG2b
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests. Extracellular and intracellular staining.
The CD66e (CEA; 180-200 kDa) is a member of carcinoembryonic antigens, immunoglobulin supergene family and consists of a single N domain (structural homology to the immunoglobulin variable) and six immunoglobulin constant-like A (A1, A2, A3) and B domains (B1, B2, B3). Human CD66e is heavily glycosylated GPI anchored protein capable of both homophilic and heterophilic adhesion. Disease relevance: The CD66e may play a role in the process of metastasis of cancer cells. CD66e is found in serum and it is clinically used as a tumor marker for early detection of disease due to its expression in adenocarcinomas - potential target of tumor imaging and drug targeting.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human carcinoembryonic antigen (CEA; CEACAM5)
Applications:
FC
Additional Info:
The mouse monoclonal antibody CB30 recognizes CD66e (CEA; 180-200 kDa), an extracellular cell surface-bound carcinoembryonic antigen mainly expressed on epithelial cells.
CD66c is a GPI-anchored glycoprotein capable of homophilic adhesion and heterophilic binding to CD66a-e, CD62E, and galectins. It is expressed on granulocytes and epithelial cells, and has potential applications in the detection of sites of infection and inflammation.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Extracts from human breast carcinoma cells
Applications:
FC
Clone number:
B6.2
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD65 is a fucosylated carbohydrate antigen (ceramide-dodecasaccharide, type II fucoganglioside), which serves as a ligand for CD62E (E-selectin). Its structure is Gal beta1-4 GlcNAc beta1-3 Gal beta1-4 GlcNAc (3-1 Fuc alpha) beta1-3 ceramide. Unlike CD65s, the CD65 antigen does not contain terminal sialic acid, the rest of their structure is identical. CD65 is expressed on granulocytes and monocytes and participates in cell adhesion. It has been reported as important for extravascular infiltration of acute monocytic leukemia cells.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
THP-1 cell line
Applications:
FC
Clone number:
VIM8
Antibody Isotype:
IgM
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD64 (FcgammaRI) is a cell surface receptor for Fc region of IgG. It is composed of specific ligand binding alpha subunit and promiscuous gamma subunit, which is indispensable for tyrosine-based signaling. However, even the alpha subunit can transduce signals leading to cellular effector functions. The isoform FcgammaRIa1 binds human IgG with high affinity, has limited myeloid cell distribution, and a relatively large intracellular domain. Products of related genes include FcgammaRIb and FcgammaRIc isoforms, but these specify low affinity IgG receptors if functionally expressed at all. Besides a role in antigen clearance, FcgammaRI (a1) can potently enhance MHC class I and II antigen presentation in vitro and in vivo.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Rheumatoid synovial fluid cells and fibronectin purified human monocytes
Applications:
FC
Additional Info:
The mouse monoclonal antibody 10.1 recognizes an extracellular epitope on CD64/FcgammaRI, a 72 kDa single chain type I glycoprotein, that is expressed on monocytes/macrophages, dendritic cells, and activated granulocytes.
Clone number:
10.1
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD64 (FcgammaRI) is a cell surface receptor for Fc region of IgG. It is composed of specific ligand binding alpha subunit and promiscuous gamma subunit, which is indispensable for tyrosine-based signaling. However, even the alpha subunit can transduce signals leading to cellular effector functions. The isoform FcgammaRIa1 binds human IgG with high affinity, has limited myeloid cell distribution, and a relatively large intracellular domain. Products of related genes include FcgammaRIb and FcgammaRIc isoforms, but these specify low affinity IgG receptors if functionally expressed at all. Besides a role in antigen clearance, FcgammaRI (a1) can potently enhance MHC class I and II antigen presentation in vitro and in vivo.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Rheumatoid synovial fluid cells and fibronectin purified human monocytes
Applications:
FC
Additional Info:
The mouse monoclonal antibody 10.1 recognizes an extracellular epitope on CD64/FcgammaRI, a 72 kDa single chain type I glycoprotein, that is expressed on monocytes/macrophages, dendritic cells, and activated granulocytes.
Clone number:
10.1
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD63 (LAMP-3, lysosome-associated membrane protein-3), a glycoprotein of tetraspanin family, is present in late endosomes, lysosomes and secretory vesicles of various cell types. It is also present in the plasma membrane, usually following cell activation. Hence, it has become an widely used basophil activation marker. In mast cells, however, CD63 exposition does not need their activation. CD63 interacts with integrins and affects phagocytosis and cell migration, it is also involved in H/K-ATPase trafficking regulation of ROMK1 channels. CD63 also serves as a T-cell costimulation molecule. Expression of CD63 can be used for predicting the prognosis in earlier stages of carcinomas.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
HPB-ALL T cell line
Applications:
FC
Additional Info:
The antibody MEM-259 reacts with an extracellular/luminal epitope of CD63 (LAMP-3), a 40-60 kDa tetraspan glycoprotein expressed by granulocytes, platelets, T cells, monocytes/macrophages and endothelial cells. Cell surface exposition of CD63 is usually activation-dependent.
Clone number:
MEM-259
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD63 (LAMP-3, lysosome-associated membrane protein-3), a glycoprotein of tetraspanin family, is present in late endosomes, lysosomes and secretory vesicles of various cell types. It is also present in the plasma membrane, usually following cell activation. Hence, it has become an widely used basophil activation marker. In mast cells, however, CD63 exposition does not need their activation. CD63 interacts with integrins and affects phagocytosis and cell migration, it is also involved in H/K-ATPase trafficking regulation of ROMK1 channels. CD63 also serves as a T-cell costimulation molecule. Expression of CD63 can be used for predicting the prognosis in earlier stages of carcinomas.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
HPB-ALL T cell line
Applications:
FC
Additional Info:
The antibody MEM-259 reacts with an extracellular/luminal epitope of CD63 (LAMP-3), a 40-60 kDa tetraspan glycoprotein expressed by granulocytes, platelets, T cells, monocytes/macrophages and endothelial cells. Cell surface exposition of CD63 is usually activation-dependent.
Clone number:
MEM-259
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD63 (LAMP-3, lysosome-associated membrane protein-3), a glycoprotein of tetraspanin family, is present in late endosomes, lysosomes and secretory vesicles of various cell types. It is also present in the plasma membrane, usually following cell activation. Hence, it has become an widely used basophil activation marker. In mast cells, however, CD63 exposition does not need their activation. CD63 interacts with integrins and affects phagocytosis and cell migration, it is also involved in H/K-ATPase trafficking regulation of ROMK1 channels. CD63 also serves as a T-cell costimulation molecule. Expression of CD63 can be used for predicting the prognosis in earlier stages of carcinomas.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
HPB-ALL T cell line
Applications:
FC
Additional Info:
The antibody MEM-259 reacts with an extracellular/luminal epitope of CD63 (LAMP-3), a 40-60 kDa tetraspan glycoprotein expressed by granulocytes, platelets, T cells, monocytes/macrophages and endothelial cells. Cell surface exposition of CD63 is usually activation-dependent.
Clone number:
MEM-259
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD62P (P-selectin) is an adhesion glycoprotein that is expressed on platelets and endothelial cells upon their activation. Interaction between CD62P and its mucin-like ligand PSGL-1 (P-selectin glycoprotein ligand-1) expressed on the microvilli of most leukocytes supports leukocyte rolling along postkapillary venules at the earliest time of inflammation. Both CD62P and PSGL-1 are extended glycoproteins that form homodimers. CD62P dimerization is probably mediated through interactions of the transmembrane domains and stabilizes leukocyte tethering and rolling, probably by increasing rebinding within a bond cluster.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human platelets
Applications:
FC
Additional Info:
The antibody AK4 recognizes an extracellular epitope of CD62P (P-selectin), a 140 kD single chain type I transmembrane glycoprotein present in secretory alpha-granules in platelets, in Weibel-Palade bodies in endothelial cells and in megakaryocytes; it is relocated to the plasma membrane upon activation.
Clone number:
AK4
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD62P (P-selectin) is an adhesion glycoprotein that is expressed on platelets and endothelial cells upon their activation. Interaction between CD62P and its mucin-like ligand PSGL-1 (P-selectin glycoprotein ligand-1) expressed on the microvilli of most leukocytes supports leukocyte rolling along postkapillary venules at the earliest time of inflammation. Both CD62P and PSGL-1 are extended glycoproteins that form homodimers. CD62P dimerization is probably mediated through interactions of the transmembrane domains and stabilizes leukocyte tethering and rolling, probably by increasing rebinding within a bond cluster.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human platelets
Applications:
FC
Additional Info:
The antibody AK4 recognizes an extracellular epitope of CD62P (P-selectin), a 140 kD single chain type I transmembrane glycoprotein present in secretory alpha-granules in platelets, in Weibel-Palade bodies in endothelial cells and in megakaryocytes; it is relocated to the plasma membrane upon activation.
Clone number:
AK4
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD62L (L-selectin) is an adhesion glycoprotein that is constitutively expressed on the cell surface of leukocytes and mediates their homing to inflammatory sites and peripheral lymph nodes by enabling rolling along the venular wall. CD62L is also involved in activation-induced neutrophil aggregation. Activation-dependent CD62L shedding, however, counteracts neutrophil rolling. CD62L has also signaling roles including enhance of chemokine receptor expression. Similarly to CD62P, the major ligand of CD62L is PSGL-1 (P-selectin glycoprotein ligand-1).
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Peripheral blood leukocytes
Applications:
FC
Additional Info:
The antibody LT-TD180 reacts with an extracellular epitope of CD62L (L-selectin), a 74-95 kDa single chain type I glycoprotein expressed on most peripheral blood B lymphocytes, T lymphocytes, monocytes and granulocytes; it is also present on a subset of NK cells and certain hematopoietic malignant cells.
Clone number:
LT-TD180
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD62L (L-selectin) is an adhesion glycoprotein that is constitutively expressed on the cell surface of leukocytes and mediates their homing to inflammatory sites and peripheral lymph nodes by enabling rolling along the venular wall. CD62L is also involved in activation-induced neutrophil aggregation. Activation-dependent CD62L shedding, however, counteracts neutrophil rolling. CD62L has also signaling roles including enhance of chemokine receptor expression. Similarly to CD62P, the major ligand of CD62L is PSGL-1 (P-selectin glycoprotein ligand-1).
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Peripheral blood leukocytes
Applications:
FC
Additional Info:
The antibody LT-TD180 reacts with an extracellular epitope of CD62L (L-selectin), a 74-95 kDa single chain type I glycoprotein expressed on most peripheral blood B lymphocytes, T lymphocytes, monocytes and granulocytes; it is also present on a subset of NK cells and certain hematopoietic malignant cells.
Clone number:
LT-TD180
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD61 (beta3 integrin) is a transmembrane glycoprotein, which associates with CD41 or CD51 molecules to form heterodimeric adhesion receptores. CD41/CD61 complex is one of the earliest markers of the megakaryocytic lineage. It binds to fibronectin, fibrinogen and von Willebrand factor, and is involved in platelet aggregation. CD51/CD61 complex has similar binding properties and is involved in modulating migration and survival of angiogenic endothelial cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Applications:
FC
Additional Info:
The mouse monoclonal antibody VIPL2 recognizes an extracellular epitope of CD61, a 90-110 kDa transmembrane glycoprotein of integrin family, expressed on platelets, megacaryocytes, osteoclasts, endothelial cells and other cell types, including leucocytes and smooth muscle cells.
Clone number:
VIPL2
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD61 (beta3 integrin) is a transmembrane glycoprotein, which associates with CD41 or CD51 molecules to form heterodimeric adhesion receptores. CD41/CD61 complex is one of the earliest markers of the megakaryocytic lineage. It binds to fibronectin, fibrinogen and von Willebrand factor, and is involved in platelet aggregation. CD51/CD61 complex has similar binding properties and is involved in modulating migration and survival of angiogenic endothelial cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Applications:
FC
Additional Info:
The mouse monoclonal antibody VIPL2 recognizes an extracellular epitope of CD61, a 90-110 kDa transmembrane glycoprotein of integrin family, expressed on platelets, megacaryocytes, osteoclasts, endothelial cells and other cell types, including leucocytes and smooth muscle cells.
Clone number:
VIPL2
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD61 (beta3 integrin) is a transmembrane glycoprotein, which associates with CD41 or CD51 molecules to form heterodimeric adhesion receptores. CD41/CD61 complex is one of the earliest markers of the megakaryocytic lineage. It binds to fibronectin, fibrinogen and von Willebrand factor, and is involved in platelet aggregation. CD51/CD61 complex has similar binding properties and is involved in modulating migration and survival of angiogenic endothelial cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Applications:
FC
Additional Info:
The mouse monoclonal antibody VIPL2 recognizes an extracellular epitope of CD61, a 90-110 kDa transmembrane glycoprotein of integrin family, expressed on platelets, megacaryocytes, osteoclasts, endothelial cells and other cell types, including leucocytes and smooth muscle cells.
Clone number:
VIPL2
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD6, also known as T12, is a member of the scavenger receptor superfamily found on T and B cell subsets, thymocytes, and acute lymphocytic leukemia cells (ALL). CD6 interacts with its ligand CD166/ALCAM (activated leukocyte cell adhesion molecule) and serves as a coreceptor for T cell activation and stabilizer of the immunological synapse. CD6-ALCAM mediated cell adhesion is also important for T cell proliferation. CD6 may exert some its functions via association with CD5, probably by fine-tuning CD5 signaling. Ligation of CD6 has antiapoptotic role in chronic lymphocytic leukemia B cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human CD6 antigen purified by immunoaffinity chromatography from HBP-ALL cells followed by preparative SDS-PAGE of non-boiled non-reduced sample (excised piece of gel corresponding to the 100 kDa zone).
Applications:
FC
Additional Info:
The antibody MEM-98 reacts with an extracellular epitope of CD6, a 100-130 kDa single chain transmembrane glycoprotein expressed on T and B lymphocytes subsets, thymocytes, and acute lymphocytic leukemia cells.
Clone number:
MEM-98
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD59 (protectin) is a small (18-20 kDa) GPI-anchored ubiquitously expressed inhibitor of the membrane attack complex (MAC). It is thus the key regulator that preserves the autologous cells from terminal effector mechanism of the complement cascade. CD59 associates with C5b-8 complex and thereby counteracts appropriate formation of cytolytic pore within the plasma membrane. CD59 is also an low-affinity ligand of human CD2 and causes T cell costimulation.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Thymocytes and T lymphocytes
Applications:
FC
Additional Info:
The antibody MEM-43 reacts with well defined epitope (W40, R-53) on CD59 (Protectin), an 18-20 kDa glycosylphosphatidylinositol (GPI)-anchored glycoprotein expressed on the surface of all hematopoietic cells; it is widely present on cells in all tissues. This antibody does not compete with MEM-43/5.
Clone number:
MEM-43
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD59 (protectin) is a small (18-20 kDa) GPI-anchored ubiquitously expressed inhibitor of the membrane attack complex (MAC). It is thus the key regulator that preserves the autologous cells from terminal effector mechanism of the complement cascade. CD59 associates with C5b-8 complex and thereby counteracts appropriate formation of cytolytic pore within the plasma membrane. CD59 is also an low-affinity ligand of human CD2 and causes T cell costimulation.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Thymocytes and T lymphocytes
Applications:
FC
Additional Info:
The antibody MEM-43 reacts with well defined epitope (W40, R-53) on CD59 (Protectin), an 18-20 kDa glycosylphosphatidylinositol (GPI)-anchored glycoprotein expressed on the surface of all hematopoietic cells; it is widely present on cells in all tissues. This antibody does not compete with MEM-43/5.
Clone number:
MEM-43
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD58 (LFA-3) is an immunoglobulin family adhession molecule expressed by both hematopoietic and non-hematopoietic cells (often on antigen presenting cells) and serving as ligand of CD2. This interaction is important for T cell-mediated immunity. CD58 is expressed in transmembrane form and in GPI-anchored form; the later is constitutively associated with protein kinases whereas the transmembrane form activates kinase activity upon triggering. CD58 is a powerful tool for detection of minimal residual disease in acute lymphocytic leukemia, and for evaluation of liver damage related with hepatitis B.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
NALM-6 human pre-B cell line
Applications:
FC
Additional Info:
The antibody MEM-63 reacts with CD58 (LFA-3), a 40-70 kDa extracellular membrane glycoprotein distributed over many tissues, leukocytes, erythrocytes, endothelial cells, epithelial cells and fibroblasts.
Clone number:
MEM-63
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD58 (LFA-3) is an immunoglobulin family adhession molecule expressed by both hematopoietic and non-hematopoietic cells (often on antigen presenting cells) and serving as ligand of CD2. This interaction is important for T cell-mediated immunity. CD58 is expressed in transmembrane form and in GPI-anchored form; the later is constitutively associated with protein kinases whereas the transmembrane form activates kinase activity upon triggering. CD58 is a powerful tool for detection of minimal residual disease in acute lymphocytic leukemia, and for evaluation of liver damage related with hepatitis B.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
NALM-6 human pre-B cell line
Applications:
FC
Additional Info:
The antibody MEM-63 reacts with CD58 (LFA-3), a 40-70 kDa extracellular membrane glycoprotein distributed over many tissues, leukocytes, erythrocytes, endothelial cells, epithelial cells and fibroblasts.
Clone number:
MEM-63
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD57, also known as HNK1 or Leu7, is a sulphated trisaccharide (3-O-sulfoglucuronic acid beta1-3 Gal beta1-4 GlcNAc) attached to several glycoproteins, including CD56, myelin glycoprotein PO, and neural cell adhesion molecule L1, as well as on glycolipids and chondroitin sulphate proteoglycans in the nervous system. It serves as a NK cell marker and it is expressed on well differentiated prostate cancers and uveal and cutaneous melanoma. CD57+ T cells are implicated as suppressors of T-cell responses.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
A pool of neuroblastoma cell lines
Applications:
FC
Additional Info:
The mouse monoclonal antibody TB01 recognizes CD57, a carbohydrate extracellular antigen present mainly on NK cells, NK T cells, and in neural tissue.
Clone number:
TB01
Antibody Isotype:
IgM
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD57, also known as HNK1 or Leu7, is a sulphated trisaccharide (3-O-sulfoglucuronic acid beta1-3 Gal beta1-4 GlcNAc) attached to several glycoproteins, including CD56, myelin glycoprotein PO, and neural cell adhesion molecule L1, as well as on glycolipids and chondroitin sulphate proteoglycans in the nervous system. It serves as a NK cell marker and it is expressed on well differentiated prostate cancers and uveal and cutaneous melanoma. CD57+ T cells are implicated as suppressors of T-cell responses.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
A pool of neuroblastoma cell lines
Applications:
FC
Additional Info:
The mouse monoclonal antibody TB01 recognizes CD57, a carbohydrate extracellular antigen present mainly on NK cells, NK T cells, and in neural tissue.
Clone number:
TB01
Antibody Isotype:
IgM
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD56 (NCAM, neural cell adhesion molecule) is a transmembrane glycoprotein of immunoglobulin family serving as adhesive molecule which is ubiquitously expressed in nervous system, usually as 120 kDa, 140 kDa or 180 kDa isoform, and it is also found on T cells and NK cells. Polysialic modification results in reduction of CD56-mediated cell adhesion and is involved in cell migration, axonal growth, pathfinding and synaptic plasticity. CD56 is a widely used neuroendocrine marker with a high sensitivity for neuroendocrine tumours and ovarian granulosa cell tumours.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Cell line KG1a
Applications:
FC
Additional Info:
The mouse monoclonal antibody LT56 recognizes an extracellular epitope of CD56 (NCAM), a transmembrane glycoprotein expressed ubiquitously in the nervous system and found also on T cells and NK cells.
Clone number:
LT56
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD56 (NCAM, neural cell adhesion molecule) is a transmembrane glycoprotein of immunoglobulin family serving as adhesive molecule which is ubiquitously expressed in nervous system, usually as 120 kDa, 140 kDa or 180 kDa isoform, and it is also found on T cells and NK cells. Polysialic modification results in reduction of CD56-mediated cell adhesion and is involved in cell migration, axonal growth, pathfinding and synaptic plasticity. CD56 is a widely used neuroendocrine marker with a high sensitivity for neuroendocrine tumours and ovarian granulosa cell tumours.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
KG-1 human acute myelogenous leukemia cell line
Applications:
FC
Additional Info:
The antibody MEM-188 reacts with an extracellular epitope on a 180 kDa isoform of CD56 (NCAM) expressed in leukocytes. It has been suggested that the antibody MEM-188 could react with rhesus monkey lymphocytes. Reactivity with other NCAM isoforms has not been tested.
Clone number:
MEM-188
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD56 (NCAM, neural cell adhesion molecule) is a transmembrane glycoprotein of immunoglobulin family serving as adhesive molecule which is ubiquitously expressed in nervous system, usually as 120 kDa, 140 kDa or 180 kDa isoform, and it is also found on T cells and NK cells. Polysialic modification results in reduction of CD56-mediated cell adhesion and is involved in cell migration, axonal growth, pathfinding and synaptic plasticity. CD56 is a widely used neuroendocrine marker with a high sensitivity for neuroendocrine tumours and ovarian granulosa cell tumours.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Cell line KG1a
Applications:
FC
Additional Info:
The mouse monoclonal antibody LT56 recognizes an extracellular epitope of CD56 (NCAM), a transmembrane glycoprotein expressed ubiquitously in the nervous system and found also on T cells and NK cells.
Clone number:
LT56
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD56 (NCAM, neural cell adhesion molecule) is a transmembrane glycoprotein of immunoglobulin family serving as adhesive molecule which is ubiquitously expressed in nervous system, usually as 120 kDa, 140 kDa or 180 kDa isoform, and it is also found on T cells and NK cells. Polysialic modification results in reduction of CD56-mediated cell adhesion and is involved in cell migration, axonal growth, pathfinding and synaptic plasticity. CD56 is a widely used neuroendocrine marker with a high sensitivity for neuroendocrine tumours and ovarian granulosa cell tumours.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
KG-1 human acute myelogenous leukemia cell line
Applications:
FC
Additional Info:
The antibody MEM-188 reacts with an extracellular epitope on a 180 kDa isoform of CD56 (NCAM) expressed in leukocytes. It has been suggested that the antibody MEM-188 could react with rhesus monkey lymphocytes. Reactivity with other NCAM isoforms has not been tested.
Clone number:
MEM-188
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD56 (NCAM, neural cell adhesion molecule) is a transmembrane glycoprotein of immunoglobulin family serving as adhesive molecule which is ubiquitously expressed in nervous system, usually as 120 kDa, 140 kDa or 180 kDa isoform, and it is also found on T cells and NK cells. Polysialic modification results in reduction of CD56-mediated cell adhesion and is involved in cell migration, axonal growth, pathfinding and synaptic plasticity. CD56 is a widely used neuroendocrine marker with a high sensitivity for neuroendocrine tumours and ovarian granulosa cell tumours.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Cell line KG1a
Applications:
FC
Additional Info:
The mouse monoclonal antibody LT56 recognizes an extracellular epitope of CD56 (NCAM), a transmembrane glycoprotein expressed ubiquitously in the nervous system and found also on T cells and NK cells.
Clone number:
LT56
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD56 (NCAM, neural cell adhesion molecule) is a transmembrane glycoprotein of immunoglobulin family serving as adhesive molecule which is ubiquitously expressed in nervous system, usually as 120 kDa, 140 kDa or 180 kDa isoform, and it is also found on T cells and NK cells. Polysialic modification results in reduction of CD56-mediated cell adhesion and is involved in cell migration, axonal growth, pathfinding and synaptic plasticity. CD56 is a widely used neuroendocrine marker with a high sensitivity for neuroendocrine tumours and ovarian granulosa cell tumours.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
KG-1 human acute myelogenous leukemia cell line
Applications:
FC
Additional Info:
The antibody MEM-188 reacts with an extracellular epitope on a 180 kDa isoform of CD56 (NCAM) expressed in leukocytes. It has been suggested that the antibody MEM-188 could react with rhesus monkey lymphocytes. Reactivity with other NCAM isoforms has not been tested.
Clone number:
MEM-188
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD55 (decay-accelerating factor, DAF) is a GPI-anchored membrane glycoprotein that protects autologous cells from classical and alternative pathway of complement cascade. Bidirectional interactions between CD55 and CD97 are involved in T cell regulation and CD55 can still regulate complement when bound to CD97. In tumours, besides protection agains complement, CD55 promotes neoangiogenesis, tumorigenesis, invasiveness and evasion of apoptosis.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
HPB-ALL human T cell line
Applications:
FC
Additional Info:
The antibody MEM-118 recognizes an epitope in SCR4 domain of CD55 (Decay accelerating factor, DAF), a 60-70 kDa glycosylphosphatidylinositol (GPI)-anchored single chain extracellular glycoprotein. CD55 is widely expressed on hematopoietic and on many non-hematopoietic cells; it is weakly present on NK cells.
Clone number:
MEM-118
Antibody Isotype:
IgM
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD54 (ICAM-1) is a 90 kD member of the C2 subset of immunoglobulin superfamily. It is a transmembrane molecule with 7 potential N-glycosylated sites, expressed on resting monocytes and endothelial cells and can be upregulated on many other cells, e.g. with lymphokines, on B- and T-lymphocytes, thymocytes, dendritic cells and also on keratinocytes, chondrocytes, as well as epithelial cells. CD54 mediates cell adhesion by binding to integrins CD11a/CD18 (LFA-1) and to CD11b/CD18 (Mac-1). The interaction of CD54 with LFA-1 enhances antigen-specific T-cell activation.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Raji cells and spleen cells fused with NS1 cells
Applications:
FC
Additional Info:
The antibody 1H4 recognizes an extracellular epitope of CD54 (ICAM-1), a 85-110 kDa type I transmembrane glycoprotein (receptor for rhinovirus) expressed on activated endothelial cells, T lymphocytes, B lymphocytes, monocytes, macrophages, granulocytes and dendritic cells; the expression of CD54 is upregulated by activation.
Clone number:
1H4
Antibody Isotype:
IgG2b
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD54 (ICAM-1) is a 90 kD member of the C2 subset of immunoglobulin superfamily. It is a transmembrane molecule with 7 potential N-glycosylated sites, expressed on resting monocytes and endothelial cells and can be upregulated on many other cells, e.g. with lymphokines, on B- and T-lymphocytes, thymocytes, dendritic cells and also on keratinocytes, chondrocytes, as well as epithelial cells. CD54 mediates cell adhesion by binding to integrins CD11a/CD18 (LFA-1) and to CD11b/CD18 (Mac-1). The interaction of CD54 with LFA-1 enhances antigen-specific T-cell activation.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Raji cells and spleen cells fused with NS1 cells
Applications:
FC
Additional Info:
The antibody 1H4 recognizes an extracellular epitope of CD54 (ICAM-1), a 85-110 kDa type I transmembrane glycoprotein (receptor for rhinovirus) expressed on activated endothelial cells, T lymphocytes, B lymphocytes, monocytes, macrophages, granulocytes and dendritic cells; the expression of CD54 is upregulated by activation.
Clone number:
1H4
Antibody Isotype:
IgG2b
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD54 (ICAM-1) is a 90 kD member of the C2 subset of immunoglobulin superfamily. It is a transmembrane molecule with 7 potential N-glycosylated sites, expressed on resting monocytes and endothelial cells and can be upregulated on many other cells, e.g. with lymphokines, on B- and T-lymphocytes, thymocytes, dendritic cells and also on keratinocytes, chondrocytes, as well as epithelial cells. CD54 mediates cell adhesion by binding to integrins CD11a/CD18 (LFA-1) and to CD11b/CD18 (Mac-1). The interaction of CD54 with LFA-1 enhances antigen-specific T-cell activation.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Raji human Burkitt's lymphoma cell line
Applications:
FC
Additional Info:
The antibody MEM-111 reacts with an extracellular epitope of CD54 (ICAM-1), a 85-110 kDa type I transmembrane glycoprotein (receptor for rhinovirus). The expression of CD54 is upregulated by activation; it is expressed on activated endothelial cells, T lymphocytes, B lymphocytes, monocytes, macrophages, granulocytes and dendritic cells.
Clone number:
MEM-111
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD54 (ICAM-1) is a 90 kD member of the C2 subset of immunoglobulin superfamily. It is a transmembrane molecule with 7 potential N-glycosylated sites, expressed on resting monocytes and endothelial cells and can be upregulated on many other cells, e.g. with lymphokines, on B- and T-lymphocytes, thymocytes, dendritic cells and also on keratinocytes, chondrocytes, as well as epithelial cells. CD54 mediates cell adhesion by binding to integrins CD11a/CD18 (LFA-1) and to CD11b/CD18 (Mac-1). The interaction of CD54 with LFA-1 enhances antigen-specific T-cell activation.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Raji cells and spleen cells fused with NS1 cells
Applications:
FC
Additional Info:
The antibody 1H4 recognizes an extracellular epitope of CD54 (ICAM-1), a 85-110 kDa type I transmembrane glycoprotein (receptor for rhinovirus) expressed on activated endothelial cells, T lymphocytes, B lymphocytes, monocytes, macrophages, granulocytes and dendritic cells; the expression of CD54 is upregulated by activation.
Clone number:
1H4
Antibody Isotype:
IgG2b
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD53 is a tetraspanin family transmembrane glycoprotein expressed in the lymphoid-myeloid lineage. This molecule has been reported to form complexes with other leukocyte surface proteins such as CD2, CD19, CD21, MHC II, VLA-4 or tetraspanins CD37, CD81 and CD82, thus probably modulating various signaling processes. CD53 is involved in radioresistancy of tumour cells and its triggering has anti-apoptotic effect. In thymus, CD53 is up-regulated in response to positive selection signals during T cell development, and is strongly expressed upon macrophage exposure to bacterial lipopolysaccharide, whereas stimulation of neutrophils results in down-regulation of CD53 expression.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Leukocytes of pacient suffering from a LGL-type leukemia.
Applications:
FC
Additional Info:
The antibody MEM-53 reacts with an extracellular epitope of CD53, a 32-40 kDa tetraspanin family glycoprotein exclusivelly expressed on leukocytes; it is not present on platelets, red blood cells and non-hematopoietic cells.
The antibody MEM-53 reacts also with deglycosylated molecule (molecular weight of the antigen is reduced by 15 kDa using endoglycosidase F).
Clone number:
MEM-53
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD52 (CAMPATH-1, HE5) is a highly glycosylated GPI-anchored 21-28 kDa glycopeptide which is present at high levels on lymphocytes, macrophages, epithelial cells of male reproductive tract and mature sperm. Its 12-amino acid beckbone carries a complex N-linked carbohydrate moiety, which differs between sperm and leukocyte CD52, as well as the GPI anchor does. CD52 can be acquired by sperm cells from seminal plasma, where it is released by epithelial cells. Although CD52 is not an essential T-cell costimulator, its triggering results in activation of normal human T cells. CD52 is a very good target for antibody/complement-mediated cell lysis.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human tonsil
Applications:
FC
Additional Info:
The antibody HI186 reacts with CD52 (CAMPATH-1), a 21-28 kDa extracellular glycoprotein containing a large N-linked carbohydrate moiety; mature CD52 molecule is actually much smaller (approx. 8-9 kDa). CD52 is expressed at high levels on lymphocytes, monocytes/macrophages and in male reproductive tract.
Clone number:
HI186
Antibody Isotype:
IgG2b
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD52 (CAMPATH-1, HE5) is a highly glycosylated GPI-anchored 21-28 kDa glycopeptide which is present at high levels on lymphocytes, macrophages, epithelial cells of male reproductive tract and mature sperm. Its 12-amino acid beckbone carries a complex N-linked carbohydrate moiety, which differs between sperm and leukocyte CD52, as well as the GPI anchor does. CD52 can be acquired by sperm cells from seminal plasma, where it is released by epithelial cells. Although CD52 is not an essential T-cell costimulator, its triggering results in activation of normal human T cells. CD52 is a very good target for antibody/complement-mediated cell lysis.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human lymphocytes
Applications:
FC
Clone number:
4C8
Antibody Isotype:
IgG3
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD52 (CAMPATH-1, HE5) is a highly glycosylated GPI-anchored 21-28 kDa glycopeptide which is present at high levels on lymphocytes, macrophages, epithelial cells of male reproductive tract and mature sperm. Its 12-amino acid beckbone carries a complex N-linked carbohydrate moiety, which differs between sperm and leukocyte CD52, as well as the GPI anchor does. CD52 can be acquired by sperm cells from seminal plasma, where it is released by epithelial cells. Although CD52 is not an essential T-cell costimulator, its triggering results in activation of normal human T cells. CD52 is a very good target for antibody/complement-mediated cell lysis.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human tonsil
Applications:
FC
Additional Info:
The antibody HI186 reacts with CD52 (CAMPATH-1), a 21-28 kDa extracellular glycoprotein containing a large N-linked carbohydrate moiety; mature CD52 molecule is actually much smaller (approx. 8-9 kDa). CD52 is expressed at high levels on lymphocytes, monocytes/macrophages and in male reproductive tract.
Clone number:
HI186
Antibody Isotype:
IgG2b
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD52 (CAMPATH-1, HE5) is a highly glycosylated GPI-anchored 21-28 kDa glycopeptide which is present at high levels on lymphocytes, macrophages, epithelial cells of male reproductive tract and mature sperm. Its 12-amino acid beckbone carries a complex N-linked carbohydrate moiety, which differs between sperm and leukocyte CD52, as well as the GPI anchor does. CD52 can be acquired by sperm cells from seminal plasma, where it is released by epithelial cells. Although CD52 is not an essential T-cell costimulator, its triggering results in activation of normal human T cells. CD52 is a very good target for antibody/complement-mediated cell lysis.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human lymphocytes
Applications:
FC
Clone number:
4C8
Antibody Isotype:
IgG3
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD51/CD61 (integrin alpha5beta3), also known as osteoclast functional antigen, serves as a vitronectin receptor, and binds also to fibronectin, fibrinogen, thrombospondin, osteopontin, collagen, and von Willebrand factor. Expression of this antigen increases with melanoma progression. In healthy individuals CD51/CD61 is expressed mainly on osteoclasts, placenta, and endothelial cells, at lower levels on platelets and macrophages.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
A cell suspension containing osteoclasts from osteoclastomas
Applications:
FC
Clone number:
23C6
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
PRR7/TRAP3 (proline-rich 7, transmembrane adaptor protein 3) is a 28 kDa transmembrane adaptor protein ubiquitously expressed at low level (most in brain). Its amino acid sequence is extremely conserved among mammalian and other species. PRR7/TRAP3 contains potential palmitoylation motif and is found in lipid rafts. It is a part of the complex postsynaptic density fraction in neurons and associates with PSD-95, NMDA receptor and probably other proteins. The intracellular domain of PRR7/TRAP3 contains several tyrosines, a proline-rich sequence, and a C-terminal PDZ-binding motif. So far nothing is known about function of this protein. It may be involved in regulation of some receptor signaling and in formation of neurologic and immunologic synapse.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Do not freeze.
Immunogen:
Recombinant C-terminal half of the intracellular domain of human PRR7/TRAP3 (amino acids 126-253)
Applications:
WB,ICC
Additional Info:
The mouse monoclonal antibody TRAP3/10 recognizes an epitope located in the C-terminal part of the intracellular domain of PRR7/TRAP3 (amino acids 126-253 of human PRR7 / TRAP3), a 28 kDa proline-rich membrane protein presumably associated with NMDA receptor complex.
Clone number:
TRAP3/10
Antibody Isotype:
IgG2a
Application Details:
Immunocytochemistry: Recommended dilution: 10 ?g/ml; cell culture fixed with 4% paraformaldehyde, permeabilized with 0.1% Triton-X100. Western blotting: Recommended dilution: 1 ?g/ml; positive control: murine brain lysate (red. Laemmli buffer).
Perforin is a 70 kDa cytolytic protein with structural and functional similarities to complement component 9 (C9). It is stored in cytoplasmic granules of cytotoxic T cells and NK cells and after its release it forms transmembrane pores in the target cells to kill it. As perforin is a key effector molecule for cell-mediated cytolysis, defects of its gene can cause severe disorders.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
purified granules from human YT lymphoma cell line
Applications:
FC
Additional Info:
The mouse monoclonal antibody dG9 (also known as deltaG9) recognizes perforin, a 70 kDa protein expressed in cytoplasmic granules of cytotoxic T cells and NK cells.
Clone number:
dG9
Antibody Isotype:
IgG2b k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests. Intracellular staining.
PCNA (proliferating cell nuclear antigen) is the DNA polymerase delta auxiliary protein acting in homotrimeric form to increase the processivity of leading strand synthesis during DNA replication. PCNA is expressed in the nucleus of all proliferating cells. In response to DNA damage, it is ubiquitinated and is involved in the RAD6-dependent DNA repair pathway. PCNA is a useful marker of DNA synthesis, as its form not involved in DNA synthesis degradates in histological preparations in the presence of organic solvents.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
recombinant rat PCNA
Applications:
FC
Additional Info:
The mouse monoclonal antibody PC10 (also known as 3F81) recognizes PCNA, a 36 kDa conserved nuclear protein serving as a cofactor for DNA synthesis.
Clone number:
PC10
Antibody Isotype:
IgG2a k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests. Intracellular staining.
PCLO (piccolo, also known as aczonin) is a large (more than 400 kDa) multidomain protein of the presynaptic cytomatrix in neurons, that is present in all vertebrate synapses, but is absent from invertebrates. It contains zinc finger and coiled-coil sequences, as well as N-terminal glutamine-rich sequence, and C-terminal PDZ domain followed by two C2 domains (C2A and C2B). In vitro binding and transfection experiments suggested that PCLO binds to multiple proteins including profilin and L-type calcium channels. It is involved in neurotransmitter release and insulin secretion.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human recombinant PCLO protein
Applications:
FC
Additional Info:
The mouse monoclonal antibody PCLO-01 recognizes PCLO (Piccolo), a more than 400 kDa multidomain protein expressed mainly in the presynaptic cytoplasmatic matrix of the neurons.
OPAL1 (outcome predictor in acute leukemia 1) is an almost uncharacterized transmembrane adaptor protein expressed mainly by megacaryocytes and platelets. Its expression is enhanced on TEL/AML leukemic cells. The function of OPAL1 is unknown, although the presence of a cytochrome c-like heme-binding site and a transmembrane domain suggested OPAL1 may be involved in the mitochondrial electron transport chain. Its originally reported prognostic impact appears to be treatment dependent.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Recombinant fragment of human OPAL1 (amino acids 152-342)
Applications:
FC
Additional Info:
The mouse monoclonal antibody OPAL1-01 recognizes an intracellular epitope of OPAL1 (outcome predictor in acute leukemia 1), a transmembrane adaptor protein expressed mainly by megacaryocytes and platelets.
NG2 / chondroitin sulfate proteoglycan 4 is expressed on glial cell populations, but not on normal hepatopoietic cells. It is an integral membrane chondroitin sulfate proteoglycan expressed by human malignant melanoma cells, where it plays role in stabilizing cell-substratum interactions during early events of melanoma cell spreading on endothelial basement membranes, and supports signaling pathways important for tumor invasion and growth. NG2 also serves as an AML blast tumor marker associated with poor prognosis.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human bone marrow stromal cells infected with SV-40
Applications:
FC
Additional Info:
The mouse monoclonal antibody 7.1 recognizes an extracellular epitope of NG2, the melanoma-associated chondroitin sulfate proteoglycan 4 of Mw approximately 220-300 kDa.
Clone number:
7.1
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD50 (intracellular adhesion molecule 3, ICAM-3) is a transmembrane glycoprotein expressed by leukocytes, that serves as a counter-receptor for the lymphocyte function-associated antigen (LFA)-1 integrin. Besides functioning as an adhesive molecule that mediates e.g. the contact between T cells and antigen presenting cells, ICAM-3 regulates affinity of LFA-1 for ICAM-1 and induces T cell activation and proliferation. ICAM-3 plays an essential role in the initiation of the immune response both on T cells and antigen presenting cells and interacts also with CD209 (dendritic cell-specific ICAM-3-grabbing nonintegrin, DC-SIGN), a C-type lectin of dendritic cells and macrophages; this process is involved in dialogue between dendritic cells and granulocytes.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human granulocytes
Applications:
FC
Additional Info:
The antibody MEM-171 recognizes an extracellular epitope in the D2 domain of CD50 (ICAM-3), a 120-130 kDa type I membrane protein (immunoglobulin supergene family) expressed on leukocytes, endothelial cells and Langerhans cells; it is negative on platelets and erythrocytes.
Clone number:
MEM-171
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD5 antigen (T1; 67 kDa) is a human cell surface T-lymphocyte single-chain transmembrane glycoprotein. CD5 is expressed on all mature T-lymphocytes, most of thymocytes, subset of B-lymphocytes and on many T-cell leukemias and lymphomas. It is a type I membrane glycoprotein whose extracellular region contains three scavenger receptor cysteine-rich (SRCR) domains. The CD5 is a signal transducing molecule whose cytoplasmic tail is devoid of any intrinsic catalytic activity. CD5 modulates signaling through the antigen-specific receptor complex (TCR and BCR). CD5 crosslinking induces extracellular Ca++ mobilization, tyrosine phosphorylation of intracellular proteins and DAG production. Preliminary evidence shows protein associations with ZAP-70, p56lck, p59fyn, PC-PLC, etc. CD5 may serve as a dual receptor, giving either stimulatory or inhibitory signals depending both on the cell type and development stage. In thymocytes and B1a cells it seems to provide inhibitory signals, in peripheral mature T lymhocytes it acts as a costimulatory signal receptor. CD5 is the phenotypic marker of a B cell subpopulation involved in the production of autoreactive antibodies. Disease relevance: CD5 is a phenotypic marker for some B cell lymphoproliferative disorders (B-CLL, Hairy cell leukemia, etc.). The CD5+ popuation is expanded in some autoimmune disorders (rheumatoid arthritis, etc.). Herpes virus infections induce loss of CD5 expression in the expanded CD8+ human T cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human acute lymphoblastic leukemia (ALL) T cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody L17F12 reacts with an extracellular epitope of CD5, a 67kDa single-chain transmembrane glycoprotein expressed on mature T lymphocytes, most of thymocytes and B lymphocytes subset (B-1a lymphocytes).
Clone number:
L17F12
Antibody Isotype:
IgG2a k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD5 antigen (T1; 67 kDa) is a human cell surface T-lymphocyte single-chain transmembrane glycoprotein. CD5 is expressed on all mature T-lymphocytes, most of thymocytes, subset of B-lymphocytes and on many T-cell leukemias and lymphomas. It is a type I membrane glycoprotein whose extracellular region contains three scavenger receptor cysteine-rich (SRCR) domains. The CD5 is a signal transducing molecule whose cytoplasmic tail is devoid of any intrinsic catalytic activity. CD5 modulates signaling through the antigen-specific receptor complex (TCR and BCR). CD5 crosslinking induces extracellular Ca++ mobilization, tyrosine phosphorylation of intracellular proteins and DAG production. Preliminary evidence shows protein associations with ZAP-70, p56lck, p59fyn, PC-PLC, etc. CD5 may serve as a dual receptor, giving either stimulatory or inhibitory signals depending both on the cell type and development stage. In thymocytes and B1a cells it seems to provide inhibitory signals, in peripheral mature T lymhocytes it acts as a costimulatory signal receptor. CD5 is the phenotypic marker of a B cell subpopulation involved in the production of autoreactive antibodies. Disease relevance: CD5 is a phenotypic marker for some B cell lymphoproliferative disorders (B-CLL, Hairy cell leukemia, etc.). The CD5+ popuation is expanded in some autoimmune disorders (rheumatoid arthritis, etc.). Herpes virus infections induce loss of CD5 expression in the expanded CD8+ human T cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human acute lymphoblastic leukemia (ALL) T cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody L17F12 reacts with an extracellular epitope of CD5, a 67kDa single-chain transmembrane glycoprotein expressed on mature T lymphocytes, most of thymocytes and B lymphocytes subset (B-1a lymphocytes).
Clone number:
L17F12
Antibody Isotype:
IgG2a k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD5 antigen (T1; 67 kDa) is a human cell surface T-lymphocyte single-chain transmembrane glycoprotein. CD5 is expressed on all mature T-lymphocytes, most of thymocytes, subset of B-lymphocytes and on many T-cell leukemias and lymphomas. It is a type I membrane glycoprotein whose extracellular region contains three scavenger receptor cysteine-rich (SRCR) domains. The CD5 is a signal transducing molecule whose cytoplasmic tail is devoid of any intrinsic catalytic activity. CD5 modulates signaling through the antigen-specific receptor complex (TCR and BCR). CD5 crosslinking induces extracellular Ca++ mobilization, tyrosine phosphorylation of intracellular proteins and DAG production. Preliminary evidence shows protein associations with ZAP-70, p56lck, p59fyn, PC-PLC, etc. CD5 may serve as a dual receptor, giving either stimulatory or inhibitory signals depending both on the cell type and development stage. In thymocytes and B1a cells it seems to provide inhibitory signals, in peripheral mature T lymhocytes it acts as a costimulatory signal receptor. CD5 is the phenotypic marker of a B cell subpopulation involved in the production of autoreactive antibodies. Disease relevance: CD5 is a phenotypic marker for some B cell lymphoproliferative disorders (B-CLL, Hairy cell leukemia, etc.). The CD5+ popuation is expanded in some autoimmune disorders (rheumatoid arthritis, etc.). Herpes virus infections induce loss of CD5 expression in the expanded CD8+ human T cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
stimulated human leukocytes
Applications:
FC
Additional Info:
The mouse monoclonal antibody CRIS1 reacts with an extracellular epitope of CD5, a 67kDa single-chain transmembrane glycoprotein expressed on mature T lymphocytes, most of thymocytes and B lymphocytes subset (B-1a lymphocytes).
Clone number:
CRIS1
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD5 antigen (T1; 67 kDa) is a human cell surface T-lymphocyte single-chain transmembrane glycoprotein. CD5 is expressed on all mature T-lymphocytes, most of thymocytes, subset of B-lymphocytes and on many T-cell leukemias and lymphomas. It is a type I membrane glycoprotein whose extracellular region contains three scavenger receptor cysteine-rich (SRCR) domains. The CD5 is a signal transducing molecule whose cytoplasmic tail is devoid of any intrinsic catalytic activity. CD5 modulates signaling through the antigen-specific receptor complex (TCR and BCR). CD5 crosslinking induces extracellular Ca++ mobilization, tyrosine phosphorylation of intracellular proteins and DAG production. Preliminary evidence shows protein associations with ZAP-70, p56lck, p59fyn, PC-PLC, etc. CD5 may serve as a dual receptor, giving either stimulatory or inhibitory signals depending both on the cell type and development stage. In thymocytes and B1a cells it seems to provide inhibitory signals, in peripheral mature T lymhocytes it acts as a costimulatory signal receptor. CD5 is the phenotypic marker of a B cell subpopulation involved in the production of autoreactive antibodies. Disease relevance: CD5 is a phenotypic marker for some B cell lymphoproliferative disorders (B-CLL, Hairy cell leukemia, etc.). The CD5+ popuation is expanded in some autoimmune disorders (rheumatoid arthritis, etc.). Herpes virus infections induce loss of CD5 expression in the expanded CD8+ human T cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
stimulated human leukocytes
Applications:
FC
Additional Info:
The mouse monoclonal antibody CRIS1 reacts with an extracellular epitope of CD5, a 67kDa single-chain transmembrane glycoprotein expressed on mature T lymphocytes, most of thymocytes and B lymphocytes subset (B-1a lymphocytes).
Clone number:
CRIS1
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD5 antigen (T1; 67 kDa) is a human cell surface T-lymphocyte single-chain transmembrane glycoprotein. CD5 is expressed on all mature T-lymphocytes, most of thymocytes, subset of B-lymphocytes and on many T-cell leukemias and lymphomas. It is a type I membrane glycoprotein whose extracellular region contains three scavenger receptor cysteine-rich (SRCR) domains. The CD5 is a signal transducing molecule whose cytoplasmic tail is devoid of any intrinsic catalytic activity. CD5 modulates signaling through the antigen-specific receptor complex (TCR and BCR). CD5 crosslinking induces extracellular Ca++ mobilization, tyrosine phosphorylation of intracellular proteins and DAG production. Preliminary evidence shows protein associations with ZAP-70, p56lck, p59fyn, PC-PLC, etc. CD5 may serve as a dual receptor, giving either stimulatory or inhibitory signals depending both on the cell type and development stage. In thymocytes and B1a cells it seems to provide inhibitory signals, in peripheral mature T lymhocytes it acts as a costimulatory signal receptor. CD5 is the phenotypic marker of a B cell subpopulation involved in the production of autoreactive antibodies. Disease relevance: CD5 is a phenotypic marker for some B cell lymphoproliferative disorders (B-CLL, Hairy cell leukemia, etc.). The CD5+ popuation is expanded in some autoimmune disorders (rheumatoid arthritis, etc.). Herpes virus infections induce loss of CD5 expression in the expanded CD8+ human T cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human acute lymphoblastic leukemia (ALL) T cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody L17F12 reacts with an extracellular epitope of CD5, a 67kDa single-chain transmembrane glycoprotein expressed on mature T lymphocytes, most of thymocytes and B lymphocytes subset (B-1a lymphocytes).
Clone number:
L17F12
Antibody Isotype:
IgG2a k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD49d / integrin alpha 4, unlike other alpha integrins, neither contains an I-domain, nor undergoes disulfide-linked cleavage. It associates with beta 7 chain to form alpha 4 / beta 7 integrin, and with beta 1 chain (CD29) to form VLA-4 integrin. These complexes are important for lymphocyte migration from circulation into tissue (binding VCAM-1) and homing of T cell subsets to Peyer´s patches (binding MadCAM-1), but VLA-4 is also target for invasive bacteria which contain invasin. CD49d is essential for differentiation and migration of hematopoietic stem cells by their adhesion to bone marrow stromal cells, and provides a costimulatory signal to TCR-CD3 complex by inducing phosphorylation of some focal adhesion proteins.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Applications:
FC
Additional Info:
The mouse monoclonal antibody 9F10 recognizes an extracellular epitope of CD49d (alpha 4 integrin), a 145-180 kDa type I transmembrane glycoprotein expressed on B and T cells, monocytes, eosinophils, basophils, NK cells, and dendritic cells, but not platelets.
Clone number:
9F10
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD49c / Integrin alpha 3 is a type I transmembrane glycoprotein proteolytically cleaved into two disulfide linked chains. It noncovalently associates with CD29 (integrin beta 1) to form the VLA-3 complex, an adhesion receptor for extracellular matrix components (fibronectin, laminin 1, laminin 5, entactin, and collagen). It is expressed on adherent cells, mainly on fibroblasts, epithelial cells and endothelial cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human SSC-9 cell line (squamous cell carcinoma)
Applications:
FC
Additional Info:
The mouse monoclonal antibody ASC-1 recognizes an extracellular epitope of CD49c (integrin alpha 3), a transmembrane glycoprotein composed of disulfide linked 125 kDa and 30 kDa chains, and expressed on adherent cell lines and to a lesser extent on T and B cells and monocytes.
Clone number:
ASC-1
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD49b the integrin alpha 2 chain, associates with CD29 (integrin beta 1 chain) to form VLA-2 integrin complex, which plays a critical role in the processes of lymphocyte adhesion and activation. VLA-2 serves as a receptor for collagen, laminin, and fibronectin and also regulates the extracellular matrix synthesis and organization. CD49b has been used to identify NK cells, and coexpressed with CD223 (LAG-3) it identifies CD4+ T regulatory type 1 cells (Tr1).
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human platelets
Applications:
FC
Additional Info:
The mouse monoclonal antibody AK7 recognizes an extracellular epitope of CD49b, a 160-165 kDa alpha subunit of VLA-2 integrin complex expressed on platelets, megakaryocytes, activated T and B cells, monocytes, epithelial cells, endothelial cells and fibroblasts.
Clone number:
AK7
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD49a is the alpha 1 chain of VLA integrin complex (together with CD29, serving as the beta 1 chain), and is expressed on activated T cells, monocytes, NK cells, cultured neuronal cells, melanoma cells, mesenchymal cells (including smooth muscle cells), fibroblasts, hepatocytes, and microvascular endothelium. It binds to collagen IV and laminin 1. It is important for leukocyte migration into tissues. It is upregulated in inflammatory tissues, such as inflammed intestine.
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
CD48 (Blast-1) belongs to the CD2 subset of the Ig superfamily, which includes CD2, CD2F-10, CD58, CD84, CD150, CD229, CD244 and others. These molecules bind to the same or another members of their family, thus mediate homotypic or heterotypic adhesion. CD48 is a GPI-anchored protein broadly expressed on hematopoietic cells and serves as a high affinity ligand for 2B4 and low affinity ligand for CD2. 2B4-CD48 interaction among NK cells and NK-T cells regulates cell proliferation. Signaling through CD48 results in eosinophil activation and CD48 expression is increased in several infectious diseases.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Raji human Burkitt's lymphoma cell line
Applications:
FC
Additional Info:
The antibody MEM-102 reacts with CD48 (Blast-1), a 40-47 kDa GPI-anchored extracellular membrane protein (immunoglobulin supergene family) widely expressed on hematopoietic cells; it is negative on granulocytes, platelets and erythrocytes.
Clone number:
MEM-102
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD48 (Blast-1) belongs to the CD2 subset of the Ig superfamily, which includes CD2, CD2F-10, CD58, CD84, CD150, CD229, CD244 and others. These molecules bind to the same or another members of their family, thus mediate homotypic or heterotypic adhesion. CD48 is a GPI-anchored protein broadly expressed on hematopoietic cells and serves as a high affinity ligand for 2B4 and low affinity ligand for CD2. 2B4-CD48 interaction among NK cells and NK-T cells regulates cell proliferation. Signaling through CD48 results in eosinophil activation and CD48 expression is increased in several infectious diseases.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Raji human Burkitt's lymphoma cell line
Applications:
FC
Additional Info:
The antibody MEM-102 reacts with CD48 (Blast-1), a 40-47 kDa GPI-anchored extracellular membrane protein (immunoglobulin supergene family) widely expressed on hematopoietic cells; it is negative on granulocytes, platelets and erythrocytes.
Clone number:
MEM-102
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD42a, also known as glycoprotein 9 (GPIX), composes together with GPIb alpha, GPIb beta and GPV the GPIb-IX-V receptor complex critical in the process of platelet-rich thrombus formation by tethering the platelet to a thrombogenic surface. CD42b binds to von Willebrand factor (VWF) exposed at a site of vascular injury, as well as to thrombin, coagulation factors XI and XII, high molecular wight kininogen, TSP-1, integrin Mac-1 and P-selectin. Defects in the gene encoding CD42a are a cause of Bernard-Soulier syndrome, also known as giant platelet disease. These patients have unusually large platelets and have a clinical bleeding tendency.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human acute lymphoblastic leukemia cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody GR-P (also known as GRP-P) recognizes an extracellular epitope of CD42a (glycoprotein 9), a 22 kDa transmembrane protein constitutively expressed on megakaryocytes and platelets.
Clone number:
GR-P
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD41 (platelet glycoprotein IIb, integrin alpha IIb) is composed of two subunits (120 kDa transmembrane alpha chain and 23 kDa extracellular beta chain) and interacts with CD61 (platelet glycoprotein IIIa, integrin beta 3) in the presence of calcium to form a functional adhesive protein receptor. CD41/CD61 complex is one of the earliest markers of the megakaryocytic lineage. Upon blood vessel damage, this receptor binds to a variety of proteins including von Willebrand factor, fibrinogen, fibronectin and vitronectin, and it is involved in platelet aggregation.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human platelets
Applications:
FC
Clone number:
PAC-1
Antibody Isotype:
IgM k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD41 (platelet glycoprotein IIb, integrin alpha IIb) is composed of two subunits (120 kDa transmembrane alpha chain and 23 kDa extracellular beta chain) and interacts with CD61 (platelet glycoprotein IIIa, integrin beta 3) in the presence of calcium to form a functional adhesive protein receptor. CD41/CD61 complex is one of the earliest markers of the megakaryocytic lineage. Upon blood vessel damage, this receptor binds to a variety of proteins including von Willebrand factor, fibrinogen, fibronectin and vitronectin, and it is involved in platelet aggregation.
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
CD41 (platelet glycoprotein IIb, integrin alpha IIb) is composed of two subunits (120 kDa transmembrane alpha chain and 23 kDa extracellular beta chain) and interacts with CD61 (platelet glycoprotein IIIa, integrin beta 3) in the presence of calcium to form a functional adhesive protein receptor. CD41/CD61 complex is one of the earliest markers of the megakaryocytic lineage. Upon blood vessel damage, this receptor binds to a variety of proteins including von Willebrand factor, fibrinogen, fibronectin and vitronectin, and it is involved in platelet aggregation.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human platelets
Applications:
FC
Additional Info:
The mouse monoclonal antibody PAC-1 recognizes an extracellular activation-induced conformational epitope PAC-1 on CD41/CD61 complex (gpIIb/IIIa), also known as integrin alpha IIb beta 3, a receptor which mediates platelet aggregation.
Clone number:
PAC-1
Antibody Isotype:
IgM k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD41 (platelet glycoprotein IIb) is composed of two subunits (120 kDa a, alpha and 23 kDa b, beta) that interact with CD61 in the presence of calcium to form a functional adhesive protein receptor. Upon blood vessel damage, this receptor binds to a variety of proteins including von Willebrand factor, fibrinogen, fibronectin and vitronectin. CD41 is mainly expressed on megakaryocyte-platelet lineage, but generally belongs to the antigens that are expressed during early stages of hematopoietic differentiation.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Leukocytes of patient suffering from LGL-type leukaemia.
Applications:
FC
Additional Info:
The antibody MEM-06 reacts with an extracellular epitope of CD41 (GPIIb), a transmembrane glycoprotein (integrin family) composed of two chains GPIIb alpha (heavy chain; 120 kDa) and GPIIb beta (light chain; 23 kDa). CD41 is mainly expressed on platelets and megakaryocytes.
Clone number:
MEM-06
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD41 (platelet glycoprotein IIb) is composed of two subunits (120 kDa a, alpha and 23 kDa b, beta) that interact with CD61 in the presence of calcium to form a functional adhesive protein receptor. Upon blood vessel damage, this receptor binds to a variety of proteins including von Willebrand factor, fibrinogen, fibronectin and vitronectin. CD41 is mainly expressed on megakaryocyte-platelet lineage, but generally belongs to the antigens that are expressed during early stages of hematopoietic differentiation.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Leukocytes of patient suffering from LGL-type leukaemia.
Applications:
FC
Additional Info:
The antibody MEM-06 reacts with an extracellular epitope of CD41 (GPIIb), a transmembrane glycoprotein (integrin family) composed of two chains GPIIb alpha (heavy chain; 120 kDa) and GPIIb beta (light chain; 23 kDa). CD41 is mainly expressed on platelets and megakaryocytes.
Clone number:
MEM-06
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD41 (platelet glycoprotein IIb) is composed of two subunits (120 kDa a, alpha and 23 kDa b, beta) that interact with CD61 in the presence of calcium to form a functional adhesive protein receptor. Upon blood vessel damage, this receptor binds to a variety of proteins including von Willebrand factor, fibrinogen, fibronectin and vitronectin. CD41 is mainly expressed on megakaryocyte-platelet lineage, but generally belongs to the antigens that are expressed during early stages of hematopoietic differentiation.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Leukocytes of patient suffering from LGL-type leukaemia.
Applications:
FC
Additional Info:
The antibody MEM-06 reacts with an extracellular epitope of CD41 (GPIIb), a transmembrane glycoprotein (integrin family) composed of two chains GPIIb alpha (heavy chain; 120 kDa) and GPIIb beta (light chain; 23 kDa). CD41 is mainly expressed on platelets and megakaryocytes.
Clone number:
MEM-06
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD40 is a costimulatory molecule of the TNF receptor superfamily and is expressed on many cell types, such as B cells, monocytes/macrophages, dendritic cells, endothelial cells, fibroblasts or vascular smooth muscle cells. Interaction of CD40 and its ligand CD154 (CD40L) is required for the generation of antibody responses to T-dependent antigens as well as for the development of germinal centers and memory B cells. In monocytes/macrophages CD40 engagement induces production of pro-inflammatory cytokines and chemokines. CD40-CD154 interactions are also critical for development of CD4 T cell-dependent effector functions. CD40 links innate and adaptive immune responses to bacterial stimuli and serves as an important regulator affecting functions of other costimulatory molecules.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human CD40a
Applications:
FC
Additional Info:
The antibody HI40a recognizes an extracellular epitope of CD40 (BP50), a 48 kDa type I single chain transmembrane glycoprotein expressed on normal and neoplastic B cells, but not on terminally differentiated plasma cells. CD40 antigen is also present on Hodgkin's and Reed-Sternberg cells, follicular dendritic cells, some macrophages, basal epithelial cells and endothelial cells.
Clone number:
HI40a
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD4 (T4) is a single chain transmembrane glycoprotein and belongs to immunoglobulin supergene family. In extracellular region there are 4 immunoglobulin-like domains (1 Ig-like V-type and 3 Ig-like C2-type). Transmembrane region forms 25 aa, cytoplasmic tail consists of 38 aa. Domains 1,2 and 4 are stabilized by disulfide bonds. The intracellular domain of CD4 is associated with p56Lck, a Src-like protein tyrosine kinase. It was described that CD4 segregates into specific detergent-resistant T-cell membrane microdomains. Extracellular ligands: MHC class II molecules (binds to CDR2-like region in CD4 domain 1); HIV envelope protein gp120 (binds to CDR2-like region in CD4 domain 1); IL-16 (binds to CD4 domain 3), human seminal plasma glycoprotein gp17 (binds to CD4 domain 1), L-selectin. Intracellular ligands: p56LckCD4 is a co-receptor involved in immune response (co-receptor activity in binding to MHC class II molecules) and HIV infection (human immunodeficiency virus; CD4 is primary receptor for HIV-1 surface glycoprotein gp120). CD4 regulates T-cell activation, T/B-cell adhesion, T-cell diferentiation, T-cell selection and signal transduction. Defects in antigen presentation (MHC class II) cause dysfunction of CD4+ T-cells and their almost complete absence in patients blood, tissue and organs (SCID immunodeficiency).
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
2 N-terminal domains of human CD4 fused to human IgG1 Fc
Applications:
FC
Additional Info:
The antibody MEM-241 recognizes an extracellular epitope of CD4 antigen, a 55 kDa transmebrane glycoprotein expressed on a subset of T lymphocytes (helper T-cells) and also on monocytes, tissue macrophages and granulocytes.
Clone number:
MEM-241
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD4 (T4) is a single chain transmembrane glycoprotein and belongs to immunoglobulin supergene family. In extracellular region there are 4 immunoglobulin-like domains (1 Ig-like V-type and 3 Ig-like C2-type). Transmembrane region forms 25 aa, cytoplasmic tail consists of 38 aa. Domains 1,2 and 4 are stabilized by disulfide bonds. The intracellular domain of CD4 is associated with p56Lck, a Src-like protein tyrosine kinase. It was described that CD4 segregates into specific detergent-resistant T-cell membrane microdomains. Extracellular ligands: MHC class II molecules (binds to CDR2-like region in CD4 domain 1); HIV envelope protein gp120 (binds to CDR2-like region in CD4 domain 1); IL-16 (binds to CD4 domain 3), human seminal plasma glycoprotein gp17 (binds to CD4 domain 1), L-selectin. Intracellular ligands: p56LckCD4 is a co-receptor involved in immune response (co-receptor activity in binding to MHC class II molecules) and HIV infection (human immunodeficiency virus; CD4 is primary receptor for HIV-1 surface glycoprotein gp120). CD4 regulates T-cell activation, T/B-cell adhesion, T-cell diferentiation, T-cell selection and signal transduction. Defects in antigen presentation (MHC class II) cause dysfunction of CD4+ T-cells and their almost complete absence in patients blood, tissue and organs (SCID immunodeficiency).
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Normal human blood lymphocytes
Applications:
FC
Additional Info:
The mouse monoclonal antibody EM4 recognizes an extracellular epitope of CD4 antigen, a 55 kDa transmebrane glycoprotein expressed on a subset of T lymphocytes (helper T-cells) and also on monocytes, tissue macrophages and granulocytes. This antibody does not block Leu3a and OKT4 binding, and blocks HIV-1 infection in cell to cell system. Very strong flow cytometry staining, brighter than Leu3a, OKT4 and other.
Clone number:
EM4
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD4 (T4) is a single chain transmembrane glycoprotein and belongs to immunoglobulin supergene family. In extracellular region there are 4 immunoglobulin-like domains (1 Ig-like V-type and 3 Ig-like C2-type). Transmembrane region forms 25 aa, cytoplasmic tail consists of 38 aa. Domains 1,2 and 4 are stabilized by disulfide bonds. The intracellular domain of CD4 is associated with p56Lck, a Src-like protein tyrosine kinase. It was described that CD4 segregates into specific detergent-resistant T-cell membrane microdomains. Extracellular ligands: MHC class II molecules (binds to CDR2-like region in CD4 domain 1); HIV envelope protein gp120 (binds to CDR2-like region in CD4 domain 1); IL-16 (binds to CD4 domain 3), human seminal plasma glycoprotein gp17 (binds to CD4 domain 1), L-selectin. Intracellular ligands: p56LckCD4 is a co-receptor involved in immune response (co-receptor activity in binding to MHC class II molecules) and HIV infection (human immunodeficiency virus; CD4 is primary receptor for HIV-1 surface glycoprotein gp120). CD4 regulates T-cell activation, T/B-cell adhesion, T-cell diferentiation, T-cell selection and signal transduction. Defects in antigen presentation (MHC class II) cause dysfunction of CD4+ T-cells and their almost complete absence in patients blood, tissue and organs (SCID immunodeficiency).
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
2 N-terminal domains of human CD4 fused to human IgG1 Fc
Applications:
FC
Additional Info:
The antibody MEM-241 recognizes an extracellular epitope of CD4 antigen, a 55 kDa transmebrane glycoprotein expressed on a subset of T lymphocytes (helper T-cells) and also on monocytes, tissue macrophages and granulocytes.
Clone number:
MEM-241
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD4 (T4) is a single chain transmembrane glycoprotein and belongs to immunoglobulin supergene family. In extracellular region there are 4 immunoglobulin-like domains (1 Ig-like V-type and 3 Ig-like C2-type). Transmembrane region forms 25 aa, cytoplasmic tail consists of 38 aa. Domains 1,2 and 4 are stabilized by disulfide bonds. The intracellular domain of CD4 is associated with p56Lck, a Src-like protein tyrosine kinase. It was described that CD4 segregates into specific detergent-resistant T-cell membrane microdomains. Extracellular ligands: MHC class II molecules (binds to CDR2-like region in CD4 domain 1); HIV envelope protein gp120 (binds to CDR2-like region in CD4 domain 1); IL-16 (binds to CD4 domain 3), human seminal plasma glycoprotein gp17 (binds to CD4 domain 1), L-selectin. Intracellular ligands: p56LckCD4 is a co-receptor involved in immune response (co-receptor activity in binding to MHC class II molecules) and HIV infection (human immunodeficiency virus; CD4 is primary receptor for HIV-1 surface glycoprotein gp120). CD4 regulates T-cell activation, T/B-cell adhesion, T-cell diferentiation, T-cell selection and signal transduction. Defects in antigen presentation (MHC class II) cause dysfunction of CD4+ T-cells and their almost complete absence in patients blood, tissue and organs (SCID immunodeficiency).
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
2 N-terminal domains of human CD4 fused to human IgG1 Fc
Applications:
FC
Additional Info:
The antibody MEM-241 recognizes an extracellular epitope of CD4 antigen, a 55 kDa transmebrane glycoprotein expressed on a subset of T lymphocytes (helper T-cells) and also on monocytes, tissue macrophages and granulocytes.
Clone number:
MEM-241
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD39, also known as ectonucleoside triphosphate diphosphohydrolase 1 (ENTPD1), is a cell surface enzyme (with intracellular N- and C-terminus) which hydrolyzes extracellular ATP and ADP to AMP. Inhibition of its enzymatic activity may confer anticancer benefits. The formation of oligomers in the plasma membrane is essential for enzyme activity. It is expressed on Treg cells, and in other cell types, such as mantle zone B cells, activated T cells, NK cells, macrophages, dendritic cells, neurons, endothelial cells and platelets. Hydrolysis of ATP and ADP inhibits inflammatory and thrombotic responses. In the nervous system, it regulates purinergic neurotransmission.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Applications:
FC
Additional Info:
The mouse monoclonal antibody TU66, also known as Tü66, recognizes an extracellular epitope of CD39, a 78 kDa cell surface enzyme expressed by regulatory T cells, mantle zone B cells, activated T cells, NK cells, macrophages, dendritic cells, neurons, endothelial cells and platelets.
Clone number:
TU66
Antibody Isotype:
IgG2b k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD39, also known as ectonucleoside triphosphate diphosphohydrolase 1 (ENTPD1), is a cell surface enzyme (with intracellular N- and C-terminus) which hydrolyzes extracellular ATP and ADP to AMP. Inhibition of its enzymatic activity may confer anticancer benefits. The formation of oligomers in the plasma membrane is essential for enzyme activity. It is expressed on Treg cells, and in other cell types, such as mantle zone B cells, activated T cells, NK cells, macrophages, dendritic cells, neurons, endothelial cells and platelets. Hydrolysis of ATP and ADP inhibits inflammatory and thrombotic responses. In the nervous system, it regulates purinergic neurotransmission.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Applications:
FC
Additional Info:
The mouse monoclonal antibody TU66, also known as Tü66, recognizes an extracellular epitope of CD39, a 78 kDa cell surface enzyme expressed by regulatory T cells, mantle zone B cells, activated T cells, NK cells, macrophages, dendritic cells, neurons, endothelial cells and platelets.
Clone number:
TU66
Antibody Isotype:
IgG2b k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD38 (NAD+ glycohydrolase) is a type II transmembrane glycoprotein able to induce activation, proliferation and differentiation of mature lymphocytes and mediate apoptosis of myeloid and lymphoid progenitor cells. Another role of CD38 is provided by enzymatic activity of its extracellular part. CD38 acts as NAD+ glycohydrolase converting NAD+ into ADP-ribose, as ADP-ribosyl cyclase producing cADPR and as cADPR hydrolase, thus affecting levels of calcium-mobilizing metabolites. ADPR produced by CD38 serves as an important second messenger of neutrophil and dendritic cell migration.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human thymocytes in foetus
Applications:
FC
Additional Info:
The mouse monoclonal antibody HIT2 reacts with an extracellular epitope of CD38 (T10), a 45 kDa type II transmembrane glycoprotein strongly expressed mainly on plasma cells and activated T and B lymphocytes; it is an antigenic marker of lymphoid cells.
Clone number:
HIT2
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD38 (NAD+ glycohydrolase) is a type II transmembrane glycoprotein able to induce activation, proliferation and differentiation of mature lymphocytes and mediate apoptosis of myeloid and lymphoid progenitor cells. Another role of CD38 is provided by enzymatic activity of its extracellular part. CD38 acts as NAD+ glycohydrolase converting NAD+ into ADP-ribose, as ADP-ribosyl cyclase producing cADPR and as cADPR hydrolase, thus affecting levels of calcium-mobilizing metabolites. ADPR produced by CD38 serves as an important second messenger of neutrophil and dendritic cell migration.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human thymocytes in foetus
Applications:
FC
Additional Info:
The mouse monoclonal antibody HIT2 reacts with an extracellular epitope of CD38 (T10), a 45 kDa type II transmembrane glycoprotein strongly expressed mainly on plasma cells and activated T and B lymphocytes; it is an antigenic marker of lymphoid cells.
Clone number:
HIT2
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD38 (NAD+ glycohydrolase) is a type II transmembrane glycoprotein able to induce activation, proliferation and differentiation of mature lymphocytes and mediate apoptosis of myeloid and lymphoid progenitor cells. Another role of CD38 is provided by enzymatic activity of its extracellular part. CD38 acts as NAD+ glycohydrolase converting NAD+ into ADP-ribose, as ADP-ribosyl cyclase producing cADPR and as cADPR hydrolase, thus affecting levels of calcium-mobilizing metabolites. ADPR produced by CD38 serves as an important second messenger of neutrophil and dendritic cell migration.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human thymocytes in foetus
Applications:
FC
Additional Info:
The mouse monoclonal antibody HIT2 reacts with an extracellular epitope of CD38 (T10), a 45 kDa type II transmembrane glycoprotein strongly expressed mainly on plasma cells and activated T and B lymphocytes; it is an antigenic marker of lymphoid cells.
Clone number:
HIT2
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD370 / CLEC9A, also known as DNGR1, is a type II transmembrane glycoprotein with extracellular C-type lectin domain and intracellular ITAM-containing domain. Its expression is restricted to BDCA3+ conventional dendritic cells and to a subset of CD14+ CD16- monocytes. CD370 serves as a receptor for ubiquitous preformed acid-labile protein associated ligands that are exposed when the cell membrane is damaged, such as on necrotic cells. Its triggering by these ligands mediates recruitment and activation of the tyrosine kinase Syk and leads to their cross-presentation to the immune system.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
RBL-2H3 cells expressing human CLEC9A fused to an HA epitope
Applications:
FC
Clone number:
8F9
Antibody Isotype:
IgG2a
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD369 (dectin-1, beta-glucan receptor) is a 33 kDa type II transmembrane glycoprotein of lectin family, and serves as a part of innate immunity system by binding to beta-glucan polymers, which are typical for yeast and mycobacterial cell walls. CD369 is expressed predominantly on dendritic cells, but it can be detected also on monocytes, macrophages, mast cells, eosinophils, B cells, endothelial cells, and sometimes also on some T cell subsets.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Extracellular part of human CD369 with hIgG FC tag
Applications:
FC
Clone number:
1500
Antibody Isotype:
IgG2a k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD361, also known as EVI2B (ecotropic viral integration site 2B) or EVDB, is a poorly characterized type I transmembrane protein, expressed from one of three genes embedded in intron 27b of the neurofibromatosis type 1 (NF1) gene. The DNA strand that is transcribed to produce CD361 is the complementary one to the strand encoding NF1. Murine homolog to human CD361 is associated with ecotropic viral insertions, which have been implicated in the expression of murine myeloid leukemias. CD361 has been also reported to be involved in melanocyte and keratinocyte differentiation. However, it is expressed mainly in peripheral blood and bone marrow.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Raji cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody MEM-216 recognizes an extracellular epitope of CD361 / EVI2B, almost uncharacterized type I transmembrane protein with broad leukocyte expression, mostly in myeloid and B cells.
Clone number:
MEM-216
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD361, also known as EVI2B (ecotropic viral integration site 2B) or EVDB, is a poorly characterized type I transmembrane protein, expressed from one of three genes embedded in intron 27b of the neurofibromatosis type 1 (NF1) gene. The DNA strand that is transcribed to produce CD361 is the complementary one to the strand encoding NF1. Murine homolog to human CD361 is associated with ecotropic viral insertions, which have been implicated in the expression of murine myeloid leukemias. CD361 has been also reported to be involved in melanocyte and keratinocyte differentiation. However, it is expressed mainly in peripheral blood and bone marrow.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Raji cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody MEM-216 recognizes an extracellular epitope of CD361 / EVI2B, almost uncharacterized type I transmembrane protein with broad leukocyte expression, mostly in myeloid and B cells.
Clone number:
MEM-216
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD36 (fatty acid translocase, FAT) is an 88 kDa ditopic glycosylated protein that belongs to the class B family of scavenger receptors. CD36 is expressed by most resting marginal zone B cells but not by follicular and B1 B cells, and it is rapidly induced on follicular B cells in vitro upon TLR and CD40 stimulation. CD36 does not affect the development of B cells, but modulates both primary and secondary antibody response. Similarly to glucose transporter GLUT4, CD36 is translocated from intracellular pools to the plasma membrane following cell stimulation by insulin. In mouse, CD36 is responsible for gustatory perception of long-chain fatty acids.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
living human myeloid cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody CB38 (NL07) recognizes an extracellular epitope of CD36 (GPIIIb), a 85-113 kDa integral membrane glycoprotein expressed on platelets, macrophages, endothelial cells, early erythroid cells and megakaryocytes.
Clone number:
CB38
Antibody Isotype:
IgM k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD36 (fatty acid translocase, FAT) is an 88 kDa ditopic glycosylated protein that belongs to the class B family of scavenger receptors. CD36 is expressed by most resting marginal zone B cells but not by follicular and B1 B cells, and it is rapidly induced on follicular B cells in vitro upon TLR and CD40 stimulation. CD36 does not affect the development of B cells, but modulates both primary and secondary antibody response. Similarly to glucose transporter GLUT4, CD36 is translocated from intracellular pools to the plasma membrane following cell stimulation by insulin. In mouse, CD36 is responsible for gustatory perception of long-chain fatty acids.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Platelets
Applications:
FC
Additional Info:
The antibody TR9 reacts with an extracellular epitope of CD36 (GPIIIb), a 85 kDa integral membrane glycoprotein expressed on platelets, macrophages, endothelial cells, early erythroid cells and megakaryocytes. The antibody TR9 cross-blocks binding of FITC-labeled standard antibody OKM5. Anti-CD36 antibodies inhibit adhesive functions (e.g. adherence of infected erythrocytes to target cells).
Clone number:
TR9
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD36 (fatty acid translocase, FAT) is an 88 kDa ditopic glycosylated protein that belongs to the class B family of scavenger receptors. CD36 is expressed by most resting marginal zone B cells but not by follicular and B1 B cells, and it is rapidly induced on follicular B cells in vitro upon TLR and CD40 stimulation. CD36 does not affect the development of B cells, but modulates both primary and secondary antibody response. Similarly to glucose transporter GLUT4, CD36 is translocated from intracellular pools to the plasma membrane following cell stimulation by insulin. In mouse, CD36 is responsible for gustatory perception of long-chain fatty acids.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
living human myeloid cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody CB38 (NL07) recognizes an extracellular epitope of CD36 (GPIIIb), a 85-113 kDa integral membrane glycoprotein expressed on platelets, macrophages, endothelial cells, early erythroid cells and megakaryocytes.
Clone number:
CB38
Antibody Isotype:
IgM k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD36 (fatty acid translocase, FAT) is an 88 kDa ditopic glycosylated protein that belongs to the class B family of scavenger receptors. CD36 is expressed by most resting marginal zone B cells but not by follicular and B1 B cells, and it is rapidly induced on follicular B cells in vitro upon TLR and CD40 stimulation. CD36 does not affect the development of B cells, but modulates both primary and secondary antibody response. Similarly to glucose transporter GLUT4, CD36 is translocated from intracellular pools to the plasma membrane following cell stimulation by insulin. In mouse, CD36 is responsible for gustatory perception of long-chain fatty acids.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Platelets
Applications:
FC
Additional Info:
The antibody TR9 reacts with an extracellular epitope of CD36 (GPIIIb), a 85 kDa integral membrane glycoprotein expressed on platelets, macrophages, endothelial cells, early erythroid cells and megakaryocytes. The antibody TR9 cross-blocks binding of FITC-labeled standard antibody OKM5. Anti-CD36 antibodies inhibit adhesive functions (e.g. adherence of infected erythrocytes to target cells).
Clone number:
TR9
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD352, also known as SLAMF6 (SLAM family member 6) is a type I transmembrane glycoprotein expressed on NK cells, T cells, and B cells, and serves as a coreceptor for them. Besides association of its tyrosine phosphorylated intracellular domain with SH2D1A protein, it associates also with SH2 domain-containing phosphatases, which can modulate the signaling. Multiple CD352 isoforms have been identified.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
CD352 transfectants
Applications:
FC
Clone number:
hsF6.4.20
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD35 (complement receptor 1, CR1) is a monomeric multiple modular cell surface glycoprotein which serves as receptor for C3b and C4b, the most important components of the complement system leading to clearance of foreign macromolecules. It is expressed mainly on the surface of granulocytes, monocytes, erythrocytes, B cells and folicular dendritic cells. Besides its role in complement cascade, CD35 is involved in blocking BCR-induced proliferation and the differentiation of B cells to plasmablasts and their Ig production.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Acute monocytic leukemia cells and normal blood monocytes
Applications:
FC
Additional Info:
The mouse monoclonal antibody E11 recognizes an extracellular epitope of CD35 (CR1), a type I transmembrane glycoprotein expressed on granulocytes, monocytes, B cells, folicular dendritic cells, erythrocytes, NK and T cell subsets, as well as e.g. on glomerulal podocytes.
Clone number:
E11
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD35 (complement receptor 1, CR1) is a monomeric multiple modular cell surface glycoprotein which serves as receptor for C3b and C4b, the most important components of the complement system leading to clearance of foreign macromolecules. It is expressed mainly on the surface of granulocytes, monocytes, erythrocytes, B cells and folicular dendritic cells. Besides its role in complement cascade, CD35 is involved in blocking BCR-induced proliferation and the differentiation of B cells to plasmablasts and their Ig production.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Acute monocytic leukemia cells and normal blood monocytes
Applications:
FC
Additional Info:
The mouse monoclonal antibody E11 recognizes an extracellular epitope of CD35 (CR1), a type I transmembrane glycoprotein expressed on granulocytes, monocytes, B cells, folicular dendritic cells, erythrocytes, NK and T cell subsets, as well as e.g. on glomerulal podocytes.
Clone number:
E11
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD344 (Frizzled class receptor 4) is a G-protein coupled 7-TM protein, predominantly expressed in fetal neuronal progenitor cells, neuronal intestinal cells, as well as in the kidney, lung, brain, and liver. CD344 is important for regulation of cell polarity, proliferation, and tissue development. Defects in CD344 expression, or its mutation, lead e.g. to serious failures in retinal vascularization, defects in cerebellum, progressive hearing loss, or impaired corpora lutea formation and function.
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
The oncoprotein ErbB2/HER2 (human epidermal growth factor receptor 2), also known as Neu or CD340, is a 185 kDa transmembrane tyrosine kinase of cell surface growth factor receptor family. It is present in a wide variety cell types of normal human fetal and adult tissues and is frequently overexpressed in human carcinomas (e.g. in 20-30% cases of breast cancer cells). Activation of ErbB2 triggers intracellular signalling events, which are essential for cell growth and differentiation. In the last 20 years ErbB2 antigen has become very important marker and therapy target in patient care.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
NIH-3T3/huCD340 cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 24D2 recognizes an extracellular epitope of human CD340 (HER-2), a type I transmembrane protein expressed by mesenchymal stem cells, B-lymphoblastic leukemia cells, subsets of C-ALL blasts, and and various types of carcinomas.
Clone number:
24D2
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
The oncoprotein ErbB2/HER2 (human epidermal growth factor receptor 2), also known as Neu or CD340, is a 185 kDa transmembrane tyrosine kinase of cell surface growth factor receptor family. It is present in a wide variety cell types of normal human fetal and adult tissues and is frequently overexpressed in human carcinomas (e.g. in 20-30% cases of breast cancer cells). Activation of ErbB2 triggers intracellular signalling events, which are essential for cell growth and differentiation. In the last 20 years ErbB2 antigen has become very important marker and therapy target in patient care.
Product Type:
Antibodies Primary
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
NIH-3T3/huCD340 cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 24D2 recognizes an extracellular epitope of human CD340 (HER-2), a type I transmembrane protein expressed by mesenchymal stem cells, B-lymphoblastic leukemia cells, subsets of C-ALL blasts, and and various types of carcinomas.
Clone number:
24D2
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD34 is a highly glycosylated monomeric 111-115 kDa surface protein, which is present on many stem cell populations. It is a well established stem cell marker, though its expression on human hematopoietic stem cells is reversible. CD34 probably serves as a surface receptor that undergoes receptor-mediated endocytosis and regulates adhesion, differentiation and proliferation of hematopoietic stem cells and other progenitors. CD34 expression is likely to represent a specific state of hematopoietic development that may have altered adhering properties with expanding and differentiating capabilities in both in vitro and in vivo conditions.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Applications:
FC
Additional Info:
The mouse monoclonal antibody 581 reacts with an extracellular epitope of CD34 (Mucosialin), a 110-115 kDa monomeric transmembrane phosphoglycoprotein expressed on hematopoietic progenitors cells and on the most pluripotential stem cells; it is gradually lost on progenitor cells. The antibody recognizes the class III CD34 epitope resistant to neuraminidase, chymopapain and glycoprotease.
Clone number:
581
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD34 is a highly glycosylated monomeric 111-115 kDa surface protein, which is present on many stem cell populations. It is a well established stem cell marker, though its expression on human hematopoietic stem cells is reversible. CD34 probably serves as a surface receptor that undergoes receptor-mediated endocytosis and regulates adhesion, differentiation and proliferation of hematopoietic stem cells and other progenitors. CD34 expression is likely to represent a specific state of hematopoietic development that may have altered adhering properties with expanding and differentiating capabilities in both in vitro and in vivo conditions.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Permanent human cell line derived from peripheral leucocytes of a patient suffering from chronic myeloid leukaemia.
Applications:
FC,ICC
Additional Info:
The mouse monoclonal antibody 4H11[APG] reacts with extracellular class III epitope on CD34 (Mucosialin), a 110-115 kDa monomeric transmembrane phosphoglycoprotein expressed on hematopoietic progenitors cells and on the most pluripotential stem cells; it is gradually lost on progenitor cells. The antibody 4H11[APG] completely blocks binding of class II antibody QBEnd10 and class III antibodies BIRMA K3 and 8G12 on KG1a cell line.
Clone number:
4H11[APG]
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD34 is a highly glycosylated monomeric 111-115 kDa surface protein, which is present on many stem cell populations. It is a well established stem cell marker, though its expression on human hematopoietic stem cells is reversible. CD34 probably serves as a surface receptor that undergoes receptor-mediated endocytosis and regulates adhesion, differentiation and proliferation of hematopoietic stem cells and other progenitors. CD34 expression is likely to represent a specific state of hematopoietic development that may have altered adhering properties with expanding and differentiating capabilities in both in vitro and in vivo conditions.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Applications:
FC
Additional Info:
The mouse monoclonal antibody 581 reacts with an extracellular epitope of CD34 (Mucosialin), a 110-115 kDa monomeric transmembrane phosphoglycoprotein expressed on hematopoietic progenitors cells and on the most pluripotential stem cells; it is gradually lost on progenitor cells. The antibody recognizes the class III CD34 epitope resistant to neuraminidase, chymopapain and glycoprotease.
Clone number:
581
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD34 is a highly glycosylated monomeric 111-115 kDa surface protein, which is present on many stem cell populations. It is a well established stem cell marker, though its expression on human hematopoietic stem cells is reversible. CD34 probably serves as a surface receptor that undergoes receptor-mediated endocytosis and regulates adhesion, differentiation and proliferation of hematopoietic stem cells and other progenitors. CD34 expression is likely to represent a specific state of hematopoietic development that may have altered adhering properties with expanding and differentiating capabilities in both in vitro and in vivo conditions.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human endothelial vesicles
Applications:
FC
Additional Info:
The antibody QBEnd-10 reacts with an extracellular class II epitope on CD34 (Mucosialin), a 110-115 kDa monomeric transmembrane phosphoglycoprotein expressed on hematopoietic progenitors cells and on the most pluripotential stem cells; it is gradually lost on progenitor cells. This antibody has been also used as an endothelial marker.
Clone number:
QBEnd-10
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 20 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (2 ml) is sufficient for 100 tests.
CD34 is a highly glycosylated monomeric 111-115 kDa surface protein, which is present on many stem cell populations. It is a well established stem cell marker, though its expression on human hematopoietic stem cells is reversible. CD34 probably serves as a surface receptor that undergoes receptor-mediated endocytosis and regulates adhesion, differentiation and proliferation of hematopoietic stem cells and other progenitors. CD34 expression is likely to represent a specific state of hematopoietic development that may have altered adhering properties with expanding and differentiating capabilities in both in vitro and in vivo conditions.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Permanent human cell line derived from peripheral leucocytes of a patient suffering from chronic myeloid leukaemia.
Applications:
FC
Additional Info:
The mouse monoclonal antibody 4H11[APG] reacts with extracellular class III epitope on CD34 (Mucosialin), a 110-115 kDa monomeric transmembrane phosphoglycoprotein expressed on hematopoietic progenitors cells and on the most pluripotential stem cells; it is gradually lost on progenitor cells. The antibody 4H11[APG] completely blocks binding of class II antibody QBEnd10 and class III antibodies BIRMA K3 and 8G12 on KG1a cell line.
Clone number:
4H11[APG]
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD34 is a highly glycosylated monomeric 111-115 kDa surface protein, which is present on many stem cell populations. It is a well established stem cell marker, though its expression on human hematopoietic stem cells is reversible. CD34 probably serves as a surface receptor that undergoes receptor-mediated endocytosis and regulates adhesion, differentiation and proliferation of hematopoietic stem cells and other progenitors. CD34 expression is likely to represent a specific state of hematopoietic development that may have altered adhering properties with expanding and differentiating capabilities in both in vitro and in vivo conditions.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Applications:
FC
Additional Info:
The mouse monoclonal antibody 581 reacts with an extracellular epitope of CD34 (Mucosialin), a 110-115 kDa monomeric transmembrane phosphoglycoprotein expressed on hematopoietic progenitors cells and on the most pluripotential stem cells; it is gradually lost on progenitor cells. The antibody recognizes the class III CD34 epitope resistant to neuraminidase, chymopapain and glycoprotease.
Clone number:
581
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD334 / FGFR4 (fibroblast growth factor receptor 4), a transmembrane tyrosine kinase, which is expressed in many tissues, such as in lung, kidney, muscle, heart, pancreas, intestine and other, acts as a receptor for several fibroblast growth factors, namely FGF1, FGF2, FGF6, FGF8, and FGF19. Interaction with these growth factors initiates in cell the signaling cascades leading to the mitogenesis and cell differentiation. Presence of CD334 Gly338Arg allele correlates with prognostic parameters in various cancer studies. CD334 plays multiple roles in the organism, including those of muscle regeneration, cholesterol-to-bile acid metabolism, or glucose homeostasis.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
NIH 3T3 cells transfected with full length human CD334
Applications:
FC
Additional Info:
The mouse monoclonal antibody 4FR6D3 reacts with an extracellular epitope of CD334, the fibroblast growth factor receptor 4, which is an approximately 88 kDa receptor tyrosine kinase expressed in variety of tissues.
Clone number:
4FR6D3
Antibody Isotype:
IgG1 k
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD33 is a transmembrane protein of the sialic acid-binding immunoglobulin-like lectin (Siglec) family. It belongs to the immunoreceptor tyrosine-based inhibitory motif (ITIM)-containing molecules able of recruiting protein tyrosine phosphatases SHP-1 and SHP-2 to signal assemblies; these ITIMs are also used for ubiquitin-mediated removal of the receptor from the cell surface. CD33 is expressed on cells of myelomonocytic lineage, binds sialic acid residues in N- and O-glycans on cell surfaces, and is a therapeutic target for acute myeloid leukemia.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human AML cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody WM53 reacts with an extracellular epitope of CD33, a 67 kDa type I transmembrane glycoprotein (immunoglobulin superfamily) expressed on myeloid progenitors, monocytes, granulocytes, dendritic cells and mast cells; it is absent on platelets, lymphocytes, erythrocytes and hematopoietic stem cells.
Clone number:
WM53
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
CD33 is a transmembrane protein of the sialic acid-binding immunoglobulin-like lectin (Siglec) family. It belongs to the immunoreceptor tyrosine-based inhibitory motif (ITIM)-containing molecules able of recruiting protein tyrosine phosphatases SHP-1 and SHP-2 to signal assemblies; these ITIMs are also used for ubiquitin-mediated removal of the receptor from the cell surface. CD33 is expressed on cells of myelomonocytic lineage, binds sialic acid residues in N- and O-glycans on cell surfaces, and is a therapeutic target for acute myeloid leukemia.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Human AML cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody WM53 reacts with an extracellular epitope of CD33, a 67 kDa type I transmembrane glycoprotein (immunoglobulin superfamily) expressed on myeloid progenitors, monocytes, granulocytes, dendritic cells and mast cells; it is absent on platelets, lymphocytes, erythrocytes and hematopoietic stem cells.
Clone number:
WM53
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
?-Casein is expressed as 13 genetic variants resulting from single nucleotide polymorphisms (SNP) in the CSN2 gene. The most frequent genetic variants in western dairy breeds are ?-Casein A1 and ?-Casein A2. The two types of ?-Casein protein, A1 and A2, differ by a single-point mutation at amino acid position 82 (P82/H82). The Biosensis Bovine A2 ?-Casein enzyme-linked immunosorbent assay (ELISA) Kit is a sandwich ELISA that allows the quantification of the bovine A2 ?-Casein isoform in 5 hours. This kit consists of a pre-coated rabbit anti-bovine ?-Casein polyclonal capture antibody, a chicken anti-bovine A2 ?-Casein detection antibody and a horseradish peroxidase (HRP)-conjugated donkey anti-chicken IgY antibody. The addition of a substrate (3,3',5,5' -tetramethylbenzidine, TMB) yields a coloured reaction product which is directly proportional to the concentration of Bovine A2 ?-Casein present in samples and protein standards. Extensive validation has shown accurate quantification of A2 ?-Casein in full cream milk, skim milk and reconstituted A2 milk powder. Please refer to the kit protocol for specific use instructions. The A1 isoform is not detected in this ELISA assay.
Product Type:
ELISA Assay
Species Reactivity:
Bovine
Immunogen:
Purified bovine beta Casein and peptide specific peptides for A2
Applications:
ELISA
Application Details:
ELISA. For the quantification of A2 Beta casein (A2) in Bovine Milk. Please download the detailed product insert for complete instructions for the successful use of this ELISA. Use only as directed.
Alternative Names:
CSN2; Bovine A2 Beta Casein; A2;
Biosensis Brand:
Biosensis®
Detection Method:
Colorimetric
Shelf Life:
12 months after date of receipt unopened.
Use:
For research use only.
Kit Components:
The ELISA kit box contains 96-well pre-coated strip plate(s), protein standards, detection reagents, wash and sample buffers, substrate buffer, stop solution and detailed protocols.
Specificity:
Bovine A2 beta-casein
Storage:
Store at 2-8°C
Range:
3.1 - 200 ng/mL
Sample Type:
Bovine Milk
Sensitivity:
This bovine A2 beta-casein ELISA kit detects a minimum of 2 ng/mL A2 beta-casein in assay buffer (defined as A1 concentration at blank OD plus 3x standard deviations of the blank OD (n=10))
Cross Reactivity:
No cross-reactivity is observed with bovine A1 beta-Casein.
The ZAP-70 (zeta-associated protein of 70 kDa) tyrosine kinase was identified as a tyrosine phosphoprotein that associates with TCR zeta subunit and undergoes tyrosine phosphorylation following TCR stimulation. ZAP-70 is a Syk family tyrosine kinase primarily expressed in T and NK cells that plays an essential role in signaling through the TCR. TCR-mediated activation of T cells is crucial to the immune response. In humans, ZAP-70 gene mutations resulting in lower ZAP-70 protein expression levels or expression of catalytically inactive ZAP-70 proteins, have been identified. ZAP-70 deficiency results in the absence of mature CD8+ T cells and the prevention of TCR-mediated activation of CD4+ T cells, and it can lead to severe combined immunodeficiency.In patients with chronic lymphocytic leukemia (B-CLL), ZAP-70 expression on B cell was shown to be correlated with disease progression and survival. ZAP-70 contains two N-terminal SH2 domains (Src homology domain 2) and a C-terminal kinase domain. During T cell activation, the binding of ZAP-70 SH2 domains to the phosphorylated zeta subunit on the activated TCR complex causes a colocalization with the Lck tyrosine kinase that phosphorylates ZAP-70 on Tyr493 in the activation loop. ZAP-70 autophosphorylates multiple tyrosines in the region between the SH2 domains and the kinase domain, including the binding sites for additional SH2-containing signaling proteins such as SLP76, LAT, Lck, PLCgamma1, Vav, Shc, Ras-GAP, and Abl. ZAP-70-mediated activation of these downstream effectors leads to the release of intracellular calcium stores, and the transcription of interleukin-2 and other genes important for an immune response.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store in the dark at 2-8°C. Do not freeze. Avoid prolonged exposure to light. Do not use after expiration date stamped on vial label.
Immunogen:
A KLH-coupled peptide corresponding to amino acids 282-307 of human ZAP-70
Applications:
FC,IP,WB,ICC
Additional Info:
The mouse monoclonal antibody 1E7.2 recognizes ZAP-70, a 70 kDa protein tyrosine kinase expressed in T and NK cells.<br>_x000D_ <b>ZAP-70 is a molecule susceptible to degradation.</b> It is recommended to use freshly prepared cell lysates (protease inhibitors are essential) to avoid non-specific staining of degradation products.<br>_x000D_ <i>This product is for research and in vitro experimental use only. It is not to be used for any other commercial purpose. Use of this product to produce products for sale or for therapeutic or drug discovery purposes is prohibited. In order to obtain a license to use this product for commercial purposes, contact The Regents of the Univessity of California.</i>
CD328, also known as Siglec-7 or p75/AIRM1, is a 75 kDa type I transmembrane glycoprotein of sialic acid-binding immunoglobulin-like lectin (Siglec) family. CD328 binds to sialylated glycans with alpha2,6 sialyl and alpha2,8 disyalyl residues and mediates sialic acid-dependent cell-cell binding. As it contains in its intracellular part the immunoreceptor tyrosine-based inhibitory motif (ITIM), it serves as an inhibitory receptor, e.g. of NK cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
human dendritic cells
Applications:
FC
Additional Info:
The mouse monoclonal antibody 6-434 recognizes an extracellular epitope of CD328 (Siglec-7), a 75 kDa transmembrane glycoprotein expressed mainly on NK cells, dendritic cells and monocytes.
Clone number:
6-434
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: The reagent is designed for analysis of human blood cells using 10 ?l reagent / 100 ?l of whole blood or 106 cells in a suspension. The content of a vial (1 ml) is sufficient for 100 tests.
DCL3 (EC=3.1.26) is a ribonuclease (RNase) III involved in RNA-mediated post-transcriptional gene silencing (PTGS). Functions in the microRNAs (miRNAs) biogenesis pathway by cleaving primary miRNAs (pri-miRNAs) and precursor miRNAs (pre-miRNAs). Synonymes: Endoribonuclease Dicer homolog 3.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Protein A is a surface protein of S. aureus which binds IgG molecules by their Fc region. In serum, the bacteria will bind IgG molecules in the wrong orientation on their surface, which hinders opsonization and phagocytosis. Mutants of S. aureus lacking protein A are more efficiently phagocytosed in vitro and mutants in infection models have diminished virulence. Due to its affinity for the Fc region of many mammalian immunoglobulins, protein A is considered a universal reagent in biochemistry and immunology.
The specific activity of the anti-protein A-agarose was determined, For this lot, 1,1 mg protein A bound per ml agarose
Purity:
Immunogen affinity purified in PBS pH 7.2. Contains 0.075% sodium azide, coupled to immunoprecipiation gel.
Special application note:
Antibodies were isolated from immune eggs, affinity purified on a protein A column and conjugated to N- hydroxysuccinimide (NHS)-activated agarose beads, Beads were washed extensively with after the blocking of the residual NHS sites
Escherichia coli LexA protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA). LexA‘s self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As a result, the expression of genes belonging to the S
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at -20 °C or -80°Cfor a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
LexA protein is full length, highly purified (over 90 %, SDS-PAGE) provided at a concentration of 1 mg/ml estimated by BCA method. UniProt: P0A7C2
Purity:
Contains 50% glycerol, 10 mM Tris-HCl (pH 7,5), 2 mM EDTA, 100 mM NaCl, 1 mM DTT. Over 90 % pure by SDS-PAGE.
Molecular Weight:
22,3 | 23 kDa
Special application note:
This product can be used in:Functional studies of E.coli SOS response. This product will bind to SOS box in vitro and repress the expression of the genes belonging to SOS regulationWestern blot as a positive control, to confirm that the bait construct is expressed in yeast two-hybrid sstem using lexA genecontrol in ChIP in combination with anti-LexA antibodies
Mouse anti-Human IgG1 Fc, HRP conjugated is a secondary antibody which binds to human IgG1 FC part in immunological assays.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized in 0.5 ml PBS
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube. Reconstituted material can be stoored in 4°Cup to 7 days.
Host Animal:
Mouse
Species Reactivity:
human IgG1
Immunogen:
Purified monoclonal IgG1 isolated from pooled human serum,
for reconstitution please add 0.5 ml of sterile destilled water
Not reactive in:
The antiserum does not react with any other component of the Human Ig system or any other Human plasma protein as tested, This antiserum has not been tested for cross-reactivity with other species
RuvA protein of Escherichia coli binds specifically to the Holliday structure which is the intermediate of recombination at the late stage of homologous recombination and recombination repair and forms a complex with RuvB motor protein allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region. In solution, it forms a tetramer and binds to the cross-like DNA of the Holliday junction from below and above holding it in between.
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at 4°Cor -20 °C for a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
RuvA protein is full length, highly purified (over 90 %, SDS-PAGE). UniProt: P0A809
Purity:
Contains 50% glycerol, 10 mM Tris-HCl (pH 7,5), 2 mM EDTA, 100 mM NaCl, 5 mM mercaptoethanol. Over 90 % pure by SDS-PAGE.
Molecular Weight:
22 kDa (monomer)
Selected references:
Han et al. (2006). Direct observation of DNA rotation during branch migration of Holliday junction DNA by Escherichia coli RuvA-RuvB protein complex. Proc Natl Acad Sci U S A. 2006 Aug 1;103(31):11544-8. doi: 10.1073/pnas.0600753103. Epub 2006 Jul 24. PMID: 16864792; PMCID: PMC1544206.Iwasaki et al. (1992) Escherichia coli RuvA and RuvB proteins specifically interact with Holliday junctions and promote branch migration. Genes Dev. 1992 Nov;6(11):2214-20. doi: 10.1101/gad.6.11.2214. PMID: 1427081.
Special application note:
This product can be used in functional studies as Holliday junction specific binding protein, which promotes Holliday-junction branch migration in combination with RuvB protein
E. coli RuvC protein (19 kDa) is a structurally specific endonuclease which binds specifically to the Holliday structure, an intermediate of recombination, at the late stage of homologous recombination and recombination repair and introduces a nick in the symmetrical point of the Holliday junction cleaving and resolving the recombinant.
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at -20 °C or -80°Cfor a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
RuvC protein is full length, highly purified (over 95 %, SDS-PAGE), recombinant without a tag at a concentration of 1 mg/ml (determined by BCA method). UniProt: P0A814
Purity:
Contans 50% glycerol, 10 mM Tris-HCl (pH 7,5), 2 mM EDTA, 100 mM NaCl, 5 mM mercaptoethanol. Over 95 % pure by SDS-PAGE.
Molecular Weight:
18,7 | 19 kDa
Selected references:
Shinagawa & Iwasaki (1996). Processing the holliday junction in homologous recombination. Trends Biochem Sci. 1996 Mar;21(3):107-11. PMID: 8882584.Iwasaki et al. (1991) Escherichia coli RuvC protein is an endonuclease that resolves the Holliday structure. EMBO J. 1991 Dec;10(13):4381-9. PMID: 1661673; PMCID: PMC453191.
Special application note:
This product can be used in:in vitro functional studies. RuvC cleaves recombination intermediate at Holiday JunctionAs a positive control in Western blot and standard in ELISA.
E. coli RuvB protein forms a complex with RuvA protein at the late stage of homologous recombination and recombination repair and binds specifically to the Holliday structure which is the intermediate of recombination, allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region.
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at -20 °C or -80°Cfor a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
RuvB protein is full length, highly purified (over 95 %, SDS-PAGE), recombinant. UniProt: P0A812
Purity:
Contans 50% glycerol, 10 mM Tris-HCl (pH 7,5), 2 mM EDTA, 100 mM NaCl, 5 mM mercaptoethanol. Over 95 % pure by SDS-PAGE.
Molecular Weight:
37 kDa
Selected references:
Mazina et al. (2012) Polarity and bypass of DNA heterology during branch migration of Holliday junctions by human RAD54, BLM, and RECQ1 proteins. J Biol Chem. 2012 Apr 6;287(15):11820-32. doi: 10.1074/jbc.M112.341347. Epub 2012 Feb 22. PMID: 22356911; PMCID: PMC3320930.Han et al. (2006). Direct observation of DNA rotation during branch migration of Holliday junction DNA by Escherichia coli RuvA-RuvB protein complex. Proc Natl Acad Sci U S A. 2006 Aug 1;103(31):11544-8. doi: 10.1073/pnas.0600753103. Epub 2006 Jul 24. PMID: 16864792; PMCID: PMC1544206.Iwasaki et al. (1992) Escherichia coli RuvA and RuvB proteins specifically interact with Holliday junctions and promote branch migration. Genes Dev. 1992 Nov;6(11):2214-20. doi: 10.1101/gad.6.11.2214. PMID: 1427081.
Special application note:
This product can be used in:in vitro functional studies. RuvA and RuvB are forming a complex that promotes Holiday junction ( a recombination intermediate) branch-migration by using ATP hydrolysis energy.As a positive control in Western blot and standar in ELISA.
The ExoTEST Ready to Use Kit is the ideal platform for capturing and quantifying exosomes from biological samples. It features ELISA plate(s) pre-coated with primary antibodies to exosome-specific markers, plus the secondary antibody, substrate reagents and the exosome standards. Plus we can also help you customise your own kit by choosing from the individual reagents available in our catalog.
Background Info:
Exosomes are small endosome derived lipid nanoparticles (50-120 nm) actively secreted by exocytosis by most living cells. Exosome release occurs either constitutively or upon induction, under both normal and pathological conditions, in a dynamic, regulated and functionally relevant manner. Both amount and molecular composition of released exosomes depend on the state of a parent cell. Exosomes have been isolated from diverse cell lines (hematopoietic cells, tumor lines, primary cultures, virus infected cells) as well as from biological fluids in particular blood (e.g. serum and plasma from cancer patients) and other body fluids (bronchoalveolar lavage fluid, pleural effusions, synovial fluid, urine, amniotic fluid, semen, saliva etc). Exosomes have pleiotropic physiological and pathological functions and an emerging role in diverse pathological conditions such as cancer, infectious and neurodegenerative diseases.
Product Type:
FACS analysis
Storage Temp:
+ 4 C
Applications:
FACS Exosome isolation and exosome marker characterization via FACS. Exosome comprehensive profiling.
ExoTEST has been developed to fill the need for a reliable method to quantify exosomes and examine their biomarkers. >>>> HansaBioMed also provide the ability to design and create your own kit by choosing from among the wide variety of reagents available in our catalog. 1-Select the exosome standard you need. 2-Select the primary antibody for exosome detection.
HBM provides a ready to use kit for the qualitative FACS analysis of exosomes. The Exo-FACS assay for exosome characterisation consists of 4um beads used for the direct overall capture of pre-purified, validated and lyophilized exosomes from cell culture supernatants or human biological fluids. The characterization of exosomal proteins (membrane expressed or internal) is subsequently performed using appropriate detection antibodies against exosome associated antigens.
Background Info:
Exosomes are small endosome derived lipid nanoparticles (50-120 nm) actively secreted by exocytosis by most living cells. Exosome release occurs either constitutively or upon induction, under both normal and pathological conditions, in a dynamic, regulated and functionally relevant manner. Both amount and molecular composition of released exosomes depend on the state of a parent cell. Exosomes have been isolated from diverse cell lines (hematopoietic cells, tumor lines, primary cultures, virus infected cells) as well as from biological fluids in particular blood (e.g. serum and plasma from cancer patients) and other body fluids (bronchoalveolar lavage fluid, pleural effusions, synovial fluid, urine, amniotic fluid, semen, saliva etc). Exosomes have pleiotropic physiological and pathological functions and an emerging role in diverse pathological conditions such as cancer, infectious and neurodegenerative diseases.
Product Type:
FACS analysis
Storage Temp:
+ 4 C
Applications:
FACS Exosome isolation and exosome marker characterization via FACS. Exosome comprehensive profiling.
No initial exosome purification required User friendly and reliable and efficient Suitable for multiple marker analyses Available in custom format
Fluorescent proteins, like EBFP, can be used as protein "tags" to study the subcellular localization of proteins and/or their translocation upon stimulation and/or as markers for transfections in transient and stable expression systems. In immunoblot it cross reacts with GFP and YFP.
Antibody Isotype:
IgG1
Monosan Range:
MONOSAN
Clone:
3A6
Concentration:
n/a
Storage buffer:
lyophilized in a 10 mM ammonium bicarbonate buffer. Each vial contains 2 mg BSA
CD57, also known as HNK-1 (human natural killer-1), is a cell surface carbohydrate epitope expressed on terminally differentiated T-cells and subsets of natural killer (NK) cells.1 It has also been identified on cells of neural crest origin.2 Anti-CD57 is often used to visualize the non-neoplastic bystander T-cells that may form rosettes around the neoplastic lymphocyte-predominant (LP) cells in nodular lymphocyte-predominant Hodgkin lymphoma (NLPHL).3
Antibody Isotype:
IgM-k
Monosan Range:
MONOSAN Ready To Use
Clone:
NK1
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Kared H, et al. Cancer Immunol Immunother. 2016; 65:441-52
References 2:
Nielsen CM, et al. Front Immunol. 2013; 4:422
References 3:
Sattarzadeh A, et al. Exp Hematol Oncol. 2015; 4:27
Anti-CD45RO labels an isoform of the CD45 antigen also known as leukocyte common antigen. Anti-CD45RO reacts with thymocytes, mature activated T-cells, and a subpopulation of resting T-cells while showing no reactivity with B-cells, making this antibody helpful in identifying T-cell neoplasms.
Antibody Isotype:
IgG2a-k
Monosan Range:
MONOSAN Ready To Use
Clone:
UCHL-1
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
CD43 is a transmembrane protein involved in immune function and T-cell activation. AntiCD43 reactivity is seen in T lymphocytes, monocytes, and granulocytes. No reactivity has been observed in normal or reactive B-cells. Reportedly, anti-CD43 reactivity is seen in the majority of T-cell lymphomas and some low grade B-cell lymphomas. Therefore, anti-CD43 is a useful immunohistochemical marker for the identification of T-cell lymphomas and some low grade B-cell lymphomas
Antibody Isotype:
IgG1
Monosan Range:
MONOSAN Ready To Use
Clone:
MT1
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Leong AS-Y, et al. 2nd edition. Grenwich Medical Media. London. 2003
References 2:
Dabbs DJ. Diagnositc Immunohistochemistry. Third Edition. Saunders. 2006
> 90% based on SDS-PAGE Small amounts of intact IgG may be present.
Host:
Goat
Immunogen:
Purified Rat IgG, whole molecule
Buffer:
PBS, 1% BSA & 0.1% proclin 150
Reconstitution:
Rehydrate with 0.55 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, prepare small aliquots and store at -20 °C . For storage at 2-8 °C, add a preservative to prevent growth of bacteria.
Shelf Life:
Store lyophilized material at 2-8 °C. For long term storage after reconstitution, dilute with 50% glycerol and store at -20 °C as a liquid.
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins · IgG from goat, hamster, human, mouse, or rabbit · serum from bovine, goat, horse, human, mouse, or rabbit
Country Of Origin:
Goat serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
> 90% based on SDS-PAGE Small amounts of intact IgG may be present.
Host:
Goat
Immunogen:
Purified Rat IgG, whole molecule
Buffer:
30 mM Triethanolamine, pH 7.2, 5 mM Magnesium Chloride, 0.1 mM Zinc Chloride, 1 % (w/v) BSA, Protease/IgG free
Storage:
Store undiluted liquid at 2-8 °C. For storage at -20 °C, dilute with an equal volume of glycerol to prevent loss of enzymatic activity. Prepare working dilutions prior to use and then discard.
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin rat serum proteins · IgG from goat, hamster, human, mouse, or rabbit · serum from bovine, goat, horse, human, mouse, or rabbit
Country Of Origin:
Goat serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
The antibody is an antibody to high molecular weight cytokeratin that reacts with all squamous and ductal epithelium and stains carcinomas. This antibody recognizes cytokeratins 1,5,10, and 14 that are found in complex epithelia. Anti-Cytokeratin, 34betaE12 shows no reactivity with hepatocytes, pancreatic acinar cells, proximal renal tubules, or endometrial glands; there has been no reactivity with cells derived from simple epithelia. Mesenchymal tumors, lymphomas, melanomas, and neural tumors are unreactive with this antibody with some exceptions. Anti-Cytokeratin, 34betaE12 does label myoepithelial cells and has been shown to be useful in distinguishing prostatic adenocarcinoma from hyperplasia of the prostate. This antibody has also been useful in separating benign from malignant intraductal breast proliferations.
Antibody Isotype:
IgG1-k
Monosan Range:
MONOSAN Ready To Use
Clone:
34betaE12
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Gown AM, et al. Am J Pathol. 1984; 114:309
References 2:
OMalley FP, et al. Virch Arch A. 1990; 417:191-6
References 3:
Wojno KJ, et al. Am J Surg Pathol. 1995; 19:251-60
References 4:
Moinfar F, et al. Am J Surg Pathol. 1999; 23:1048-58
Anti-TTF-1 (Thyroid Transcription Factor 1) is useful in differentiating primary adenocarcinoma of the lung from metastatic carcinomas originating in the organs rather than thyroid, germ cell tumors, and malignant mesothelioma. It can also be used to differentiate small cell lung carcinoma from lymphoid infiltrates. TTF-1 labeling is also seen in thyroid and thyroid-derived tumors. TTF-1 immunostaining is useful in the differentiation between pulmonary and nonpulmonary origin of adenocarcinomas in malignant effusions. TTF-1 staining is very reliable in discerning whether a brain metastasis has arisen from a pulmonary or nonpulmonary site, particularly when dealing with adenocarcinomas and largecell carcinomas.
Antibody Isotype:
IgG1-k
Monosan Range:
MONOSAN
Clone:
8G7G3/1
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Bejarano PA, et al. Mod Pathol. 1996; 9:445-52
References 2:
Di Loreto C, et al. Cancer Lett. 1998; 124:73-8
References 3:
Abutaily AS, et al. J Clin Pathol. 2002; 55:662-8
References 4:
Jang KY, et al. Anal Quant Cytol Histol. 2001; 23:400-4
The antibody detects a formalin-resistant epitope that is expressed by Reed-Sternberg cells in classic Hodgkin lymphoma, the majority of anaplastic large cell lymphomas, primary cutaneous CD30 positive T-cell lymphoproliferative disorders and in embryonal carcinomas. Occasionally diffuse large B-cell lymphoma stains with this antibody. This antibody also stains plasma cells in paraffin-embedded tissue as well as reactive immunoblasts. The staining pattern of anti-CD30 in lymphoma and embryonal carcinoma is different, with the former being membranous and exhibiting Golgi zone accentuation in location, and the latter being membranous only.
Antibody Isotype:
IgG1-k
Monosan Range:
MONOSAN
Clone:
Ber-H2
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Schwarting R, et al., Blood 1989 (74):1678-1689
References 2:
Fonatsch C, et al., Genomics 1992 (14):825-826
References 3:
George DH et al. Am J Surg Pathol. 2003 Apr;27(4): 487-93
References 4:
Hedvat CV et al. Hum Pathol. 2002 Oct;33(10): 968-74
The antibody s a useful marker for staining many carcinomas. It stains normal and neoplastic cells from various tissues, including mammary epithelium, sweat glands and colorectal carcinoma. Hepatocellular carcinoma, adrenal carcinoma and embryonal carcinomas are consistently EMA negative, so keratin positivity with negative EMA favors one of these tumors. EMA is frequently positive in meningioma, which can be useful when distinguishing it from other intracranial neoplasms such as schwannomas.
Antibody Isotype:
IgG2a-k, IgG1-k
Monosan Range:
MONOSAN
Clone:
E29
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Dearnaly DP, et al. Lancet 1983; 1271-4
References 2:
Attanoos RL, et al. Histopathology. 2003; 43:231-8
Helicobacter pylori is strongly associated with inflammation of the stomach and is also implicated in the development of gastric malignancy, peptic ulcers, and gastric lymphomas in humans. Helicobacter pylori can exist in a number of locations: in the mucus, attached to epithelial cells, or inside of vacuoles in epithelial cells, where it produces adhesions that bind to membrane-associated lipids and carbohydrates in or on epithelial cells. The most reliable method for detecting H. pylori infection is a biopsy during endoscopy histologic examination and detection by immunohistochemistry. Immunohistochemical staining of H. pylori on the surface of gastric mucosa is a valuable tool for identification of H. pylori infections.
Monosan Range:
MONOSAN
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
HDEL (his-asp-glu-leu) is a C-terminal tertapeptide found in yeast and plants which allows sorting of resident soluble proteins in the lumen of the endoplasmic reticulum.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C for 1 year; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Antibody in concentration 1 g/ml was sufficient for detection of HDEL-containing proteins in 10 g of yeast cell lysate by colorimetric western blot. Clone 2E7. For western blot results, immunofluorescence and immunogold images please referr to Napier et al. 1992.
Application Details:
1: 50-1 : 500 (IF), 1 : 100-1, 1000 (WB)
Conjugation:
IgG2B
Isotype:
IgG2B
Purity:
Total IgG. Protein G purified in PBS pH 7.4.
Molecular Weight:
78 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Luo et al. (2006). GRP78/BiP is required for cell proliferation and protecting the inner cell mass from apoptosis during early mouse embryonic development. Mol Cell Biol. 26(15): 5688-5697.Napier et al. (1992). Immunological evidence that plants use both HDEL and KDEL for targeting proteins to the endoplasmic reticulum. J Cell Sci. 102: 261-271.
Special application note:
Protein G purified IgG2B in PBS, pH 7,4 with 0,09 % sodium azide and 50 % glycerol at concentration 1 mg/ml
DMPO (5,5-dimethly-1-proline N-oxide) is a compound used in spin trapping. It is a method employed in chemistry as an analytical technique for detection and identification of short-lived free radicals. DMPO adducts can be generated with protein and DNA radicals.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C for one year, once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
DMPO (species independent)
Expected Species:
DMPO (species independent)
Immunogen:
5,5-dimethyl-2-(8-octanoic acid)-1-pyrrolone-N-oxide conjugated to ovalbumin
Applications:
ELISA (ELISA), Immunocytochemistry (ICC), Immuno-spin trapping (IT), Immunoprecipitation (IP), Western blot (WB)
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Chatterjee et al. (2009). Immuno-spin trapping of a post-translational carboxypeptidase B1 radical formed by a dual role of xanthine oxidase and endothelial nitric oxide synthase in acute septic mice. Free Radic. Med. and Biol. 46:454-461.
Special application note:
Antibody is purified on Protein G and present in TBS pH 7.4 with 0.05 % sodium azide as preservative and 50 % glycerol.DMPO antibody in dilution of 1: 1000 was sufficient to detect the DMPO nitrone adducts of metmyoglobin when loaded at 100 ng/lane by colormetric immunoblot analysis using goat anti-mouse IgG HRP conjugated secondary antibody.
Oxidative derivate of guanosine is called 8-Hydroxyguanosine (8OHdG) and is used as a popular biomarker of oxidative stress.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Recognizes markers of oxidative damage to DNA (8-hydroxy-2’-deoxyguanosine, 8-hydroxyguanine and 8-hydroxyguanosine)
Immunogen:
8-hydroxy-guanosine-BSA and – casein conjugates
Applications:
ELISA (ELISA), Immunoaffinity chromatography (IAP), Immunohistochemistry on frozen tissue and paraffin-embedded (IHC-Fr-P)
Protocol for immunostaining using this antibody can be found here.
Application Details:
The optimal working dilution should be determined by the investigator
Conjugation:
IgG2A
Isotype:
IgG2A
Purity:
Total IgG fraction. Protein G purified.
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Poborilova et al. (2015). DNA hypomethylation concomitant with the overproduction of ROS induced by naphthoquinone juglone on tobacco BY-2 suspension cells. Environmental and Experimental Botany, Volume 113, May 2015, Pages 28–39.Haigh and Drew (2015). Cavitation during the protein misfolding cyclic amplification (PMCA) method - The trigger for de novo prion generation? Biochem Biophys Res Commun. 2015 Apr 17. pii: S0006-291X(15)00726-3. doi: 10.1016/j.bbrc.2015.04.048.
Special application note:
Protein G purified IgG2B in PBS, pH 7,4 with 0,09 % sodium azide and 50 % glycerol at concentration 0,65 mg/ml
Nitrotyrosine is a marker of NO-dependent oxidative stress. It is a product of tyrosine nitration mediated by reactive nitrogen species. Protein tyrosine nitration results in a post-translational modification, component of nitric oxide signaling.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
The antibody recognizes 3-nitrotyrosine moieties. No detectable crossreactivitywith non-nitrated tyrosine. Not species specific.0.7μg/ml was sufficient for detection of 5 μg SIN-1 treated BSA by Western Blot..ECL.Antibody works paraffin-embedded sections.
Application Details:
1: 100 (IHC), 1: 1400 (WB), The exact and optimal working dilution should be determined by the investigator
Conjugation:
IgG2A
Isotype:
IgG2A
Purity:
Total IgG. Protein G purified, in PBS. Contains 50 % glycerol and 0.09% sodium azide.
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Gow et al. (2004).Biological significance of nitric oxide-mediated protein modifications. Am J Physiol Lung Cell Mol Physiol. 287(2): L262-8.Antibody used in immunohistochemistry:Pfister et al. (2002). Inducible nitric oxide synthase and nitrotyrosine in listeric encephalitis: a cross-species study in ruminants. Vet Pathol. 39: 190-199.Girault et al. (2001).Immunodetection of 3-nitrotyrosine in the liver of zymosan-treated rats with a new monoclonal antibody: comparison to analysis by HPLC. Free Radical Biology and Medicine, 31 (11): 1375-1387.
Special application note:
1 mg/ml of Protein G purified IgG2A in PBS pH 7,4, 0,09 % sodium azide, 50 % glycerol
Tyrosine phosphorylation is considered to be one of the key steps in signal transduction and regulation of enzymatic activity. Phosphotyrosine antibodies are helpful in facilitating the identification of tyrosine kinase substrates.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at -20 °C for one year; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Antibody reacts with phosphotyrosine and detects the presence of phosphotyrosine in proteins of both unstimulated and stimulated cell lysated, Does not cross react with phosphoserine or phosphothreonine
Immunogen:
Phosphotyrosine, alanine and glyceine in a 1:1:1 ratio polymerized in the presence of keyhole limpet hemocyanin KLH with 1-ethyl-3-(3’-dimentrylaminopropyl) carbodiimide
Applications:
Immunoprecipitation (IP), Immunofluorescence (IF), Immunohistochemistry (IHC), Western blot (WB)
1 g/ml of this antibody is sufficient for detection of phosphorylated tyrosine residues in 10 g of rat tissue lysate by colorimetric immunoblot analysis
Application Details:
1 : 1000 (WB)
Conjugation:
IgG1
Isotype:
IgG1
Purity:
Total IgG.
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Garton & Tonks (1999). Regulation of fibroblast motility by the protein tyrosine phosphatase PTP-PEST. J Biol Chem 6:3811-3818.Tiganis et al. (1999). The protein-tyrosine phosphatase TCPTP regulates epidermal growth factor receptor-mediated and phosphatidylinositol 3-kinase-dependent signaling. J Biol Chem 39: 27768-27775.(IF):Garton et al. (1996). Identification of p130(cas) as a substrate for the cytosolic protein tyrosine phosphatase PTP-PEST. Mol and Cell Bio 11:6408-6418.(IP):
Special application note:
Protein G purified IgG1 in PBS, pH 7,4 with 0,09 % sodium azide and 50 % glycerol at concentration 1 mg/ml
Post-translational modifications of proteins play critical roles in the regulation and function of many known biological processes. Proteins can be post-translationally modified in many different ways, and a common posttranscriptional modification of Lysine involves acetylation (1). The conserved amino-terminal domains of the four core histones (H2A, H2B, H3 and H4) contain lysines that are acetylated by histone acetyltransferases (HATs) and deacetylated by histone deacetylases (HDACs) (2). Protein posttranslational reversible lysine Nε-acetylation and deacetylation have been recognized as an emerging intracellular signaling mechanism that plays critical roles in regulating gene transcription, cell-cycle progression, apoptosis, DNA repair, and cytoskeletal organization (3).
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Mouse
Species Reactivity:
Bovine, avian
Expected Species:
Higher plants
Immunogen:
acetylated KLH
Applications:
ELISA (ELISA), Immunocytochmistry/Immunofluorescence (ICC/IF), Immunohistochemistry (IHC), Immunoprecipitation (IP), Western blot (WB)
1 g of this antibody is sufficient to detect acetylated chicken erythrocyte histones (sodium butyrate-treated) using 20 g total protein and ECL detection system
Application Details:
1 : 100 (IHC), 1 : 1000 (WB)
Conjugation:
IgG1
Isotype:
IgG1
Purity:
Total IgG fraction. Protein G purified.
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Vigushin & Coombes (2004). Targeted histone deacetylase inhibition for cancer therapy. Curr. Cancer Drug Targets 4: 205-218.
Special application note:
Protein G purified IgG2B in PBS, pH 7,4 with 0,09 % sodium azide and 50 % glycerol at concentration 1 mg/mlantibody detects Proteins containing acetylated lysine residues in ELISA and WBs, Does not detect non-acetylated lysine residues
Tyrosine Kinase Receptor B (TrkB)-Fc Chimera, Human, Purified Recombinant Protein, suitable to Block..
Background Info:
TrkC is a member of the tropomyosin-related kinase receptor family. TrkC is a membrane-bound receptor that upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. TrkC is the receptor for neurotrophin-3 (NT-3). Signalling through TrkC leads to cell differentiation and may play a role in the development of proprioceptive neurons that sense body position. TrkC is a heavily glycosylated molecule with 13 potential N-linked glycosylation sites within the extracellular domain.
Product Type:
Protein
Format:
The TrkC-Fc chimera consists of 15-55% carbohydrate by weight. When reconstituted in 0.5 mL sterile phosphate-buffered saline, the solution will contain 1% human serum albumin (HSA) and 10% trehalose.
Lyophilized products should be stored at 2 to 8°C. Following reconstitution short-term storage at 2-8°C is recommended, and longer-term storage of aliquots at -18 to -20°C. Repeated freeze thawing is not recommended.
Purification:
>95%, as determined by SDS-PAGE and visualized by silver stain.
L-selectin-Fc Chimera, Human, Purified Recombinant Protein, suitable to Block.
Background Info:
L-selection (CD26L) is a cell surface adhesion protein constitutively expressed on all classes of human leukocytes. The L-Selectin glycoprotein is composed of a C-type lectin family domain at the amino terminus, an EGF-like domain, two short consensus repeat (SCR) sequences, a transmembrane domain and a short cytoplasmic tail. L-Selectin contains 7 potential N- linked glycosylation sites.
Product Type:
Protein
Format:
The L-Selectin-Fc chimera consists of 20-45% carbohydrate by weight. When reconstituted in 0.5 mL sterile phosphate-buffered saline, the solution will contain 1% human serum albumin (HSA) and 10% trehalose.
Lyophilized products should be stored at 2 to 8°C. Following reconstitution, short-term storage at 2-8°C is recommended and longer-term storage of aliquots at -18 to -20°C. Repeated freeze thawing is not recommended.
Purification:
>95%, as determined by SDS-PAGE and visualized by silver stain
Stem Cell Factor Receptor (SCFR) is a member of the receptor tyrosine kinase family. Binding of SCFR to its ligand Stem Cell Factor (PE-2008-5) induces receptor dimerization, autophosphorylation and signal transduction. SCFR is essential for the development of normal hematopoietic cells and plays an important role in the survival, proliferation and differentiation of mast cells, melanocytes and germ cells.
Product Type:
Protein
Format:
The SCFR-Fc Chimera consists of 5-45% carbohydrate by weight. When reconstituted in 0.5 mL sterile phosphate-buffered saline, the solution will contain 1% human serum albumin (HSA) and 10% trehalose.
Lyophilized products should be stored at 2 to 8°C. Following reconstitution short-term storage at 2-8°C is recommended, and longer-term storage of aliquots at -18 to -20°C. Repeated freeze thawing is not recommended.
Purification:
>95%, as determined by SDS-PAGE and visualized by silver stain
Stem Cell Factor Receptor (SCFR) is a member of the receptor tyrosine kinase family. Binding of SCFR to its ligand Stem Cell Factor (PE-1242-5) induces receptor dimerization, autophosphorylation and signal transduction. SCFR is essential for the development of normal hematopoietic cells and plays an important role in the survival, proliferation and differentiation of mast cells, melanocytes and germ cells.
Product Type:
Protein
Format:
Purified SCFR consists of approximately 15-45% carbohydrate by weight. When reconstituted in 0.5 mL sterile phosphate-buffered saline, the solution will contain 1% human serum albumin (HSA) and 10% trehalose.
Lyophilized products should be stored at 2 to 8°C. Following reconstitution, short-term storage at 2-8°C and longer-term storage of aliquots at -18 to -20°C is recommended. Repeated freeze thawing is not recommended.
Purification:
>95%, as determined by SDS-PAGE, visualised by Coomassie Brilliant Blue
The antibody reacts with the ?II?-subunit of the ?-integrins. Reacts specifically with platelets, megakaryocytes and leukemic cells able to megakaryocytic differentiation.
The antibody is directed against a single band of 180 kD of human carcinoembryonic antigen (CEA) and shows no cross-reactivity neither with bilary glycoprotein (BGP) nor with non-specific cross-reacting antigen (NCA).
Tumor associated glycoprotein (TAG)-72 is a high molecular weight glycoprotein that is present on the surface of many neoplastic cells, including adenocarcinomas of the breast, colon, and lung. TAG-72 is found in lung adenocarcinoma and is absent in mesothelioma, making the TAG-72 antibody useful in distinguishing adenocarcinoma from mesothelioma.
Antibody Isotype:
IgG1-k
Monosan Range:
MONOSAN
Clone:
B72.3
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Thor, A, et al. Cancer Res 1986;46:3118
References 2:
Schlom J, et al. Tumormarker Oncology;1987;2:3
References 3:
Osteen KG et al. In J Gynecol Pathol. 1992 Jul;11(3):216-20
References 4:
Ordonez NG. Am J Surg Pathol. 1998 Oct;22(10):1203-14
References 5:
Chhieng DC et al. Hum Pathol. 2003 Oct;34(10):1016-21
hMSCs have emerged as a promising regenerative tool, owing mainly to their multi-differentiation potential and immunosuppressive capacity. MSCs of neonatal origins exhibit superior proliferation ability, lower immunogenicity, and are expected to show lower incorporated mutation. hMSCs are isolated from three neonatal tissues, namely amniotic membrane, Chorion Villi, and Decidua tissue of the human placenta from the same donor.
Email us for more details - tech@nktscientific.com.
Background Info:
Product Quality Control:
Rigid quality control testing is performed for each batch (both cell donors and cell cultures). Cultured cells are tested for cell identity, purity, potency, viability and suitability for the intended use.
Before cryopreservation cultured MSCs (P2-P3) are characterised by flow cytometry analysis for identity by a comprehensive panel of markers [CD73/CD90/CD105 (positive) and CD14/CD34/CD45/HLA-DR (negative)] as proposed by the ISCTMSC committee position statement, 2006.
A multilineage differentiation assay into adipogenic and osteogenic directions is performed for each MSCs batch expanded in vitro. In addition, all donors and cell cultures have been screened for the absence of the following infectious agents: HIV-1/2, HBV, HCV, HSV1, HSV2, CMV, EBV, HHV6, Treponema pallidum, Toxoplasmagondii, Chlamydia trachomatis, Ureaplasma urealyticum, Ureaplasma parvum and microbial contaminants (bacteria & fungi,Mycoplasma hominis and Mycoplasma genitalium).
MSC cultures genetic stability is verified by karyotype evaluation (GTG banding).
FITC is a fluorochrome dye that absorbs ultraviolet or blue light causing molecules to become excited and emit a visible yellow-green light. This emission ceases upon removal of the light causing the excitation. FITC antibody is used to enhance the specific signal from a monoclonal antibody or a secondary antibody conjugated to FITC. The sensitivity of the FITC hapten-anti-hapten system makes it a useful alternative to other systems.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube. Stort time storage at +4°C.
Aflatoxins are naturally occurring mycotoxins that are produced by many species of Aspergillus. Aflatoxins are toxic and among the most carcinogenic substances known. Crops which are frequently affected by Asperiillus include cereals (maize, sorghum, pearl millet, rice, wheat), oilseeds (peanut, soybean, sunflower, cotton), spices (chile peppers, black pepper, coriander, turmeric, ginger), and tree nuts (almond, pistachio, walnut, coconut, brazil nut).
Goat anti-Mouse IgG (H&L), F(ab)'2 fragment, Biotin conjugated, min. cross-reactivity to bovine, goat, human, rabbit, or rat IgG (highly absorbed against rat IgG) is a secondary antibody conjugated to biotin, which binds to mouse IgG (H&L), F(ab)'2 Fragment in immunological assays.
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.05% (w/v) Sodium Azide is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins • bovine, goat, human, rabbit or rat IgG Based on ELISA, this antibody has <1% reactivity to: • rat IgG .
Goat anti-Mouse IgG (H&L), F(ab)'2 fragment, HRP conjugated, min. cross-reactivity to bovine, goat, human, rabbit, or rat IgG (highly absorbed against rat IgG) is a secondary antibody conjugated to HRP, which binds to mouse IgG (H&L), F(ab)'2 Fragment in immunological assays.
For reconstitution add 0,55 ml of sterile water,Let it stand 30 minutes at room temperature to dissolve, Prepare fresh working dilutions daily
Special application note:
Antibody purity is > 90% based on SDS-PAGE Small amounts of intact IgG may be present.Affinity purified using solid phase Mouse IgG .Antibody is supplied in 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free. 0.1% (v/v) Kathon CG is added as a preservative.Based on IEP, this antibody reacts with: • heavy (γ) chains on mouse IgG • light chains on all mouse immunoglobulins .Based on IEP, no reactivity is observed to: • non-immunoglobulin mouse serum proteins • bovine, goat, human, rabbit or rat IgG Based on ELISA, this antibody has <1% reactivity to: • rat IgG .
The antibody reacts with the Lectin Domain of E-selectin, CD62-e, formerly designated Endothelial Leucocyte Adhesion Molecule-1 (ELAM-1). The antibody reacts with human endothelial cells activated with TNF, IL-1 or endotoxin. The antibody was found to react also with cells transfected with the ELAM-1 gene. The antibody inhibits the adhesion of granulocytes both neutrophilic and eosinophilic.
The psbA gene has been cloned from many species of plants, green algae, and cyanobacteria. The psbA gene is located in the chloroplast genome and encodes for the D1 protein, a core component of Photosystem II. PsbA/D1 is rapidly cycled under illumination in all oxygenic photobionts. Tracking PsbA pools using the Global PsbA antibody can show the functional content of Photosystem II in a wide range of samples. Alternative names: 32 kDa thylakoid membrane protein, photosystem II protein D1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Algae (brown and red), Dictos, Conifers, Cyanobacteria, Medicago sativa, Nannochloropsis sp., Pisum sativum, Triticum aestivum, cellular [compartment marker] of thylakoid membrane. Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from available plant, algal and cyanobacterial PsbA sequences, including Arabidopsis thaliana UniProt: A4QJR4, TAIR: AtCg00020 , Oryza sativa P0C434, Populus alba Q14FH6, Physcomitrella patens Q6YXN7, Chlamydomonas reinhardtii P07753, Synechocystis sp. P14660 and many others
The antibody is appropriate for detecting both, 24 kDa or the 10 kDa C-terminal fragments, whichever is generated under given treatment conditions. In our analysis we have seen both, ca. 24 kDa and ca. 10 kDa fragments from different samples, depending on treatments and isolation procedures.Rabbit anti-PsbA antibody can detect more than one band of PsbA protein, e.g. precursor and mature protein as compare to the hen anti-PsbA antibodies AS01 016.This antibody will detect the phosphorylated form of D1 as an alternate band to the main band on a high resolution gel.The antibody will bind to cross-linked proteins: D1/D2, D1/cyt b559, D1/CP43.
Application Details:
1 : 15 000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4, conjugated to HRP.
Molecular Weight:
38 | 28-30 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Thurotte et al. (2020). DnaK3 Is Involved in Biogenesis and/or Maintenance of Thylakoid Membrane Protein Complexes in the Cyanobacterium Synechocystis Sp. PCC 6803. Life (Basel). 2020 Apr 30;10(5):E55. doi: 10.3390/life10050055.
Special application note:
Due to biology of PsbA (D1) protein a number of degradation products can apprear in a sample and may be observed when using anti-PsbA antibodies, including products having apparent molecular weights of 24kDa and 16kDa. D1 degradation is a complex set of events and the products observed can be influenced by both the extraction procedure and the physiology of the cells prior to harvest. Third, cross-linking may occur between D1 and cytochrome b559, shifting the protein higher in the gel. In cyanobacteria (PCC7942), three different bands were competed out by preincubating the antibody with the PsbA free peptide, indicating that all bands are indeed PsbA and its precursors or breakdown products. Competition assays were also performed with spinach and Chlamydomonas, confirming the identity of PsbA bands.Anti-PsbA antibodies will not detect D2 protein, as the peptide used to generate PsbA antibodies has no homology to the D2 sequence.
Clone C241:5:1:4 reacts specifically with Sialyl Lewisa - containing glycolipids, showing no crossreaction with Lewisa, Lewisb, or other structurally related molecules. The epitope recognized by NCL-L-CA19-9 is designated CA19-9
Antibody Isotype:
IgG1
Monosan Range:
MONXtra
Clone:
C241:5:1:4
Concentration:
n/a
Storage buffer:
Purified in PBS, 1% BSA and 15 mM sodium azide
Storage:
2-8°C
References 1:
Johansson C et al. Tumour Biology. 12: 159170 (1991)
References 2:
Kuusela P et al. British Journal of Cancer. 63: 636640 (1991)
References 3:
Haglund C et al. British Journal of Cancer. 60: 845851 (1989)
Mouse anti-6x Histidine is a primary antibody which binds to 6x Histidine tag and is directly conjugated to SureLight R-Phycoerythrin. This is of advantage to shorten assay time by no need to use a secondary antibody to 6x Histidine tag.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Mouse anti-DYKDDDDK is a primary antibody which binds to DYKDDDDK (Sigma FLAG ) and is directly conjugated to DyLight 650. This is of advantage to shorten assay time by no need to use a secondary antibody.DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Mouse anti-c-myc is a primary antibody which binds to c-myc tag and is directly conjugated to DyLight 550. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Host Animal:
Mouse
Immunogen:
epitope EQKLISEEDL sequence from the human c-myc protein
Mouse anti-c-myc is a primary antibody which binds to c-myc tag and is directly conjugated to DyLight 488. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Host Animal:
Mouse
Immunogen:
epitope EQKLISEEDL sequence from the human c-myc protein
Mouse anti-c-myc is a primary antibody which binds to c-myc tag and is directly conjugated to SureLight R-Phycoerythrin.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20 °C.
Host Animal:
Mouse
Immunogen:
epitope EQKLISEEDL sequence from the human c-myc protein
Mouse anti-c-myc is a primary antibody which binds to c-myc tag which is directly conjugated to DyLight 650. This is of advantage to shorten assay time. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Host Animal:
Mouse
Immunogen:
epitope EQKLISEEDL sequence from the human c-myc protein
Mouse anti-c-myc is a primary antibody which binds to c-myc and is directly conjugated to ALP, Alkaline Phosphatase. This is of advantage to shorten assay time by no need to use a secondary antibody.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Host Animal:
Mouse
Immunogen:
epitope EQKLISEEDL sequence from the human c-myc protein
His-Tag is a polyhistidine tag which consists of 6 histidine residues introduced on N- or C-terminus of the protein. The polyhistidine-tag can be used for recombinant protein detection using specific antibodies and it is not conjugated to any dye or enzyme.
Rabbit anti-T7 is a primary antibody which binds to T7 and is directly conjugated to DyLight 550. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Rabbit anti-T7 is a primary antibody which binds to T7 and is directly conjugated to DyLight 488. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Rabbit anti-T7 is a primary antibody which binds to T7 and is directly conjugated to SureLight R-Phycoerythrin (R-PE).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Rabbit anti-T7 is a primary antibody which binds to T7 and is directly conjugated to DyLight 650. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Rabbit anti-T7 is a primary antibody which binds to T7 and is directly conjugated to Biotin.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Rabbit anti-T7 is a primary antibody which binds to T7 and is directly conjugated to ALP, Alkaline Phosphatase. This is of advantage to shorten assay time by no need to use a secondary antibody to T7.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Rabbit anti-S is a primary antibody which binds to S and is directly conjugated to Biotin. This is of advantage to shorten assay time by no need to use a secondary antibody to S.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Rabbit anti-S is a primary antibody which binds to S and is directly conjugated to ALP, Alkaline Phosphatase. This is of advantage to shorten assay time by no need to use a secondary antibody to S.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Rabbit anti-S is a primary antibody which binds to S and is directly conjugated to DyLight 550. This is of advantage to shorten assay time by no need to use a secondary antibody to S. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Rabbit anti-S is a primary antibody which binds to S and is directly conjugated to DyLight 488. This is of advantage to shorten assay time by no need to use a secondary antibody to S. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Rabbit anti-S is a primary antibody which binds to S and is directly conjugated to SureLight R-Phycoerythrin (R-PE). This is of advantage to shorten assay time by no need to use a secondary antibody to S.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Rabbit anti-S is a primary antibody which binds to S and is directly conjugated to DyLight 650. This is of advantage to shorten assay time by no need to use a secondary antibody to S. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Goat anti-GST IgG is a primary antibody which binds to GST and is directly conjugated to DyLight 650. This is of advantage to shorten assay time by no need to use a secondary antibody to GST. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C.; Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Goat anti-GST is a primary antibody to GST directly conjugated to SureLight R-Phycoerythrin.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Host Animal:
Goat
Immunogen:
Glutathione-S-transferase from S. japonicum
Applications:
Flow cytometry (Flow cyt), Cell Based Assays (CBA)(CBA), Microarrays (MA), and Microplate applications (MPl)
Goat anti-GST is a primary antibody which binds to GST and is directly conjugated to DyLight 488. This is of advantage to shorten assay time by no need to use a secondary antibody to GST. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Goat anti-GST is a primary antibody which binds to GST which is directly conjugated to DyLight 550. This is of advantage to shorten assay time by no need to use a secondary antibody to GST. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Mouse anti-HA is a primary antibody which binds to HA and is directly conjugated to SureLight R-Phycoerythrin. This is of advantage to shorten assay time by no need to use a secondary antibody to HA.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Host Animal:
Mouse
Immunogen:
HA-tag: YPYDVPDYA
Applications:
Flow Cytometry (FL), Cell Based Assays (CBA)(CBA), Microarrays (MA), and Microplate applications (MPl)
Mouse anti-HA is a primary antibody which binds to HA and is directly conjugated toDyLight 488. This is of advantage to shorten assay time by no need to use a secondary antibody to HA. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Mouse anti-HA is a primary antibody which binds to HA and is directly conjugated toDyLight 550. This is of advantage to shorten assay time by no need to use a secondary antibody to HA. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Mouse anti-HA is a primary antibody which binds to HA and is directly conjugated to Alkaline Phosphatase . This is of advantage to shorten assay time when no need to use a secondary antibody to HA.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
The optimal working dilution should be determined by the investigator
Purity:
Immunogen affinity purified in 25 mM Tris, 150 mM NaCl, 5 mM MgCl2, 0.12 mM ZnCl2, pH 7.4. with 2 mM sodium azide.
Selected references:
Wang et al. (2017). The inhibition of protein translation mediated by AtGCN1 is essential for cold tolerance in Arabidopsis thaliana. Plant Cell Environ. 2017 Jan;40(1):56-68. doi: 10.1111/pce.12826.
Special application note:
Antibody is provided in: 25 mM Tris, 150 mM Sodium Chloride, 5 mM Magnesium Chloride, 0,12 mM Zinc Chloride, pH 7,4 with 2 mM Sodium Azide
Mouse anti-HA is a primary antibody which binds to HA and is directly conjugated to biotin. This is of advantage to shorten assay time since there is no need to use a secondary antibody to HA.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Mouse anti-HA is a primary antibody which binds to HA and is directly conjugated to HRP. This is of advantage to shorten assay time by no need to use a secondary antibody to HA.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized. Reconstitute in 1 ml of distilled, deionized water. Vortex gently and let sit on ice for 20 minutes.
Mouse anti-HA is a primary antibody which binds to HA and is directly conjugated toDyLight 650. This is of advantage to shorten assay time by no need to use a secondary antibody to HA. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Host Animal:
Mouse
Immunogen:
HA-tag:YPYDVPDYA
Applications:
Flow cytometry (Flow cyt) and Cell Based Assays (CBA)(CBA)
Mouse anti-6x Histidine is a primary antibody which binds to 6x Histidine tag and is directly conjugated to DyLight 488. This is of advantage to shorten assay time by no need to use a secondary antibody to 6x Histidine tag. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Mouse anti-6x Histidine is a primary antibody which binds to 6x Histidine tag and is directly conjugated to DyLight 550. This is of advantage to shorten assay time by no need to use a secondary antibody to 6x Histidine tag. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Mouse anti-6x Histidine is a primary antibody which binds to 6x Histidine tag and is directly conjugated to HRP. This is of advantage to shorten assay time by no need to use a secondary antibody to 6x Histidine tag.
Mouse anti-6x Histidine is a primary antibody which binds to 6x Histidine tag and is directly conjugated to DyLight 650. This is of advantage to shorten assay time by no need to use a secondary antibody to 6x Histidine tag. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Host Animal:
Mouse
Immunogen:
Polyhistidine (HHHHHH) tagged polypeptide
Applications:
High throughput screening (HTS), Immunofluorescence (IF), Immunohistochemisty (IHC), Western blot (WB)
Mouse anti-6x Histidine is a primary antibody which binds to 6x Histidine tag and is directly conjugated to Biotin. This is of advantage to shorten assay time by no need to use a secondary antibody to 6x Histidine tag.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Mouse anti-DYKDDDDK is a primary antibody which binds to DYKDDDDK (Sigma FLAG ) and is directly conjugated to DyLight 488. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. Shelf life: 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Rabbit anti-HA is a primary antibody which binds to HA and is directly conjugated to SureLight R-Phycoerythrin. This is of advantage to shorten assay time by no need to use a secondary antibody to HA.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Rabbit anti-HA is a primary antibody which binds to HA and is directly conjugated to DyLight 488. This is of advantage to shorten assay time by no need to use a secondary antibody to HA. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Rabbit anti-HA is a primary antibody which binds to HA and is directly conjugated to DyLight 550. This is of advantage to shorten assay time by no need to use a secondary antibody to HA. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Rabbit anti-HA is a primary antibody which binds to HA and is directly conjugated to DyLight 650. This is of advantage to shorten assay time by no need to use a secondary antibody to HA. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Rabbit anti-V5 is a primary antibody which binds to V5 and is directly conjugated to ALP, Alkaline Phosphatase.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Rabbit anti-V5 is a primary antibody which binds to V5 and is directly conjugated to DyLight 488. This is of advantage to shorten assay time by no need to use a secondary antibody to V5. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Rabbit anti-V5 is a primary antibody which binds to V5 and is directly conjugated to DyLight 550. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Mouse anti-DYKDDDDK is a primary antibody which binds to DYKDDDDK (binds to Sigma FLAG ) and is directly conjugated to SureLight R-Phycoerythrin.
Product Type:
Antibody
Antibody Type:
Monoclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
Rabbit anti-V5 is a primary antibody which binds to V5 and is directly conjugated to DyLight 650. DyLight is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 2-8°C. The shelf life is 1 year from date of receipt. Prepare working dilution prior to use and then discard.
Rabbit anti-V5 is a primary antibody which binds to V5 and is directly conjugated to SureLight R-Phycoerythrin (R-PE).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store at 2-8°C. Product is stable for up to 4 weeks at 2-8°Cafter rehydration. For extended storage after rehydration, add an equal volume of glycerol and Store at -20 °C.
hCG is a protein secreted in large quantities by normal trophoblasts; the antibody detects cells and tumors of trophoblastic origin such as Choriocarcinoma. Large Cell Carcinoma and Adenocarcinoma of Lung demonstrate hCG positivity in 90% and 60% of cases respectively. 20% of Squamous Cell Lung Carcinomas are positive for hCG. hCG expression by nontrophoblastic tumors may indicate aggressive behavior since it has been observed that hCG may play a role in the host response to a given tumor.
Monosan Range:
MONOSAN
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Human alpha-sarcoglycan, also known as adhalin. Also crossreacts strongly with alpha-sarcoglycan in sections of muscle from mouse, rat, rabbit, hamster and pig. Does not react with chicken muscle.
Antibody Isotype:
IgG1
Monosan Range:
MONXtra
Clone:
Ad1/20A6
Concentration:
n/a
Storage buffer:
Tissue culture supernatant with sodium azide
Storage:
2-8°C
References 1:
Marafioti T et al. American Journal of Pathology. 162 (3): 861871 (2003)
References 2:
Hess J et al. Molecular and Cellular Biology. 21 (5): 15311539 (2001)
References 3:
Re D et al. Cancer Research. 61 (5): 20802084 (2001)
References 4:
Luo Y and Roeder R G. Molecular and Cellular Biology. 15 (8): 41154124 (1995)
This antibody reacts specifically with the MHC class II epitope present on Strain 13, but not on Strain 2 guinea pig cells. The antigen is also found in outbred Hartley guinea pigs.
Antibody Isotype:
IgG
Monosan Range:
MONOSAN
Clone:
(CI.13.1)
Concentration:
700 ul/ ml
Storage buffer:
cell culture supernatant with 0.7% BSA and 0.1% sodium azide
Mouse anti Guinea Pig CD90 antibody, clone CT4 recognizes guinea pig THY-1 (CD90), a small but heavily glycosylated member of the immunoglobulin superfamily. Clone CT4 was originally identified as recognizing a guinea pig homing receptor (Kraal et al. 1986) and later confirmed as recognizing the guinea pig homologue of human and rodent CD90 (Schäfer et al. 1999) by purification and microsequencing. Guinea Pig CD90 is notable for its level of N-linked glycosylation, rendering it an apparent molecular mass of ~36kDa, higher than that seen in most other species where CD90 has been identified and characterized. Guinea pig CD90 (according to Uniprot entry Q9WUR5) demonstrates 82% amino acid identity with human CD90, 74% with murine CD90 and 76% with rat.
Antibody Isotype:
IgG3
Monosan Range:
MONOSAN
Clone:
CT-4
Concentration:
500 ug/ ml
Storage buffer:
cell culture supernatant with 0.7% BSA and 0.1% sodium azide
The amine oxidase domain 2 (AOF2) gene encodes a nuclear protein (LSD1, ~95kDa) containing a Swirm domain, a FAD-binding motif, and an amine oxidase domain. This protein is a component of several histone deacetylase complexes, though it silences genes by functioning as a histone demethylase. LSD1 is a chromatin-modifying enzyme, which serve as a docking module for the stabilization of the associated corepressor complex (es) on chromatin.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
4°C -20°C for long term storage
Host Animal:
mouse
Immunogen:
Purified recombinant fragment of human LSD1 expressed in E. Coli.
Myosins are a large superfamily of motor proteins that move along actin filaments, while hydrolyzing ATP. Myosin is the major component of thick muscle filaments, and is a long asymmetric molecule containing a globular head and a long tail. The molecule consists of two heavy chains and four light chains. Activation of smooth and cardiac muscle primarily involves pathways which increase calcium and myosin phosphorylation resulting in contraction. Myosin light chain phosphatase acts to regulate muscle contraction by dephosphorylating activated myosin light chain. MYL3 encodes myosin light chain 3, an alkali light chain also referred to in the literature as both the ventricular isoform and the slow skeletal muscle isoform. Human myosin light chain has clinical application as a cardiac marker. Mutations in MYL3 have been identified as a cause of mid-left ventricular chamber type hypertrophic cardiomyopathy.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
4°C -20°C for long term storage
Host Animal:
mouse
Immunogen:
Purified recombinant fragment of MYL3 expressed in E. Coli.
The c-myc gene (8q24 on human chromosome) is the cellular homologue of the v-myc gene originally isolated from an avian myelocytomatosis virus. The c-Myc protein is a transcription factor (nuclear localization). c-Myc is commonly activated in a variety of tumor cells and plays an important role in cellular proliferation, differentiation, apoptosis and cell cycle progression. The phosphorylation of c-Myc has been investigated and previous studies have suggested a functional association between phosphorylation at Thr58/Ser62 by glycogen synthase kinase 3, cyclin-dependent kinase, ERK2 and C-Jun N-terminal Kinase (JNK) in cell proliferation and cell cycle regulation. In normal cells the expression of c-Myc is tightly regulated but in human cancers c-Myc is frequently deregulated. c-Myc is also essential for tumor cell development in vasculogenesis and angiogenesis that distribute blood throughout the cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Protect from prolonged exposure to light. Do not freeze.
Immunogen:
Synthetic peptide sequence (AEEQKLISEEDLL) corresponding to the C-terminal region of human c-Myc.
Applications:
FC
Additional Info:
The antibody 9E10 can be used to detect the c-Myc tag.
Clone number:
90000000000
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: Intracellular or extracellular staining, depending on particular expression. Recommended dilution: 1-5 ?g/ml.
The c-myc gene (8q24 on human chromosome) is the cellular homologue of the v-myc gene originally isolated from an avian myelocytomatosis virus. The c-Myc protein is a transcription factor (nuclear localization). c-Myc is commonly activated in a variety of tumor cells and plays an important role in cellular proliferation, differentiation, apoptosis and cell cycle progression. The phosphorylation of c-Myc has been investigated and previous studies have suggested a functional association between phosphorylation at Thr58/Ser62 by glycogen synthase kinase 3, cyclin-dependent kinase, ERK2 and C-Jun N-terminal Kinase (JNK) in cell proliferation and cell cycle regulation. In normal cells the expression of c-Myc is tightly regulated but in human cancers c-Myc is frequently deregulated. c-Myc is also essential for tumor cell development in vasculogenesis and angiogenesis that distribute blood throughout the cells.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
Store at 2-8°C. Do not freeze.
Immunogen:
Synthetic peptide sequence (AEEQKLISEEDLL) corresponding to the C-terminal region of human c-Myc.
Applications:
FC,IP,WB,IHC
Additional Info:
The antibody 9E10 can be used to detect the c-Myc tag.
Clone number:
90000000000
Antibody Isotype:
IgG1
Application Details:
Flow cytometry: Intracellular or extracellular staining, depending on particular expression. Recommended dilution: 1-5 ?g/ml.
The utrophin gene is located on chromosome 6. Analyte Specific Reagent. Analytical and performance characteristics are not established. Amino terminal domain of the human homolog of human dystrophin, utrophin (also known as dystrophin related protein or DRP). Also crossreacts with utrophin in sections of muscle from rat and dog. Other animals species have not been tested.The product 2 is a lyophilized tissue culture supernatant containing sodium azide as a preservative. The user is required to reconstitute the contents of the vial with the correct volume of sterile distilled water as indicated on the vial label.
The antibody reacts specificly with human Interleukin (IL-1)RII. The IL-1 system includes two agonists (IL-1alpha and IL-1beta), converting enzymes, antagonists, two receptors (IL-1RI and IL-1RII) and the IL-1 receptor accessory protein. The IL-1RII is part of the antagonistic IL-1 mechanism. It is also known as decoy receptor and is a non signalling molecule which functions by capturing IL-1 and preventing it from interacting with the signalling IL-1RI. The decoy IL-1RII can after binding to IL-1 also recruit the IL-1 receptor accessory protein and thus inhibit by coreceptor competition. Further a soluble form of IL-1RII exists which is shed, a process in which matrix metalloproteases have been found to play a role, by various cells including monocytes, polymorphonuclear cells, B cells and fibroblasts.
Antibody Isotype:
Ig
Monosan Range:
MONOSAN
Concentration:
100 ug/ ml
Storage buffer:
PBS with 0.1% BSA and 0.02% sodium azide
Storage:
2-8°C
References 1:
Mantovani; A et al. Ann N Y Acad Sci 1998; 840: 338
p27, also known as cyclin-dependent kinase inhibitor 1B (CDNK1B), is a kinase inhibitor that controls cell cycle progression.1-4 p27 is involved in G1 phase arrest and obstructs cell entry into the S phase by binding to and inhibiting cyclin E-CDK2, effectively slowing or stopping the cell division cycle.1-4 p27 is broadly expressed in normal tissue but can be dysfunctional in neoplastic tissue and, therefore, not expressed.
Antibody Isotype:
IgG1-k
Monosan Range:
MONOSAN Ready To Use
Clone:
SX53G8
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
hUC-MSCs strongly express MSC surface markers similar to Bone Marrow Stem Cells. Under optimal growth conditions, Umbical Cord-Derived Mesenchymal Stem Cells have been shown to be multipotent, capable of differentiating down adipogenic, osteogenic and chondrogenic lineages. The harvesting procedure is non-invasive, with umbilical cords obtained from women with healthy pregnancies during caesarean deliveries at the end of gestation.
Email us for more details - tech@nktscientific.com.
Background Info:
Product Quality Control:
Rigid quality control testing is performed for each batch (both cell donors and cell cultures). Cultured cells are tested for cell identity, purity, potency, viability and suitability for the intended use.
Before cryopreservation cultured MSCs (P2-P3) are characterised by flow cytometry analysis for identity by a comprehensive panel of markers [CD73/CD90/CD105 (positive) and CD14/CD34/CD45/HLA-DR (negative)] as proposed by the ISCTMSC committee position statement, 2006.
A multilineage differentiation assay into adipogenic and osteogenic directions is performed for each MSCs batch expanded in vitro. In addition, all donors and cell cultures have been screened for the absence of the following infectious agents: HIV-1/2, HBV, HCV, HSV1, HSV2, CMV, EBV, HHV6, Treponema pallidum, Toxoplasmagondii, Chlamydia trachomatis, Ureaplasma urealyticum, Ureaplasma parvum and microbial contaminants (bacteria & fungi,Mycoplasma hominis and Mycoplasma genitalium).
MSC cultures genetic stability is verified by karyotype evaluation (GTG banding).
Anti-desmin detects a protein that is expressed by cells of normal smooth, skeletal, and cardiac muscles. It has been suggested that desmin is primarily located at or near the periphery of Z lines in striated muscle fibrils. In smooth muscle, desmin interconnects cytoplasmic dense bodies with membrane bound dense plaques. Anti-desmin reacts with leiomyomas, leiomyosarcoma, rhabdomyomas, rhabdomyosarcoma, and perivascular cells of glomus tumors of the skin.This antibody is used to demonstrate the myogenic components/derivation of tumors. Desmin can also be present in myofibroblasts and be focally positive in desmoid fibromatosis.
Antibody Isotype:
IgG1-k
Monosan Range:
MONOSAN Ready To Use
Clone:
D33
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Kouloumenta A, Journal of Biological Chemistry. 2007; 282:35211-21
References 2:
Altmannsberger M, et al. Am J Pathol 1985; 118:85-95
Mab 414 reacts with myosin-containing elements in most cell types. Antigen localization: cytoplasm In Western blot experiments the antibody reacts with a 75kD part of the heavy chain (epitope location on a myosin-common site-chain), no reaction with light chains. <br>It is not reactive with alpha-cardiac myosin. Positive control: muscle, myofibrils (chicken)
Rubisco (Ribulose-1,5-bisphosphate carboxylase/oxygenase) catalyzes the rate-limiting step of CO2 fixation in photosynthetic organisms, It is demonstrably homologous from purple bacteria to flowering plants and consists of two protein subunits, each present in 8 copies, In plants and green algae, the large subunit (~55 kDa) is coded by the chloroplast rbcL gene, and the small subunit (15 kDa) is coded by a family of nuclear rbcS genes,
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Alpha proteobacteria, Algae (brown and red) including Galdieria sulphuraria, Dicots, Benincasa hispida, Kalanchoe fedtschenkoi; Beta-proteobacteria, Conifers, Cryptomonads, Cyanobacteria (prochlorophytes), Gamma-proeobacteria, Liverworts, Manihot esculenta, Monocots, Mosses, Suaeda glauca, Welwitschia; Nannochloropsis sp., Picochlorum sp., Zosteria marinaSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide conserved across all known plant, algal and cyanobacterial RbcL protein sequences (form I L8S8 and form II L2), including, Arabidopsis thaliana O03042, Hordeum vulgare P05698, Oryza sativa P0C510, Chlamydomonas reinhardtii P00877, Synechococcus PCC 7920 A5CKC5
No confirmed exceptions from predicted reactivity are currently known.
Special application note:
Anti-RbcL can be used as a cellular [compartment marker] of plastid stroma (cytoplasm in cyanobacteria) and detects RbcL protein from 31,25 fmoles, As both forms (I and II) are detected it is suitable for work with samples from Dinoflagellates, Haptophytes and Ochrophytes (diatoms, Raphidophytes, brown algae) as well as higher plants, DyLight 488 has Amax = 493 nm, Emax = 518 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
Rubisco (Ribulose-1,5-bisphosphate carboxylase/oxygenase) catalyzes the rate-limiting step of CO2 fixation in photosynthetic organisms. It is demonstrably homologous from purple bacteria to flowering plants and consists of two protein subunits, each present in 8 copies. In plants and green algae, the large subunit (~55 kDa) is coded by the chloroplast rbcL gene, and the small subunit (15 kDa) is coded by a family of nuclear rbcS genes.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Alpha proteobacteria, Algae (brown and red) including Galdieria sulphuraria, Dicots, Benincasa hispida, Kalanchoe fedtschenkoi; Beta-proteobacteria, Conifers, Cryptomonads, Cyanobacteria (prochlorophytes), Gamma-proeobacteria, Liverworts, Manihot esculenta, Monocots, Mosses, Suaeda glauca, Welwitschia; Nannochloropsis sp., Picochlorum sp., Zosteria marinaSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide conserved across all known plant, algal and cyanobacterial RbcL protein sequences (form I L8S8 and form II L2), including, Arabidopsis thaliana O03042, Hordeum vulgare P05698, Oryza sativa P0C510, Chlamydomonas reinhardtii P00877, Synechococcus PCC 7920 A5CKC5
No confirmed exceptions from predicted reactivity are currently known,
Special application note:
Anti-RbcL can be used as a cellular [compartment marker] of plastid stroma (cytoplasm in cyanobacteria) and detects RbcL protein from 31,25 fmoles, As both forms (I and II) are detected it is suitable for work with samples from Dinoflagellates, Haptophytes and Ochrophytes (diatoms, Raphidophytes, brown algae) as well as higher plants.DyLight 594 has Amax = 593 nm, Emax = 618 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
Rubisco (Ribulose-1,5-bisphosphate carboxylase/oxygenase) catalyzes the rate-limiting step of CO2 fixation in photosynthetic organisms. It is demonstrably homologous from purple bacteria to flowering plants and consists of two protein subunits, each present in 8 copies. In plants and green algae, the large subunit (~55 kDa) is coded by the chloroplast rbcL gene, and the small subunit (15 kDa) is coded by a family of nuclear rbcS genes.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Alpha proteobacteria, Algae (brown and red) including Galdieria sulphuraria, Dicots, Benincasa hispida, Kalanchoe fedtschenkoi; Beta-proteobacteria, Conifers, Cryptomonads, Cyanobacteria (prochlorophytes), Gamma-proeobacteria, Liverworts, Manihot esculenta, Monocots, Mosses, Suaeda glauca, Welwitschia; Nannochloropsis sp., Picochlorum sp., Zosteria marinaSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide conserved across all known plant, algal and cyanobacterial RbcL protein sequences (form I L8S8 and form II L2), including, Arabidopsis thaliana O03042, Hordeum vulgare P05698, Oryza sativa P0C510, Chlamydomonas reinhardtii P00877, Synechococcus PCC 7920 A5CKC5
No confirmed exceptions from predicted reactivity are currently known,
Special application note:
Anti-RbcL can be used as a cellular [compartment marker] of plastid stroma (cytoplasm in cyanobacteria) and detects RbcL protein from 31,25 fmoles, As both forms (I and II) are detected it is suitable for work with samples from Dinoflagellates, Haptophytes and Ochrophytes (diatoms, Raphidophytes, brown algae) as well as higher plants. DyLight 650 has Amax = 652 nm, Emax = 672 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
> 90% based on SDS-PAGE Small amounts of intact IgG may be present.
Host:
Donkey
Immunogen:
Purified Mouse IgG, whole molecule
Buffer:
30 mM Triethanolamine, pH 7.2, 5 mM Magnesium Chloride, 0.1 mM Zinc Chloride, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Storage:
Store undiluted liquid at 2-8 °C. For storage at -20 °C, dilute with an equal volume of glycerol to prevent loss of enzymatic activity. Prepare working dilutions prior to use and then discard.
Shelf Life:
1 year from date of receipt. Prepare working dilution prior to use and then discard.
Specificity:
Based on IEP, this antibody reacts with: · heavy (γ) chains on mouse IgG · light chains on all mouse immunoglobulins
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin mouse serum immunoglobulins · IgG from bovine, chicken, goat, guinea pig, hamster, horse, human, rabbit, rat or sheep
Country Of Origin:
Donkey serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Prokaryotic recombinant protein corresponding to a region which spans the tyrosine kinase catalytic domain and part of the C-terminus of the NPM-ALK transcript (419-520??).
Anaplastic large cell lymphoma (ALCL) is usually composed of large pleomorphic cells which are reported to express CD30 antigen and epithelial membrane antigen (EMA). These tumor cells tend to occur in younger individuals and may be associated with cutaneous and extranodal involvement. A proportion of these cases contain a chromosomal translocation t(2;5) (p23;q35). This results in a hybrid gene encoding part of the nucleophosmin (NPM) gene joined to the cytoplasmic domain of the anaplastic lymphoma kinase (ALK) gene, giving rise to the protein, p80. Large cell lymphomas account for approximately 25% of all non-Hodgkin's lymphomas in children and young adults, of which one third carry the NPM-ALK gene translocation.
Antibody Isotype:
IgG1
Monosan Range:
MONXtra
Clone:
5A4
Concentration:
Greater than or equal to 32 mg/L
Storage buffer:
Tissue culture supernatant with 15mM sodium azide
Storage:
2-8°C
References 1:
Liu A et al. Acta Histochemica et Cytochemica. 2004; 37(1):21-30
Alpha-fetoprotein (AFP) is a fetal tumor-associated polypeptide of the albuminoid gene family that binds and transports molecules in addition to many other proposed functions. This secretory protein is synthesized primarily in the fetal liver whereas expression is repressed in adult liver.Anti-AFP has been immunohistochemically demonstrated in hepatocellular carcinoma (HCC) and shows no immunoreactivity in normal liver.
Monosan Range:
MONOSAN
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Mizejewski GJ et al. Exp Biol Med. 2001; 226:377-408
References 2:
Lazarevich NL et al.Biochemistry (Mosc). 2000; 65:117-33
References 3:
Yusof YA, et al. Anal Quant Cytol Histol. 2003; 25:332-8
The antibody recognizes actin of skeletal, cardiac, and smooth muscle cells. It is not reactive with other mesenchymal cells except for myoepithelium. Muscle Specific Actin is a part of the actin family of proteins which are highly conserved, major components of the cytoskeleton. Anti-Muscle Specific Actin immunohistochemical reactivity is seen in skeletal, cardiac, and smooth muscle cells and can be seen in neoplasms with muscle differentiation such as leiomyomas and rhabdomyosarcomas. In contrast, antiMuscle Specific Actin reactivity is typically not seen in endothelial cells, connective tissues, carcinomas, melanomas, lymphomas and most nonmyogenic sarcomas
Antibody Isotype:
IgG1-k
Monosan Range:
MONOSAN
Clone:
HHF35
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Gown AM, et al. Am J Pathol. 1986; 125:191
References 2:
Schmidt RA, et al. Am J Pathol. 1988; 131:19-28
References 3:
Azumi N, et al.Mod Pathol. 1988; 1:469-74
References 4:
Rangdaeng S, et al. Am J Clin Pathol. 1991; 96:32-45
Oct-2 is a transcription factor of the POU homeo-domain family that binds to the Ig gene octamer sites, regulating B-cell-specific genes. These are involved in proliferation and differentiation and, despite the scarce evidence for Oct-2 expression in T cells, it has been shown that this factor participates in transcriptional regulation during T-cell activation. Oct-2 activity is dependent on phosphorylation and alternatitive splicing.Various lymphomas are also positive for this marker including the following: Bchronic lymphocytic leukemia, mantle cell lymphoma, follicular lymphoma, marginal zone lymphoma, plasmacytoma, Burkitt lymphoma, diffuse large cell lymphoma, diffuse large B-cell lymphoma, T-cell rich B-cell lymphoma, nodular lymphocyte predominant Hodgkin lymphoma, and classic Hodgkin lymphoma.
Antibody Isotype:
IgG1
Monosan Range:
MONOSAN Ready To Use
Clone:
MRQ-2
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Browne P, et al. Am J Clin Pathol. 2003; 120:767-77
References 2:
García-Cosío M, et al. Mod Pathol. 2004; 17:1531-8
References 3:
Gibson SE, et al. Am J Clin Pathol. 2006; 126:916-24
Botulinum toxin is a toxin produced by the anaerobic, gram-positive, bacterium of the genus Clostridium (C. botulinum, C. butyricum, C. baratii and C. argentinense). These strains are widely distributed and can be found in soil and dust. Eight types of botulinum toxin are distinguished, named type A–H. Type A and B are capable of causing disease in humans (botulism) and have longest activity in vivo, and are also used commercially (BOTOX) and medically. Types C–G are less common; types E and F can cause disease in humans, while the other types cause disease in other animals. BotA is cleaved into two chains: heavy and light.Alternative name: Bontoxilysin-A
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Chicken
Species Reactivity:
Botulinum toxin A heavy chain
Immunogen:
Purified Botulinum Neurotoxin Type A (Heavy Chain Binding Domain)
For direct ELISA coating with 2 g of Botulinium Toxin A is recommended combined with primary antibody dilution of 1: 10 000.For Western blot 0.5 g of non reduced holotoxin or heavy chains is recommended together with 1: 2000 dilution of a primary antibody.
The immunohistochemical staining of Alpha-1-Antitrypsin is considered to be very useful in the study of inherited AAT deficiency, benign and malignant hepatic tumors and yolk sac carcinomas. Positive staining for A-1-Antitrypsin may also be used in detection of benign and malignant lesions of an histiocytic nature. Sensitivity and specificity of the results have made this antibody a useful tool in the screening of patients with cryptogenic cirrhosis or other forms of liver disease with portal fibrosis of uncertain etiology.
Monosan Range:
MONOSAN
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Callea F, et al. J Hepatol. 1986; 2:389-401
References 2:
Palmer PE, et al.Am J Clin Pathol. 1974; 62:350-4
References 3:
Palmer PE, et al. Cancer. 1980; 45:1424-31
References 4:
Raintoft I, et al. Hum Pathol. 1979; 10:419-24
References 5:
Ramsay AD, et al. Appl Immunohistochem Mol Morphol. 2008; 16:140-7
CD15 antigen, also known as X-hapten, is reported to be expressed on 90% of circulating human granulocytes, 30-60% of circulating monocytes and is absent from normal lymphocytes. The CD15 antigen is also expressed on Reed Sternberg cells of Hodgkin's disease and some leukemias.
Antibody Isotype:
IgM
Monosan Range:
MONXtra
Clone:
MMA
Concentration:
n/a
Storage buffer:
Tissue culture supernatant with sodium azide
Storage:
2-8°C
References 1:
Mao X et al. Translational Oncology. 2009; 2(4): 247-257
References 2:
Wong A et al. The American Journal of Surgical Pathology. 2008; 32(8):1265-1268
References 3:
Pellegrini W et al. Haematalogica. 2007; 92(5):708-709
References 4:
Vassallo J et al. The American Journal of Surgical Pathology. 2006; 30(2):223-229
References 5:
Barry TS et al. The American Journal of Surgical Pathology. 2003; 27(12):1513-1522
FoxP3 (forkhead box protein 3), a highly conserved forkhead/winged-helix transcription factor, plays a crucial role in maintaining immune homeostasis by governing the development and function of regulatory T cells. It is constitutively expressed at high level in CD25+ CD4+ Treg cells and at low level in a CD25- CD4+ Treg cell subset. Defects in gene encoding FoxP3 protein cause the scurfy phenotype in mice, and in human the IPEX syndrome (immune dysfunction, polyendocrinopathy, enteropathy, X-linked syndrome), also known as X-linked autoimmunity-allergic dysregulation (XLAAD) syndrome.SpecificityThe antibody TU-30 recognizes C-terminus (amino acids 434-449 in human) of gamma-tubulin, a 48 kDa structural constituent of cytoskeleton and microtubule organizing center (MTOC). The epitope was located in the amino acid sequence TRPDYI (aa439-444 in human), which is present on human gamma-tubulin 1 but not on human gamma-tubulin 2.Application detailsWestern blotting: Recommended dilution: 2 ?g/ml. <br>Flow cytometry: Recommended dilution: 1-4 µg/ml. Intracellular staining.
Antibody Isotype:
IgG1 kappa
Monosan Range:
MONOSAN
Clone:
3G3
Concentration:
1 mg/ml
Format:
Purified by protein-A affinity chromatography.
Storage buffer:
Phosphate buffered saline (PBS), pH 7.4, 15 mM sodium azide
CD3s immunohistochemical detection locates the cytoplasmic component of CD3 protein. Anti-CD3 is considered to be a pan-T-cell marker and reacts with an antigen present at the surface and in the cytoplasm of T lymphocytes. Anti-CD3 is widely used for the identification of immature and mature T-cell malignancies.
Antibody Isotype:
IgG
Monosan Range:
MONOSAN Ready To Use
Clone:
MRQ-39
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Beverley PC, et al. Eur J Immunol.; 11:329-34 (1981)
References 2:
Hedvat CV, et al. Hum Pathol.; 33:968-74 (2002)
References 3:
Karube K, et al. Am J Surg Pathol.; 27:1366-74 (2003)
References 4:
Dogan A, et al. Am J Surg Pathol.; 27:903-11 (2003)
Neurofilaments (NF) are intermediate filaments that provide structural support to the neuronal cytoskeleton.1-3 They are heteropolymers composed of three NF subunits: NF-H, NF-M, and NF-L.2 Anti-NF labels neurons of the central and peripheral nervous system as well as neoplastic cells of neuronal origin.
Antibody Isotype:
IgG1-k
Monosan Range:
MONOSAN Ready To Use
Clone:
2F11
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Diepholder HM, et al. Cancer. 1991; 68:2192-201
References 2:
Lee M, et al. J. Cell Biol. 1993; 122:1337-50
References 3:
Trojanowski JQ, et al. Hum Pathol. 1984; 15:248-57
CD56, also known as neural cell adhesion molecule (NCAM), is a calcium-independent homophilic binding protein that belongs to a group of cell adhesion molecules including cadherins, selectins, and integrins. CD56 is involved in cellcell adhesion of neural cells during embryogenesis and is expressed on most neuroectodermally derived tissues. In normal tissue, anti-CD56 labels neurons, glia, schwann cells, NK (natural killer) cells, and a subset of T-cells.3 CD56 expression can be seen in most NK cell neoplasms, certain subtypes of T-cell lymphoma and in some plasma cell neoplasms. well
Antibody Isotype:
IgG1-k
Monosan Range:
MONOSAN Ready To Use
Clone:
123C3.D5
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Langdon, SP, et al. Cancer Research 1988;48(21):6161-6165
References 2:
Moolenaar, CE, et al. Cancer Research 1990;50(4):1102-1106
References 3:
Sumi M et al. Leuk Lymphoma. 2003 Jan; 44(1): 201-4
References 4:
Kibbelaar, RE, et al. Euro J of Cancer 1991;27(4):431-435
References 5:
Michalides, R, et al. International J of Cancer Sup 1994;8:34-37
This antibody reacts with Human IgE (ε chain). IgE evaluation of patients with suspected diseases associated with elevations in total immunoglobulin E (IgE), including allergic disease, primary immunodeficiencies, infections, malignancies, or other inflammatory diseases.
Concentration:
1.0 mg/ml (E 1% at 280 nm = 13.0)
Conjugate:
DyLight® 650 (Ex = 652 nm; Em = 672 nm)
Form:
Lyophilized
Purification:
Affinity purified using solid phase Human IgE
Purity:
Affinity purified antibody is > 95% based on SDS-PAGE
Host:
Goat
Immunogen:
Purified Human IgE, (ε) chain
Buffer:
10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2, 1 % (w/v) BSA, Protease/IgG free
Preservative:
0.05% (w/v) Sodium Azide
Reconstitution:
Rehydrate with 1.1 ml of deionized water and let stand 30 minutes at room temperature to dissolve. (Product has been overfilled to ensure complete recovery.) Centrifuge to remove any particulates. Prepare fresh working dilution daily.
Storage:
Store freeze-dried powder at 2-8 °C.
Shelf Life:
Product is stable for up to 4 weeks at 2-8°C after rehydration. For extended storage after rehydration, add an equal volume of glycerol and store at -20°C.
Specificity:
Based on IEP, this antibody reacts with: · heavy (ε) chains on human IgE
Cross Reactivity:
Based on IEP, no reactivity is observed to: · non-immunoglobulin human serum immunoglobulins · light chains on all human immunoglobulins · serum proteins from bovine, mouse or rabbit
Country Of Origin:
Goat serum was obtained from healthy animals of US origin and under the care of a registered veterinarian.
Disclaimer:
For in vitro Laboratory Use Only. Not for diagnostic or therapeutic use. Not for human or animal consumption. Suggested applications of our products are not recommendations to use our products in violation of any patent or as a license under any patent of ImmunoReagents, Inc. Product may not be resold or modified for resale without prior written approval of ImmunoReagents, Inc.
Accession Number:
AAD41757
Trademark:
DyLight® is a trademark of Thermo Fisher Scientific, Inc. and its subsidiaries.
γ-glutamyl-cysteine is a precursor of glutathione and is synthesized by linkage of glutamate and cysteine by γ-glutamylcysteine synthetase. Synonymes:gamma-glutamyl-cysteine, γ-glutamyl-cysteine. Alternative names: γ-EC, γ-Glu-Cys.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Cucurbita pepo L. subsp. peop var. styriaca Greb, Nicotiana tabacum cv. samsun
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
γ-glutamyl-cysteine (gamma-EC) linked by glutaraldehyde
Immunogold labeling for electron microscopyBlock ultrathin sections (80nm) prepared for immunogold labeling with 2% bovine serum albumine (BSA) in phosphate buffered saline (PBS, pH 7.2). Then treat the sections with the primary antibody (anti-γ-glutamylcysteine rabbit polyclonal IgG) diluted 1:50 in PBS containing 1% BSA for 2 h at room temperature. After a short rinse in PBS (3 X 5 min), incubate samples with a gold-conjugated secondary antibody (goat anti-rabbit IgG; eg. 10nm) diluted 1:50 in PBS including 1% BSA for 90 min at room temperature. After a short wash in PBS (2 X 5 min), and distilled water (3 X 5 min) observe grids under a transmission electron microscope.
Application Details:
1 : 50 (ICC), (IG)
Purity:
Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 100 l of sterile water per tube
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Koffler et al. (2011). Subcellular distribution of glutathione precusors in Arabidopsis thaliana. Journal of Integrative Plant Biology. 53: 930-941.
The antibody reacts with neuroendocrine cells of human adrenal medulla, carotid body, skin, pituitary, thyroid, lung, pancreas, and gastrointestinal mucosa. This antibody identifies normal neuroendocrine cells and neuroendocrine neoplasms. Diffuse, finely granular, cytoplasmic staining is observed, which probably correlates with the distribution of the antigen within neurosecretory vesicles. The expression of synaptophysin is independent of the presence of NSE or other neuroendocrine markers. Antisynaptophysin is an independent, broad-range marker of neural and neuroendocrine differentiation.
Antibody Isotype:
IgG
Monosan Range:
MONOSAN Ready To Use
Clone:
MRQ-40
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Wiedenmann, B, et al. Cell 1985;41:1017-1028
References 2:
Navone, F et al. J Cell Biol 1986;103:2511-2527
References 3:
Lyda MH et al. Hum Pathol. 2000 Aug;31(8):980-7
References 4:
Skacel M et al. Appl Immunohistochem Mol Morphol. 2000 Sep;8(3):302-9
Anti-CEA specifies a group of proteins in the Carcinoembryonic Antigen (CEA) family of proteins which are present in the epithelia of various types and tumors (both benign and malignant) derived from such epithelia. Such tissues are represented by the epithelia of colon, bronchus, alveoli, breast, pancreas, biliary tract, superficial layer and parietal layers of the stomach. Predominately biliary canaliculi are labelled in the liver and this factor is useful in the diagnosis of hepatocelluar carcinoma. Anti-CEA has been quite useful in differentiating adenocarcinoma of the lung vs. mesothelioma. Associated products: CK 5/6, Calretinin, WT-1, E-Cadherin, TTF-1, TAG-72, EMA, CK 20
Monosan Range:
MONOSAN
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Shield PW, et al. Am J Clin Pathol. 1996; 105:157-62
References 2:
Sheahan K, et al. Am J Clin Pathol. 1990; 94:157-64
The antibody detects astrocytes, Schwann cells, satellite cells, enteric glial cells, and some groups of ependymal cells. This marker is mainly used to distinguish neoplasms of astrocytic origin from other neoplasms in the central nervous system.
Antibody Isotype:
IgG
Monosan Range:
MONOSAN Ready To Use
Clone:
EP672Y
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Jessen, KR, et al. J Neurosci 1983;3:2206-2218
References 2:
Regner A et al. J Neurotrauma. 2001 Aug;18(8):783-92
References 3:
Nagashima G et al. Clin Neurol Neurosurg. 2002 May;104(2):125-31
References 4:
Choi, BH, et al. Science 1984;223:407-409
References 5:
Viale, G, et al. Virchows Arch A Pathol Anat 1991;418:339-348
Carbohydrate Antigen 19-9 (CA19-9) is a sialylated Lewis A blood group antigen. It is synthesized by glycosyltransferases and has been identified as a component of gangliosides, glycoproteins and mucins. Anti-CA19-9 reacts with epithelial cells of normal pancreas, stomach, and colon as well as various adenocarcinomas, including pancreatic, gastric, and colorectal adenocarcinomas.
Antibody Isotype:
IgM
Monosan Range:
MONOSAN Ready To Use
Clone:
121SLE
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Encabo G, et al., Bull cancer (Paris) 1986;73:256-9
References 2:
Wu E, et al. Clin Adv Hematol Oncol. 2013; 11:535
References 3:
Partyka K, et al. Proteomics. 2012; 12:2212-20
References 4:
Remmers N, et al. Clin Cancer Res. 2013; 19:1981-93
Dystrophin is the 427kD protein product of the DMD gene located on the X chromosome at position Xp21. Analyte Specific Reagent. Analytical and performance characteristics are not established. Product is a lyophilized tissue culture supernatant containing sodium azide as a preservative. The user is required to reconstitute the contents of the vial with the correct volume of sterile distilled water as indicated on the vial label.
Antibody Isotype:
IgG1, kappa
Monosan Range:
MONXtra
Clone:
34C5
Concentration:
n/a
Storage buffer:
Lyophilized
Storage:
2-8°C
References 1:
Blake DJ et al. Physiological Reviews. 82 (2): 291329 (2002)
References 2:
Oliveira AS et al. Arq Neuropsiquiatr. 50 (4): 478485 (1992
References 3:
Haginoya K et al. Journal of Neurology. 238 (7): 375378 (1991)
Dystrophin is the 427kD protein product of the DMD gene located on the X chromosome at position Xp21. Analyte Specific Reagent. Analytical and performance characteristics are not established. Lyophilized tissue culture supernatant containing 15 mM sodium azide. Reconstitute with the volume of sterile distilled water indicated on the vial label.
Antibody Isotype:
IgG1
Monosan Range:
MONXtra
Clone:
13H6
Concentration:
n/a
Storage buffer:
Lyophilized
Storage:
2-8°C
References 1:
Blake DJ et al. Physiological Reviews. 82 (2): 291329 (2002)
SPS (sucrose phosphate synthase, EC 2,4,1,14) is the key enzyme of carbon flux into sucrose fixation in plants, It catalyzes the synthesis of sucrose-phosphate from UDP-glucose and fructose-6-phosphate predominantly in the cytosol of sucrose-source leaf tissue.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Brassica napus, Citrus sinensis, Glycine max, Nicotiana tabacum, Oryza sativa, Physcomitrella patens, Populus balsamifera, Robinia pseudoacaci, Ricinus communis, Saccharum officinarum, Solanum lycopersicum, Theobroma cacao, Vicia faba, Vitis vinifera Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from conserved region within plant SPS protein sequences, including Arabidopsis thaliana isoforms 1F Q94BT0, 2F, 3F and 4F. Oryza sativa Q67WN8, Solanum tuberosum Q43845
SPS (sucrose phosphate synthase, EC 2.4.1.14) is the key enzyme of carbon flux into sucrose fixation in plants. It catalyzes the synthesis of sucrose-phosphate from UDP-glucose and fructose-6-phosphate predominantly in the cytosol of sucrose-source leaf tissue.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Brassica napus, Citrus sinensis, Glycine max, Nicotiana tabacum, Oryza sativa, Physcomitrium patens, Populus balsamifera, Robinia pseudoacaci, Ricinus communis, Saccharum officinarum, Solanum lycopersicum, Theobroma cacao, Vicia faba, Vitis vinifera Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from conserved region within plant SPS protein sequences, including Arabidopsis thaliana isoforms 1F Q94BT0, 2F, 3F and 4F. Oryza sativa Q67WN8, Solanum tuberosum Q43845
PEPC (phosphoenolpyruvate carboxylase), EC=4.1.1.31, belongs to an enzyme family of carboxy-lyases that is catalyzing adding fo carbon dioxide to phosphoenolpyruvate (PEP) to form oxaloacetate. Alternative names: PEPCase 1, PEPCase 3, PEPC 1, PEPC 3
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
KLH-conjugated synthetic peptide well conserved PEPC1 and sequences from different plant species including Arabidopsis thaliana Q9MAH0, At1g53310 (PEPC 1), Q84VW9, At3g14940 (PEPC 3). The peptide chosen to elicit this antibody is also perfectly conserved in bacterial type of this enzyme NP_177043.2 (PEPC 4)
PRK ribulose-5-P-kinase| phosphoribulokinase is an enzyme that catalyzes the chemical reaction ATP + D-ribulose 5-phosphate to ADP + D-ribulose 1,5-bisphosphate.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
PRK ribulose-5-P-kinase| phosphoribulokinase is an enzyme that catalyzes the chemical reaction ATP + D-ribulose 5-phosphate to ADP + D-ribulose 1,5-bisphosphate
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
PRK ribulose-5-P-kinase phosphoribulokinase is an enzyme that catalyzes the chemical reaction ATP + D-ribulose 5-phosphate to ADP + D-ribulose 1,5-bisphosphate.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 650.
Molecular Weight:
44 | 39 kDa (A. thaliana)
Not reactive in:
Proteobacteria
Selected references:
To be added when available. Antibody released in May 2023.
Special application note:
Antibody can be used as a marker of chloroplast stroma.DyLight 650 has Amax = 652 nm, Emax = 672 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
AGO1 belongs to a group of argonaute proteins which are catalytic component of the RNA-incudes silencing complex (RISC). This protein complex is responsible for the gene silencing (RNAi).This antibody is directly conjugated to Biotin.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Brassica pekinensis, Capsella rubella, Malus domestica, Pisum sativum, Ricinus communis, Vitis vinifera Species of your interest not listed? Contact us
Immunogen:
KLH-conugated N-terminal peptide of Arabidopsis thaliana AGO1 UniProt: O04379, TAIR:At1g48410.
AGO expression may be tissue specific and using floral tissue is recommended where most of the AGOs are expressed the highest. Use of proteasome inhibitors as MG132 can help to stabilize AGO proteins during extraction procedure.The AGO1 antibody is extremely specific to AGO1 and does not cross-react with other antibodies. The evidence is 1) the peptide to which it was raised is at the very N-terminus of the protein and is not present in other AGOs 2) aAGO1 does not cross react with the AGOs which are overexpressed (AGO2, AGO3, AGO4, AGO5, AGO6, AGO9) using a western blot.
Application Details:
1 : 1000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4, conjugated to biotin.
Molecular Weight:
116,4 | 130 kDa
Not reactive in:
Chlamydomonas reinhardtii
Special application note:
Antibody binds microRNA and tasiRNAs, preference for 21nt miRNAs with 5'U.TCA acetone total protein precipitation method
AGO1 belongs to a group of argonaute proteins which are catalytic component of the RNA-incudes silencing complex (RISC). This protein complex is responsible for the gene silencing (RNAi).This antibody is directly conjugated to Horseradish Peroxidase (HRP).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
AGO expression may be tissue specific and using floral tissue is recommended where most of the AGOs are expressed the highest. Use of proteasome inhibitors as MG132 can help to stabilize AGO proteins during extraction procedure.The AGO1 antibody is extremely specific to AGO1 and does not cross-react with other antibodies. The evidence is 1) the peptide to which it was raised is at the very N-terminus of the protein and is not present in other AGOs 2) aAGO1 does not cross react with the AGOs which are overexpressed (AGO2, AGO3, AGO4, AGO5, AGO6, AGO9) using a western blot.
Application Details:
1 : 1000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4, conjugated to HRP.
AGO1 belongs to a group of argonaute proteins which are catalytic component of the RNA-incudes silencing complex (RISC), This protein complex is responsible for the gene silencing (RNAi),This antibody is directly conjugated to Horseradish Peroxidase (HRP).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Nicotiana benthamiana
Expected Species:
Brassica pekinensis, Capsella rubella, Glycine max, Malus domestica, Pisum sativum, Ricinus communis, Solanum tuberosum, Zea mays, Vitis viniferaSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated, N-terminal peptide of Arabidopsis thaliana AGO1 O04379, At1g48410
AGO expression may be tissue specific and using floral tissue is recommended where most of the AGOs are expressed the highest. Use of proteasome inhibitors as MG132 can help to stabilize AGO proteins during extraction procedure. The AGO1 antibody is extremely specific to AGO1 and does not cross-react with other antibodies. The evidence is 1) the peptide to which it was raised is at the very N-terminus of the protein and is not present in other AGOs 2) aAGO1 does not cross react with the AGOs which are overexpressed (AGO2, AGO3, AGO4, AGO5, AGO6, AGO9) using a western blot.
Application Details:
To be determined by end user.
Purity:
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 650.
To be added when available. Antibody released in May 2023.
Special application note:
Antibody binds microRNA and tasiRNAs, preference for 21nt miRNAs with 5'U, TCA acetone total protein precipitation method.DyLight 650 has Amax = 652 nm, Emax = 672 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
AGO1 belongs to a group of argonaute proteins which are catalytic component of the RNA-incudes silencing complex (RISC). This protein complex is responsible for the gene silencing (RNAi). This antibody is directly conjugated to Horseradish Peroxidase (HRP).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Nicotiana benthamiana
Expected Species:
Brassica pekinensis, Capsella rubella, Malus domestica, Pisum sativum, Ricinus communis, Vitis viniferaSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated, N-terminal peptide of Arabidopsis thaliana AGO1 O04379, At1g48410
AGO expression may be tissue specific and using floral tissue is recommended where most of the AGOs are expressed the highest. Use of proteasome inhibitors as MG132 can help to stabilize AGO proteins during extraction procedure. The AGO1 antibody is extremely specific to AGO1 and does not cross-react with other antibodies. The evidence is 1) the peptide to which it was raised is at the very N-terminus of the protein and is not present in other AGOs 2) aAGO1 does not cross react with the AGOs which are overexpressed (AGO2, AGO3, AGO4, AGO5, AGO6, AGO9) using a western blot.
Application Details:
To be determined by end user.
Purity:
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 594.
Molecular Weight:
116,4 | 130 kDa
Not reactive in:
Chlamydomonas reinhardtii
Selected references:
To be added when available. Antibody released in May 2023.
Special application note:
Antibody binds microRNA and tasiRNAs, preference for 21nt miRNAs with 5'U,TCA acetone total protein precipitation method.DyLight 594 has Amax = 593 nm, Emax = 618 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
AGO1 belongs to a group of argonaute proteins which are catalytic component of the RNA-incudes silencing complex (RISC), This protein complex is responsible for the gene silencing (RNAi).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Nicotiana benthamiana
Expected Species:
Brassica pekinensis, Capsella rubella, Glycine max, Malus domestica, Pisum sativum, Ricinus communis, Solanum tuberosum, Zea mays, Vitis viniferaSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated, N-terminal peptide of Arabidopsis thaliana AGO1 O04379, At1g48410
AGO expression may be tissue specific and using floral tissue is recommended where most of the AGOs are expressed the highest. Use of proteasome inhibitors as MG132 can help to stabilize AGO proteins during extraction procedure. The AGO1 antibody is extremely specific to AGO1 and does not cross-react with other antibodies. The evidence is 1) the peptide to which it was raised is at the very N-terminus of the protein and is not present in other AGOs 2) aAGO1 does not cross react with the AGOs which are overexpressed (AGO2, AGO3, AGO4, AGO5, AGO6, AGO9) using a western blot.
Application Details:
To be determined by end user.
Purity:
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 488.
Molecular Weight:
116,4 | 130 kDa
Not reactive in:
Chlamydomonas reinhardtii
Selected references:
To be added when available. Antibody released in May 2023.
Special application note:
Antibody binds microRNA and tasiRNAs, preference for 21nt miRNAs with 5'U,TCA acetone total protein precipitation method.DyLight 488 Amax = 493 nm, Emax = 519 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
AGO1 belongs to a group of argonaute proteins which are catalytic component of the RNA-incudes silencing complex (RISC). This protein complex is responsible for the gene silencing (RNAi).This antibody is directly conjugated to Alkaline Phosphatase (ALP).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
AGO expression may be tissue specific and using floral tissue is recommended where most of the AGOs are expressed the highest. Use of proteasome inhibitors as MG132 can help to stabilize AGO proteins during extraction procedure.The AGO1 antibody is extremely specific to AGO1 and does not cross-react with other antibodies. The evidence is 1) the peptide to which it was raised is at the very N-terminus of the protein and is not present in other AGOs 2) aAGO1 does not cross react with the AGOs which are overexpressed (AGO2, AGO3, AGO4, AGO5, AGO6, AGO9) using a western blot.TCA acetone precipitation method
Application Details:
1 : 1000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4, conjugated to ALP.
SPS (sucrose phosphate synthase, EC 2.4.1.14) is the key enzyme of carbon flux into sucrose fixation in plants. It catalyzes the synthesis of sucrose-phosphate from UDP-glucose and fructose-6-phosphate predominantly in the cytosol of sucrose-source leaf tissue.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Brassica napus, Citrus sinensis, Glycine max, Nicotiana tabacum, Oryza sativa, Physcomitrium patens, Populus balsamifera, Robinia pseudoacaci, Ricinus communis, Saccharum officinarum, Solanum lycopersicum, Theobroma cacao, Vicia faba, Vitis viniferaSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from conserved region within plant SPS protein sequences, including Arabidopsis thaliana isoforms 1F Q94BT0, 2F, 3F and 4F. Oryza sativa Q67WN8, Solanum tuberosum Q43845
The psbA gene has been cloned from many species of plants, green algae, and cyanobacteria. The psbA gene is located in the chloroplast genome and encodes for the D1 protein, a core component of Photosystem II. PsbA/D1 is rapidly cycled under illumination in all oxygenic photobionts. Tracking PsbA pools using the Global PsbA antibody can show the functional content of Photosystem II in a wide range of samples. Alternative names: 32 kDa thylakoid membrane protein, photosystem II protein D1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Algae (brown and red), Dictos, Conifers, Cyanobacteria, Medicago sativa, Nannochloropsis sp., Pisum sativum, Triticum aestivum, cellular [compartment marker] of thylakoid membraneSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from available plant, algal and cyanobacterial PsbA sequences, including Arabidopsis thaliana UniProt: A4QJR4, TAIR: AtCg00020 , Oryza sativa P0C434, Populus alba Q14FH6, Physcomitrella patens Q6YXN7, Chlamydomonas reinhardtii P07753, Synechocystis sp. P14660 and many others
The antibody is appropriate for detecting both, 24 kDa or the 10 kDa C-terminal fragments, whichever is generated under given treatment conditions. In our analysis we have seen both, ca. 24 kDa and ca. 10 kDa fragments from different samples, depending on treatments and isolation procedures.Rabbit anti-PsbA antibody can detect more than one band of PsbA protein, e.g. precursor and mature protein as compare to the chicken anti-PsbA antibodies AS01 016.This antibody will detect the phosphorylated form of D1 as an alternate band to the main band on a high resolution gel.The antibody will bind to cross-linked proteins: D1/D2, D1/cyt b559, D1/CP43.
Application Details:
1 : 15 000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4, conjugated to biotin.
Molecular Weight:
38 | 28-30 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Due to biology of PsbA (D1) protein a number of degradation products can apprear in a sample and may be observed when using anti-PsbA antibodies, including products having apparent molecular weights of 24kDa and 16kDa. D1 degradation is a complex set of events and the products observed can be influenced by both the extraction procedure and the physiology of the cells prior to harvest. Third, cross-linking may occur between D1 and cytochrome b559, shifting the protein higher in the gel. In cyanobacteria (PCC7942), three different bands were competed out by preincubating the antibody with the PsbA free peptide, indicating that all bands are indeed PsbA and its precursors or breakdown products. Competition assays were also performed with spinach and Chlamydomonas, confirming the identity of PsbA bands.Anti-PsbA antibodies will not detect D2 protein, as the peptide used to generate PsbA antibodies has no homology to the D2 sequence.
PRK ribulose-5-P-kinase| phosphoribulokinase is an enzyme that catalyzes the chemical reaction ATP + D-ribulose 5-phosphate to ADP + D-ribulose 1,5-bisphosphate.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 594.
Molecular Weight:
44 | 39 kDa (A. thaliana)
Not reactive in:
Proteobacteria
Selected references:
To be added when available. Antibody released in May 2023.
Special application note:
Antibody can be used as a marker of chloroplast stroma.DyLight 594 has Amax = 593 nm, Emax = 618 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
PRK ribulose-5-P-kinase| phosphoribulokinase is an enzyme that catalyzes the chemical reaction ATP + D-ribulose 5-phosphate to ADP + D-ribulose 1,5-bisphosphate.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 488.
Molecular Weight:
44 | 39 kDa (A. thaliana)
Not reactive in:
Proteobacteria
Selected references:
To be added when available. Antibody released in May 2023.
Special application note:
Antibody can be used as a marker of chloroplast stroma.DyLight 488 Amax = 493 nm, Emax = 519 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
VDAC proteins are porin-type, beta-barrel diffusion pores. Prominently localized in the outer mitochondrial membrane and involved in metabolite exchange.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Amount of mitochondrial fraction detected by anti-VDAC1 antibody was from 2-10 g.Immunolocalization method description and images are available hereBlue-native (2D BN/SDS-PAGE) methodology is described in Piechota et al. 2010
Application Details:
1 : 500 (IL), 1 : 5000, 2-30 g protein/lane (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4, conjugated to ALP.
VDAC proteins are porin-type, beta-barrel diffusion pores, Prominently localized in the outer mitochondrial membrane and involved in metabolite exchange,
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
To be added when available. Antibody released in May 2023.
Special application note:
Cellular [compartment marker] of mitochondrial outer membrane.DyLight 488 Amax = 493 nm, Emax = 519 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
SPS (sucrose phosphate synthase, EC 2.4.1.14) is the key enzyme of carbon flux into sucrose fixation in plants. It catalyzes the synthesis of sucrose-phosphate from UDP-glucose and fructose-6-phosphate predominantly in the cytosol of sucrose-source leaf tissue.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Brassica napus, Citrus sinensis, Glycine max, Nicotiana tabacum, Oryza sativa, Physcomitrium patens, Populus balsamifera, Robinia pseudoacaci, Ricinus communis, Saccharum officinarum, Solanum lycopersicum, Theobroma cacao, Vicia faba, Vitis vinifera Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from conserved region within plant SPS protein sequences, including Arabidopsis thaliana isoforms 1F Q94BT0, 2F, 3F and 4F. Oryza sativa Q67WN8, Solanum tuberosum Q43845
Rubisco (Ribulose-1,5-bisphosphate carboxylase/oxygenase) catalyzes the rate-limiting step of CO2 fixation in photosynthetic organisms. It is demonstrably homologous from purple bacteria to flowering plants and consists of two protein subunits, each present in 8 copies. In plants and green algae, the large subunit (~55 kDa) is coded by the chloroplast rbcL gene, and the small subunit (15 kDa) is coded by a family of nuclear rbcS genes.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Aalpha proteobacteria, Algae (brown and red), Dicots, Beta-proteobacteria, Conifers, Cryptomonads, Cyanobacteria (prochlorophytes), Gamma-proeobacteria, Liverworts, Monocots, Mosses, Suaeda glauca, Welwitschia; Nannochloropsis sp. Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide conserved across all known plant, algal and (cyano)bacterial RbcL protein sequences (form I L8S8 and form II L2), including Arabidopsis thaliana AtCg00490, Hordeum vulgare P05698, Oryza sativa P0C510, Chlamydomonas reinhardtii P00877, Synechococcus PCC 7920 A5CKC5
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Anti-RbcL can be used as a cellular [compartment marker] of plastid stroma (cytoplasm in cyanobacteria) and detects RbcL protein from 31,25 fmoles, As both forms (I and II) are detected it is suitable for work with samples from Dinoflagellates, Haptophytes and Ochrophytes (diatoms, Raphidophytes, brown algae) as well as higher plants, This antibody together with Agrisera Rubisco protein standard is very suitable to quantify Rubisco in plant and algal samples
PRK ribulose-5-P-kinase| phosphoribulokinase is an enzyme that catalyzes the chemical reaction ATP + D-ribulose 5-phosphate to ADP + D-ribulose 1,5-bisphosphate.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
PIPs proteins are aquaporins which facilitate the transport of water and small neutral molecules across cell membrane. Alternative names: PIP1-1, PIP1-2, PIP1-3, plasma membrane intrinistic protein 1a, 1b, 1c, PIP1a, PIP1b, PIP1c, plasma membrane aquaporin-1, transmembrane protein A, TMP-A, AthH2, transmembrane protein B, TMP-B,
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Brassica sp., Jatropha curcas L. cv. Biji Jarak , Mesembryantheum crystallinum, Populus nigra, Populus trichocarpa, Raphanus sativus, Thellungiella salsuginea
Expected Species:
Brassica sp., Hordeum vulgare, Juglans regia, Oryza sativa, Populus tremula, Triticum aestivum, Vicia fabaSpecies of your interest not listed? Contact us
Protein or membrane sample should be treated at 70 C for 10 min before loading on the gel.
Application Details:
1 : 1000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4, conjugated to biotin.
Molecular Weight:
30,68 | 28 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Antibodies will detect target protein in a few µg of a crude preparation loaded per well. If purified preparations of vacuolar and plasma membranes are used, one µg load per well should be sufficient
PIPs proteins are aquaporins which facilitate the transport of water and small neutral molecules across cell membrane. Alternative names: PIP1-1, PIP1-2, PIP1-3, plasma membrane intrinistic protein 1a, 1b, 1c, PIP1a, PIP1b, PIP1c, plasma membrane aquaporin-1, transmembrane protein A, TMP-A, AthH2, transmembrane protein B, TMP-B,
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Brassica sp., Jatropha curcas L. cv. Biji Jarak , Mesembryantheum crystallinum, Populus nigra, Populus trichocarpa, Raphanus sativus, Thellungiella salsuginea
Expected Species:
Brassica sp., Hordeum vulgare, Juglans regia, Oryza sativa, Populus tremula, Triticum aestivum, Vicia faba Species of your interest not listed? Contact us
Protein or membrane sample should be treated at 70 C for 10 min before loading on the gel.
Application Details:
1 : 1000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4, conjugated to HRP.
Molecular Weight:
30,68 | 28 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Antibodies will detect target protein in a few µg of a crude preparation loaded per well. If purified preparations of vacuolar and plasma membranes are used, one µg load per well should be sufficient
VDAC proteins are porin-type, beta-barrel diffusion pores, Prominently localized in the outer mitochondrial membrane and involved in metabolite exchange.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
To be added when available. Antibody released in May 2023.
Special application note:
Cellular [compartment marker] of mitochondrial outer membrane.DyLight 594 has Amax = 593 nm, Emax = 618 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
VDAC proteins are porin-type, beta-barrel diffusion pores, Prominently localized in the outer mitochondrial membrane and involved in metabolite exchange.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
To be added when available. Antibody released in May 2023.
Special application note:
Cellular [compartment marker] of mitochondrial outer membrane.DyLight 650 has Amax = 652 nm, Emax = 672 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
VDAC proteins are porin-type, beta-barrel diffusion pores. Prominently localized in the outer mitochondrial membrane and involved in metabolite exchange.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Amount of mitochondrial fraction detected by anti-VDAC1 antibody was from 2-10 g.Immunolocalization method description and images are available hereBlue-native (2D BN/SDS-PAGE) methodology is described in Piechota et al. 2010
Application Details:
1 : 500 (IL), 1 : 5000, 2-30 g protein/lane (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4, conjugated to HRP.
VDAC proteins are porin-type, beta-barrel diffusion pores. Prominently localized in the outer mitochondrial membrane and involved in metabolite exchange.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Amount of mitochondrial fraction detected by anti-VDAC1 antibody was from 2-10 g.Immunolocalization method description and images are available hereBlue-native (2D BN/SDS-PAGE) methodology is described in Piechota et al. 2010
Application Details:
1 : 500 (IL), 1 : 2000, 2-30 g protein/lane (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4, conjugated to biotin.
PIPs proteins are aquaporins which facilitate the transport of water and small neutral molecules across the cell membrane. Alternative names: PIP1-1, PIP1-2, PIP1-3, plasma membrane intrinsic protein 1a, 1b, 1c, PIP1a, PIP1b, PIP1c, plasma membrane aquaporin-1, transmembrane protein A, TMP-A, AthH2, transmembrane protein B, TMP-B.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Brassica sp,, Jatropha curcas L, cv, Biji Jarak , Mesembryantheum crystallinum, Populus nigra, Populus trichocarpa, Raphanus sativus, Thellungiella salsuginea
Expected Species:
Brassica sp., Hordeum vulgare, Juglans regia, Nicotiana tabacum, Oryza sativa, Populus tremula, Triticum aestivum, Vicia fabaSpecies of your interest not listed? Contact us
Protein or membrane sample should be treated at 70 C for 10 min before loading on the gel.
Application Details:
To be determined by end user.
Purity:
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 650.
Molecular Weight:
30,68 | 28 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known.
Selected references:
To be added when available. Antibody released in May 2023.
Special application note:
Antibodies will detect target protein in a few µg of a crude preparation loaded per well. If purified preparations of vacuolar and plasma membranes are used, one g load per well should be sufficient.DyLight 650 has Amax = 652 nm, Emax = 672 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
PIPs proteins are aquaporins which facilitate the transport of water and small neutral molecules across the cell membrane, Alternative names: PIP1-1, PIP1-2, PIP1-3, plasma membrane intrinsic protein 1a, 1b, 1c, PIP1a, PIP1b, PIP1c, plasma membrane aquaporin-1, transmembrane protein A, TMP-A, AthH2, transmembrane protein B, TMP-B.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Brassica sp,, Jatropha curcas L, cv, Biji Jarak , Mesembryantheum crystallinum, Populus nigra, Populus trichocarpa, Raphanus sativus, Thellungiella salsuginea
Expected Species:
Brassica sp., Hordeum vulgare, Juglans regia, Nicotiana tabacum, Oryza sativa, Populus tremula, Triticum aestivum, Vicia fabaSpecies of your interest not listed? Contact us
Protein or membrane sample should be treated at 70 C for 10 min before loading on the gel,
Application Details:
To be determined by end user.
Purity:
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 594.
Molecular Weight:
30,68 | 28 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known,
Selected references:
To be added when available. Antibody released in May 2023.
Special application note:
Antibodies will detect target protein in a few µg of a crude preparation loaded per well. If purified preparations of vacuolar and plasma membranes are used, one g load per well should be sufficient.DyLight 594 has Amax = 593 nm, Emax = 618 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
PEPC (phosphoenolpyruvate carboxylase), EC=4.1.1.31, belongs to an enzyme family of carboxy-lyases that is catalyzing adding fo carbon dioxide to phosphoenolpyruvate (PEP) to form oxaloacetate. Alternative names: PEPCase 1, PEPCase 3, PEPC 1, PEPC 3
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
KLH-conjugated synthetic peptide well conserved PEPC1 and sequences from different plant species including Arabidopsis thaliana Q9MAH0, At1g53310 (PEPC 1), Q84VW9, At3g14940 (PEPC 3). The peptide chosen to elicit this antibody is also perfectly conserved in bacterial type of this enzyme NP_177043.2 (PEPC 4)
PEPC (phosphoenolpyruvate carboxylase), EC=4,1,1,31, belongs to an enzyme family of carboxy-lyases that is catalyzing adding fo carbon dioxide to phosphoenolpyruvate (PEP) to form oxaloacetate, Alternative names: PEPCase 1, PEPCase 3, PEPC 1, PEPC 3.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
KLH-conjugated synthetic peptide well conserved PEPC1 and sequences from different plant species including Arabidopsis thaliana Q9MAH0, At1g53310 (PEPC 1), Q84VW9, At3g14940 (PEPC 3). The peptide chosen to elicit this antibody is also perfectly conserved in bacterial type of this enzyme NP_177043.2 (PEPC 4). For Zea mays, the peptide is converved in PEP1 and PEP4 isoforms.
PIPs proteins are aquaporins which facilitate the transport of water and small neutral molecules across the cell membrane. Alternative names: PIP1-1, PIP1-2, PIP1-3, plasma membrane intrinsic protein 1a, 1b, 1c, PIP1a, PIP1b, PIP1c, plasma membrane aquaporin-1, transmembrane protein A, TMP-A, AthH2, transmembrane protein B, TMP-B.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Brassica sp,, Jatropha curcas L, cv, Biji Jarak , Mesembryantheum crystallinum, Populus nigra, Populus trichocarpa, Raphanus sativus, Thellungiella salsuginea
Expected Species:
Brassica sp., Hordeum vulgare, Juglans regia, Nicotiana tabacum, Oryza sativa, Populus tremula, Triticum aestivum, Vicia fabaSpecies of your interest not listed? Contact us
Protein or membrane sample should be treated at 70 C for 10 min before loading on the gel.
Application Details:
To be determined by end user.
Purity:
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 488.
Molecular Weight:
30,68 | 28 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known.
Selected references:
To be added when available. Antibody released in May 2023.
Special application note:
Antibodies will detect target protein in a few µg of a crude preparation loaded per well. If purified preparations of vacuolar and plasma membranes are used, one µg load per well should be sufficient.DyLight 488 Amax = 493 nm, Emax = 519 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
The Plasma Membrane H+ATPase is a family of proteins of ca. 100 kDa that are believed to be exclusive to the plasma membranes of plants and fungi. The protein is anchored within biological membrane which creates an electrochemical gradient used as an energy source and is essential for uptake of most metabolites and plant responses to environment, for example movement of leaves.This antibody is directly conjugated to HRP.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
VERY IMPORTANT: Please, do not heat up your samples above 70 C as this may cause H+ATPase to precipitate, and there will be no signal on your Western Blot. Before SDS-PAGE, centrifuge your samples at room temperature at 10 000 rpm/1 min to remove any aggregates. H+ATPase will be less abundant in mature roots and leafs, and therefore detection may require use of very sensitive reagents.
Application Details:
1 : 600-1 : 1000 (IF), 1 : 1000-1 : 5 000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4, conjugated to HRP.
Molecular Weight:
90- 95 kDa (Arabidopsis thaliana, depending upon an isoform)
Rubisco (Ribulose-1,5-bisphosphate carboxylase/oxygenase) catalyzes the rate-limiting step of CO2 fixation in photosynthetic organisms. It is demonstrably homologous from purple bacteria to flowering plants and consists of two protein subunits, each present in 8 copies. In plants and green algae, the large subunit (~55 kDa) is coded by the chloroplast rbcL gene, and the small subunit (15 kDa) is coded by a family of nuclear rbcS genes.This antibody is directly conjugated to HRP.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Aalpha proteobacteria, Algae (brown and red), Dicots, Beta-proteobacteria, Conifers, Cryptomonads, Cyanobacteria (prochlorophytes), Gamma-proeobacteria, Liverworts, Monocots, Mosses, Suaeda glauca, Welwitschia; Nannochloropsis sp.Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide conserved across all known plant, algal and (cyano)bacterial RbcL protein sequences (form I L8S8 and form II L2), including Arabidopsis thaliana AtCg00490, Hordeum vulgare P05698, Oryza sativa P0C510, Chlamydomonas reinhardtii P00877, Synechococcus PCC 7920 A5CKC5
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Anti-RbcL can be used as a cellular [compartment marker] of plastid stroma (cytoplasm in cyanobacteria) and detects RbcL protein from 31,25 fmoles, As both forms (I and II) are detected it is suitable for work with samples from Dinoflagellates, Haptophytes and Ochrophytes (diatoms, Raphidophytes, brown algae) as well as higher plants, This antibody together with Agrisera Rubisco protein standard is very suitable to quantify Rubisco in plant and algal samples
PIPs proteins are aquaporins which facilitate the transport of water and small neutral molecules across cell membrane. Alternative names: PIP1-1, PIP1-2, PIP1-3, plasma membrane intrinistic protein 1a, 1b, 1c, PIP1a, PIP1b, PIP1c, plasma membrane aquaporin-1, transmembrane protein A, TMP-A, AthH2, transmembrane protein B, TMP-B,
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana, Brassica sp., Jatropha curcas L. cv. Biji Jarak , Mesembryantheum crystallinum, Populus nigra, Populus trichocarpa, Raphanus sativus, Thellungiella salsuginea
Expected Species:
Brassica sp., Hordeum vulgare, Juglans regia, Oryza sativa, Populus tremula, Triticum aestivum, Vicia faba Species of your interest not listed? Contact us
Protein or membrane sample should be treated at 70 C for 10 min before loading on the gel.
Application Details:
1 : 1000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4, conjugated to ALP.
Molecular Weight:
30,68 | 28 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Antibodies will detect target protein in a few µg of a crude preparation loaded per well. If purified preparations of vacuolar and plasma membranes are used, one µg load per well should be sufficient
The Plasma Membrane H+ATPase is a family of proteins of ca. 100 kDa that are believed to be exclusive to the plasma membranes of plants and fungi. The protein is anchored within biological membrane which creates an electrochemical gradient used as an energy source and is essential for uptake of most metabolites and plant responses to environment, for example movement of leaves.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
VERY IMPORTANT: Please, do not heat up your samples above 70 C as this may cause H+ATPase to precipitate, and there will be no signal on your Western Blot. Before SDS-PAGE, centrifuge your samples at room temperature at 10 000 rpm/1 min to remove any aggregates. H+ATPase will be less abundant in mature roots and leafs, and therefore detection may require use of very sensitive reagents.
Application Details:
1 : 600-1 : 1000 (IF), 1 : 1000-1 : 5 000 (WB)
Purity:
Antigen affinity purified serum in PBS pH 7.4, conjugated to DyLight 650.
Molecular Weight:
90- 95 kDa (Arabidopsis thaliana, depending upon an isoform)
To be added when available. Antibody released in October 2023.
Special application note:
Cellular [compartment marker] for plasma membrane.DyLight 650 has Amax = 652 nm, Emax = 672 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
PEPC (phosphoenolpyruvate carboxylase), EC=4,1,1,31, belongs to an enzyme family of carboxy-lyases that is catalyzing adding fo carbon dioxide to phosphoenolpyruvate (PEP) to form oxaloacetate, Alternative names: PEPCase 1, PEPCase 3, PEPC 1, PEPC 3.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
KLH-conjugated synthetic peptide well conserved PEPC1 and sequences from different plant species including Arabidopsis thaliana Q9MAH0, At1g53310 (PEPC 1), Q84VW9, At3g14940 (PEPC 3). The peptide chosen to elicit this antibody is also perfectly conserved in bacterial type of this enzyme NP_177043.2 (PEPC 4). For Zea mays, the peptide is converved in PEP1 and PEP4 isoforms.
PEPC (phosphoenolpyruvate carboxylase), EC=4,1,1,31, belongs to an enzyme family of carboxy-lyases that is catalyzing adding fo carbon dioxide to phosphoenolpyruvate (PEP) to form oxaloacetate, Alternative names: PEPCase 1, PEPCase 3, PEPC 1, PEPC 3.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
KLH-conjugated synthetic peptide well conserved PEPC1 and sequences from different plant species including Arabidopsis thaliana Q9MAH0, At1g53310 (PEPC 1), Q84VW9, At3g14940 (PEPC 3). The peptide chosen to elicit this antibody is also perfectly conserved in bacterial type of this enzyme NP_177043.2 (PEPC 4). For Zea mays, the peptide is converved in PEP1 and PEP4 isoforms.
The Plasma Membrane H+ATPase is a family of proteins of ca. 100 kDa that are believed to be exclusive to the plasma membranes of plants and fungi. The protein is anchored within biological membrane which creates an electrochemical gradient used as an energy source and is essential for uptake of most metabolites and plant responses to environment, for example movement of leaves.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
VERY IMPORTANT: Please, do not heat up your samples above 70 C as this may cause H+ATPase to precipitate, and there will be no signal on your Western Blot. Before SDS-PAGE, centrifuge your samples at room temperature at 10 000 rpm/1 min to remove any aggregates. H+ATPase will be less abundant in mature roots and leafs, and therefore detection may require use of very sensitive reagents.
Application Details:
1 : 600-1 : 1000 (IF), 1 : 1000-1 : 5 000 (WB)
Purity:
Antigen affinity purified serum in PBS, pH 7.4, conjugated to DyLight 594.
Molecular Weight:
90- 95 kDa (Arabidopsis thaliana, depending upon an isoform)
To be added when available. Antibody released in October 2023.
Special application note:
Cellular [compartment marker] for plasma membrane.DyLight 594 has Amax = 593 nm, Emax = 618 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
BiP2 (Binding immunoglobulin protein) is localized in endoplasmic reticulum lumen (ER) and plays a role in protein assembly inside ER. BiP protein is abundant under all growth conditions but its synthesis can increase under conditions that lead to the accumulation of unfolded polypeptides in endoplasmic reticulum (ER).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
BiP2 (Binding immunoglobulin protein) is localized in endoplasmic reticulum lumen (ER) and plays a role in protein assembly inside ER. BiP protein is abundant under all growth conditions but its synthesis can increase under conditions that lead to the accumulation of unfolded polypeptides in endoplasmic reticulum (ER).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
BiP2 (Binding immunoglobulin protein) is localized in endoplasmic reticulum lumen (ER) and plays a role in protein assembly inside ER, BiP protein is abundant under all growth conditions, but its synthesis can increase under conditions that lead to the accumulation of unfolded polypeptides in endoplasmic reticulum (ER).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Rubisco (Ribulose-1,5-bisphosphate carboxylase/oxygenase) catalyzes the rate-limiting step of CO2 fixation in photosynthetic organisms. It is demonstrably homologous from purple bacteria to flowering plants and consists of two protein subunits, each present in 8 copies. In plants and green algae, the large subunit (~55 kDa) is coded by the chloroplast rbcL gene, and the small subunit (15 kDa) is coded by a family of nuclear rbcS genes.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Aalpha proteobacteria, Algae (brown and red), Dicots, Beta-proteobacteria, Conifers, Cryptomonads, Cyanobacteria (prochlorophytes), Gamma-proeobacteria, Liverworts, Monocots, Mosses, Suaeda glauca, Welwitschia Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide conserved across all known plant, algal and (cyano)bacterial RbcL protein sequences (form I L8S8 and form II L2), including Arabidopsis thaliana AtCg00490, Hordeum vulgare P05698, Oryza sativa P0C510, Chlamydomonas reinhardtii P00877, Synechococcus PCC 7920 A5CKC5
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Anti-RbcL can be used as a cellular [compartment marker] of plastid stroma (cytoplasm in cyanobacteria) and detects RbcL protein from 31,25 fmoles, As both forms (I and II) are detected it is suitable for work with samples from Dinoflagellates, Haptophytes and Ochrophytes (diatoms, Raphidophytes, brown algae) as well as higher plants, This antibody together with Agrisera Rubisco protein standard is very suitable to quantify Rubisco in plant and algal samples
BiP2 (Binding immunoglobulin protein) is localized in endoplasmic reticulum lumen (ER) and plays a role in protein assembly inside ER, BiP protein is abundant under all growth conditions, but its synthesis can increase under conditions that lead to the accumulation of unfolded polypeptides in endoplasmic reticulum (ER).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
The Plasma Membrane H+ATPase is a family of proteins of ca. 100 kDa that are believed to be exclusive to the plasma membranes of plants and fungi. The protein is anchored within biological membrane which creates an electrochemical gradient used as an energy source and is essential for uptake of most metabolites and plant responses to environment, for example movement of leaves.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
VERY IMPORTANT: Please, do not heat up your samples above 70 C as this may cause H+ATPase to precipitate, and there will be no signal on your Western Blot. Before SDS-PAGE, centrifuge your samples at room temperature at 10 000 rpm/1 min to remove any aggregates. H+ATPase will be less abundant in mature roots and leafs, and therefore detection may require use of very sensitive reagents.
Application Details:
1 : 600-1 : 1000 (IF), 1 : 1000-1 : 2 000 (WB)
Purity:
Antigen affinity purified serum in PBS pH 7.4, conjugated to DyLight 488.
Molecular Weight:
90- 95 kDa (Arabidopsis thaliana, depending upon an isoform)
To be added when available. Antibody released in October 2023.
Special application note:
Cellular [compartment marker] for plasma membrane.DyLight 488 has Amax = 493 nm, Emax = 518 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
The psbA gene has been cloned from many species of plants, green algae, and cyanobacteria. The psbA gene is located in the chloroplast genome and encodes for the D1 protein, a core component of Photosystem II. PsbA/D1 is rapidly cycled under illumination in all oxygenic photobionts. Tracking PsbA pools using the Global PsbA antibody can show the functional content of Photosystem II in a wide range of samples. Alternative names: 32 kDa thylakoid membrane protein, photosystem II protein D1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Algae (brown and red), Dictos, Conifers, Cyanobacteria, Medicago sativa, Nannochloropsis sp., Pisum sativum, Triticum aestivum, cellular [compartment marker] of thylakoid membrane Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from available plant, algal and cyanobacterial PsbA sequences, including Arabidopsis thaliana UniProt: A4QJR4, TAIR: AtCg00020 , Oryza sativa P0C434, Populus alba Q14FH6, Physcomitrella patens Q6YXN7, Chlamydomonas reinhardtii P07753, Synechocystis sp. P14660 and many others
The antibody is appropriate for detecting both, 24 kDa or the 10 kDa C-terminal fragments, whichever is generated under given treatment conditions. In our analysis we have seen both, ca. 24 kDa and ca. 10 kDa fragments from different samples, depending on treatments and isolation procedures.Rabbit anti-PsbA antibody can detect more than one band of PsbA protein, e.g. precursor and mature protein as compare to the chicken anti-PsbA antibodies AS01 016.This antibody will detect the phosphorylated form of D1 as an alternate band to the main band on a high resolution gel.The antibody will bind to cross-linked proteins: D1/D2, D1/cyt b559, D1/CP43.
Application Details:
1 : 15 000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4, conjugated to ALP.
Molecular Weight:
38 | 28-30 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Due to biology of PsbA (D1) protein a number of degradation products can apprear in a sample and may be observed when using anti-PsbA antibodies, including products having apparent molecular weights of 24kDa and 16kDa. D1 degradation is a complex set of events and the products observed can be influenced by both the extraction procedure and the physiology of the cells prior to harvest. Third, cross-linking may occur between D1 and cytochrome b559, shifting the protein higher in the gel. In cyanobacteria (PCC7942), three different bands were competed out by preincubating the antibody with the PsbA free peptide, indicating that all bands are indeed PsbA and its precursors or breakdown products. Competition assays were also performed with spinach and Chlamydomonas, confirming the identity of PsbA bands.Anti-PsbA antibodies will not detect D2 protein, as the peptide used to generate PsbA antibodies has no homology to the D2 sequence.
SPS (sucrose phosphate synthase, EC 2,4,1,14) is the key enzyme of carbon flux into sucrose fixation in plants, It catalyzes the synthesis of sucrose-phosphate from UDP-glucose and fructose-6-phosphate predominantly in the cytosol of sucrose-source leaf tissue.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Brassica napus, Citrus sinensis, Glycine max, Nicotiana tabacum, Oryza sativa, Physcomitrella patens, Populus balsamifera, Robinia pseudoacaci, Ricinus communis, Saccharum officinarum, Solanum lycopersicum, Theobroma cacao, Vicia faba, Vitis vinifera Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from conserved region within plant SPS protein sequences, including Arabidopsis thaliana isoforms 1F Q94BT0, 2F, 3F and 4F. Oryza sativa Q67WN8, Solanum tuberosum Q43845
BiP2 (Binding immunoglobulin protein) is localized in endoplasmic reticulum lumen (ER) and plays a role in protein assembly inside ER, BiP protein is abundant under all growth conditions, but its synthesis can increase under conditions that lead to the accumulation of unfolded polypeptides in endoplasmic reticulum (ER).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
SPS (sucrose phosphate synthase, EC 2,4,1,14) is the key enzyme of carbon flux into sucrose fixation in plants, It catalyzes the synthesis of sucrose-phosphate from UDP-glucose and fructose-6-phosphate predominantly in the cytosol of sucrose-source leaf tissue.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Brassica napus, Citrus sinensis, Glycine max, Nicotiana tabacum, Oryza sativa, Physcomitrella patens, Populus balsamifera, Robinia pseudoacaci, Ricinus communis, Saccharum officinarum, Solanum lycopersicum, Theobroma cacao, Vicia faba, Vitis vinifera Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from conserved region within plant SPS protein sequences, including Arabidopsis thaliana isoforms 1F Q94BT0, 2F, 3F and 4F. Oryza sativa Q67WN8, Solanum tuberosum Q43845
BiP2 (Binding immunoglobulin protein) is localized in endoplasmic reticulum lumen (ER) and plays a role in protein assembly inside ER. BiP protein is abundant under all growth conditions but its synthesis can increase under conditions that lead to the accumulation of unfolded polypeptides in endoplasmic reticulum (ER).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
The Plasma Membrane H+ATPase is a family of proteins of ca. 100 kDa that are believed to be exclusive to the plasma membranes of plants and fungi. The protein is anchored within biological membrane which creates an electrochemical gradient used as an energy source and is essential for uptake of most metabolites and plant responses to environment, for example movement of leaves.This antibody is directly conjugated to Biotin.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
VERY IMPORTANT: Please, do not heat up your samples above 70 C as this may cause H+ATPase to precipitate, and there will be no signal on your Western Blot. Before SDS-PAGE, centrifuge your samples at room temperature at 10 000 rpm/1 min to remove any aggregates. H+ATPase will be less abundant in mature roots and leafs, and therefore detection may require use of very sensitive reagents.
Application Details:
1 : 100 (IL), 1 : 1000-1 : 5 000 (WB)
Purity:
Antigen affinity purified serum in PBS pH 7.4, conjugated to Biotin.
Molecular Weight:
90- 95 kDa (Arabidopsis thaliana, depending upon an isoform)
The psbA gene has been cloned from many species of plants, green algae, and cyanobacteria. The psbA gene is located in the chloroplast genome and encodes for the D1 protein, a core component of Photosystem II. PsbA/D1 is rapidly cycled under illumination in all oxygenic photobionts. Tracking PsbA pools using the Global PsbA antibody can show the functional content of Photosystem II in a wide range of samples. Alternative names: 32 kDa thylakoid membrane protein, photosystem II protein D1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7.4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Algae (brown and red), Dictos, Conifers, Cyanobacteria, Medicago sativa, Nannochloropsis sp., Pisum sativum, Triticum aestivum, cellular [compartment marker] of thylakoid membrane.Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from available plant, algal and cyanobacterial PsbA sequences, including Arabidopsis thaliana UniProt: A4QJR4, TAIR: AtCg00020 , Oryza sativa P0C434, Populus alba Q14FH6, Physcomitrella patens Q6YXN7, Chlamydomonas reinhardtii P07753, Synechocystis sp. P14660 and many others
The antibody is appropriate for detecting both, 24 kDa or the 10 kDa C-terminal fragments, whichever is generated under given treatment conditions. In our analysis we have seen both, ca, 24 kDa and ca, 10 kDa fragments from different samples, depending on treatments and isolation procedures. Rabbit anti-PsbA antibody can detect more than one band of PsbA protein, e.g. precursor and mature protein as compare to the hen anti-PsbA antibodies AS01 016. This antibody will detect the phosphorylated form of D1 as an alternate band to the main band on a high resolution gel,The antibody will bind to cross-linked proteins: D1/D2, D1/cyt b559, D1/CP43.
Application Details:
To be determined by end user
Purity:
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 488.
Molecular Weight:
38 | 28-30 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known.
Selected references:
To be added when available. Antibody release in May 2023.
Special application note:
Due to biology of PsbA (D1) protein a number of degradation products can apprear in a sample and may be observed when using anti-PsbA antibodies, including products having apparent molecular weights of 24kDa and 16kDa. D1 degradation is a complex set of events and the products observed can be influenced by both the extraction procedure and the physiology of the cells prior to harvest. Third, cross-linking may occur between D1 and cytochrome b559, shifting the protein higher in the gel. In cyanobacteria (PCC7942), three different bands were competed out by preincubating the antibody with the PsbA free peptide, indicating that all bands are indeed PsbA and its precursors or breakdown products. Competition assays were also performed with spinach and Chlamydomonas, confirming the identity of PsbA bands. Anti-PsbA antibodies will not detect D2 protein, as the peptide used to generate PsbA antibodies has no homology to the D2 sequence.DyLight 488 Amax = 493 nm, Emax = 519 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
The Plasma Membrane H+ATPase is a family of proteins of ca. 100 kDa that are believed to be exclusive to the plasma membranes of plants and fungi. The protein is anchored within biological membrane which creates an electrochemical gradient used as an energy source and is essential for uptake of most metabolites and plant responses to environment, for example movement of leaves.This antibody is directly conjugated to ALP.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
VERY IMPORTANT: Please, do not heat up your samples above 70 C as this may cause H+ATPase to precipitate, and there will be no signal on your Western Blot. Before SDS-PAGE, centrifuge your samples at room temperature at 10 000 rpm/1 min to remove any aggregates. H+ATPase will be less abundant in mature roots and leafs, and therefore detection may require use of very sensitive reagents.
Application Details:
1 : 100 (IL), 1 : 1000-1 : 5000 (WB)
Purity:
Antigen affinity purified serum in PBS pH 7.4, conjugated to ALP.
Molecular Weight:
90- 95 kDa (Arabidopsis thaliana, depending upon an isoform)
PEPC (phosphoenolpyruvate carboxylase), EC=4.1.1.31, belongs to an enzyme family of carboxy-lyases that is catalyzing adding fo carbon dioxide to phosphoenolpyruvate (PEP) to form oxaloacetate. Alternative names: PEPCase 1, PEPCase 3, PEPC 1, PEPC 3
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
KLH-conjugated synthetic peptide well conserved PEPC1 and sequences from different plant species including Arabidopsis thaliana Q9MAH0, At1g53310 (PEPC 1), Q84VW9, At3g14940 (PEPC 3). The peptide chosen to elicit this antibody is also perfectly conserved in bacterial type of this enzyme NP_177043.2 (PEPC 4)
The psbA gene has been cloned from many species of plants, green algae, and cyanobacteria. The psbA gene is located in the chloroplast genome and encodes for the D1 protein, a core component of Photosystem II, PsbA/D1 is rapidly cycled under illumination in all oxygenic photobionts. Tracking PsbA pools using the Global PsbA antibody can show the functional content of Photosystem II in a wide range of samples. Alternative names: 32 kDa thylakoid membrane protein, photosystem II protein D1.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Algae (brown and red), Dictos, Conifers, Cyanobacteria, Medicago sativa, Nannochloropsis sp., Pisum sativum, Triticum aestivum, cellular [compartment marker] of thylakoid membrane.Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from available plant, algal and cyanobacterial PsbA sequences, including Arabidopsis thaliana UniProt: A4QJR4, TAIR: AtCg00020 , Oryza sativa P0C434, Populus alba Q14FH6, Physcomitrella patens Q6YXN7, Chlamydomonas reinhardtii P07753, Synechocystis sp. P14660 and many others
The antibody is appropriate for detecting both, 24 kDa or the 10 kDa C-terminal fragments, whichever is generated under given treatment conditions, In our analysis we have seen both, ca, 24 kDa and ca, 10 kDa fragments from different samples, depending on treatments and isolation procedures,Rabbit anti-PsbA antibody can detect more than one band of PsbA protein, e,g, precursor and mature protein as compare to the hen anti-PsbA antibodies AS01 016,This antibody will detect the phosphorylated form of D1 as an alternate band to the main band on a high resolution gel,The antibody will bind to cross-linked proteins: D1/D2, D1/cyt b559, D1/CP43,
Application Details:
To be determined by end user
Purity:
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 594.
Molecular Weight:
38 | 28-30 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known,
Selected references:
To be added when available. Antibody release in May 2023.
Special application note:
Due to biology of PsbA (D1) protein a number of degradation products can apprear in a sample and may be observed when using anti-PsbA antibodies, including products having apparent molecular weights of 24kDa and 16kDa. D1 degradation is a complex set of events and the products observed can be influenced by both the extraction procedure and the physiology of the cells prior to harvest. Third, cross-linking may occur between D1 and cytochrome b559, shifting the protein higher in the gel. In cyanobacteria (PCC7942), three different bands were competed out by preincubating the antibody with the PsbA free peptide, indicating that all bands are indeed PsbA and its precursors or breakdown products. Competition assays were also performed with spinach and Chlamydomonas, confirming the identity of PsbA bands,Anti-PsbA antibodies will not detect D2 protein, as the peptide used to generate PsbA antibodies has no homology to the D2 sequence.DyLight 594 has Amax = 593 nm, Emax = 618 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
The psbA gene has been cloned from many species of plants, green algae, and cyanobacteria, The psbA gene is located in the chloroplast genome and encodes for the D1 protein, a core component of Photosystem II, PsbA/D1 is rapidly cycled under illumination in all oxygenic photobionts, Tracking PsbA pools using the Global PsbA antibody can show the functional content of Photosystem II in a wide range of samples, Alternative names: 32 kDa thylakoid membrane protein, photosystem II protein D1
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Algae (brown and red), Dictos, Conifers, Cyanobacteria, Medicago sativa, Nannochloropsis sp., Pisum sativum, Triticum aestivum, cellular [compartment marker] of thylakoid membrane.Species of your interest not listed? Contact us
The antibody is appropriate for detecting both, 24 kDa or the 10 kDa C-terminal fragments, whichever is generated under given treatment conditions, In our analysis we have seen both, ca, 24 kDa and ca, 10 kDa fragments from different samples, depending on treatments and isolation procedures,Rabbit anti-PsbA antibody can detect more than one band of PsbA protein, e,g, precursor and mature protein as compare to the hen anti-PsbA antibodies AS01 016,This antibody will detect the phosphorylated form of D1 as an alternate band to the main band on a high resolution gel,The antibody will bind to cross-linked proteins: D1/D2, D1/cyt b559, D1/CP43,
Application Details:
To be determined by end user
Purity:
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 650.
Molecular Weight:
38 | 28-30 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known,
Selected references:
To be added when available. Antibody released in May 2023.
Special application note:
Due to biology of PsbA (D1) protein a number of degradation products can apprear in a sample and may be observed when using anti-PsbA antibodies, including products having apparent molecular weights of 24kDa and 16kDa. D1 degradation is a complex set of events and the products observed can be influenced by both the extraction procedure and the physiology of the cells prior to harvest. Third, cross-linking may occur between D1 and cytochrome b559, shifting the protein higher in the gel. In cyanobacteria (PCC7942), three different bands were competed out by preincubating the antibody with the PsbA free peptide, indicating that all bands are indeed PsbA and its precursors or breakdown products. Competition assays were also performed with spinach and Chlamydomonas, confirming the identity of PsbA bands,Anti-PsbA antibodies will not detect D2 protein, as the peptide used to generate PsbA antibodies has no homology to the D2 sequence.DyLight 650 has Amax = 652 nm, Emax = 672 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
Clathrin is a protein involved in intracellular trafficking and plays a major role in the formation of coated vesicles. It consists of three clathrin heavy chains and three light chains. Clathrin-coated vesicles (CCV) selectively sort cargo at the cell membrane, trans-Golgi network, and endosomal compartments for multiple membrane traffic pathways.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Amborella trichopoda, Brassica napus, Capsella rubella, Citrus aurantium var. sinensis, Eucalyptus grandis, Glycine max, Chlorella variabilis, Leucaena glauca, Lotus japonicus, Medicago tribuloides, Mimulus guttatus, Musa malaccensis, Oryza sativa, Panicum italicum, Physcomitrium patens, Phaseolus vulgaris, Pisum sativum, Populus balsamifera, Ricinus communis, Selaginella moellendorffii, Sisymbrium salsugineum, Solanum lycopersicum, Theobroma cacao, Triticum aestivum, Vitis vinifera Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from available plant clathrin heavy chain sequences including Arabidopsis thaliana clathrin heavy chain 1 UniProt: Q0WNJ6, TAIR:At3g11130, clathrin heavy chain 2 UniProt: Q0WLB5,TAIR:At3g08530
Applications:
Immunolocalization (IL), Immunofluorescence (IF), Western blot (WB)
Clathrin is a protein involved in intracellular trafficking and plays a major role in the formation of coated vesicles, It consists of three clathrin heavy chains and three light chains, Clathrin-coated vesicles (CCV) selectively sort cargo at the cell membrane, trans-Golgi network, and endosomal compartments for multiple membrane traffic pathways.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Amborella trichopoda, Brassica napus, Capsella rubella, Citrus aurantium var. sinensis, Eucalyptus grandis, Glycine max, Chlorella variabilis, Leucaena glauca, Lotus japonicus, Medicago tribuloides, Mimulus guttatus, Musa malaccensis, Oryza sativa, Panicum italicum, Physcomitrium patens, Phaseolus vulgaris, Pisum sativum, Populus balsamifera, Populus trichocarpa, Ricinus communis, Selaginella moellendorffii, Sisymbrium salsugineum, Solanum lycopersicum, Theobroma cacao, Triticum aestivum, Vitis vinifera, Zea mays.Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from available plant clathrin heavy chain sequences including Arabidopsis thaliana clathrin heavy chain 1 UniProt: Q0WNJ6, TAIR:At3g11130, clathrin heavy chain 2 UniProt: Q0WLB5,TAIR:At3g08530
Clathrin is a protein involved in intracellular trafficking and plays a major role in the formation of coated vesicles, It consists of three clathrin heavy chains and three light chains, Clathrin-coated vesicles (CCV) selectively sort cargo at the cell membrane, trans-Golgi network, and endosomal compartments for multiple membrane traffic pathways.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Amborella trichopoda, Brassica napus, Capsella rubella, Citrus aurantium var. sinensis, Eucalyptus grandis, Glycine max, Chlorella variabilis, Leucaena glauca, Lotus japonicus, Medicago tribuloides, Mimulus guttatus, Musa malaccensis, Oryza sativa, Panicum italicum, Physcomitrium patens, Phaseolus vulgaris, Pisum sativum, Populus balsamifera, Populus trichocarpa, Ricinus communis, Selaginella moellendorffii, Sisymbrium salsugineum, Solanum lycopersicum, Theobroma cacao, Triticum aestivum, Vitis vinifera, Zea mays.Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from available plant clathrin heavy chain sequences including Arabidopsis thaliana clathrin heavy chain 1 UniProt: Q0WNJ6, TAIR:At3g11130, clathrin heavy chain 2 UniProt: Q0WLB5,TAIR:At3g08530
Clathrin is a protein involved in intracellular trafficking and plays a major role in the formation of coated vesicles, It consists of three clathrin heavy chains and three light chains, Clathrin-coated vesicles (CCV) selectively sort cargo at the cell membrane, trans-Golgi network, and endosomal compartments for multiple membrane traffic pathways.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
Zea mays
Expected Species:
Amborella trichopoda, Arabidopsis thaliana, Brassica napus, Capsella rubella, Chlamydomonas reinhardtii, Citrus aurantium var. sinensis, Eucalyptus grandis, Glycine max, Chlorella variabilis, Leucaena glauca, Lotus japonicus, Medicago tribuloides, Mimulus guttatus, Musa malaccensis, Nicotiana tabacum, Oryza sativa, Panicum italicum, Physcomitrium patens, Phaseolus vulgaris, Pisum sativum, Populus balsamifera, Populus trichocarpa, Ricinus communis, Selaginella moellendorffii, Sisymbrium salsugineum, Solanum lycopersicum, Theobroma cacao, Triticum aestivum, Vitis vinifera, Zea mays.Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from available plant clathrin heavy chain sequences including Arabidopsis thaliana clathrin heavy chain 1 UniProt: Q0WNJ6, TAIR:At3g11130, clathrin heavy chain 2 UniProt: Q0WLB5,TAIR:At3g08530
Clathrin is a protein involved in intracellular trafficking and plays a major role in the formation of coated vesicles. It consists of three clathrin heavy chains and three light chains. Clathrin-coated vesicles (CCV) selectively sort cargo at the cell membrane, trans-Golgi network, and endosomal compartments for multiple membrane traffic pathways.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Amborella trichopoda, Brassica napus, Capsella rubella, Citrus aurantium var. sinensis, Eucalyptus grandis, Glycine max, Chlorella variabilis, Leucaena glauca, Lotus japonicus, Medicago tribuloides, Mimulus guttatus, Musa malaccensis, Oryza sativa, Panicum italicum, Physcomitrium patens, Phaseolus vulgaris, Pisum sativum, Populus balsamifera, Ricinus communis, Selaginella moellendorffii, Sisymbrium salsugineum, Solanum lycopersicum, Theobroma cacao, Triticum aestivum, Vitis viniferaSpecies of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from available plant clathrin heavy chain sequences including Arabidopsis thaliana clathrin heavy chain 1 UniProt: Q0WNJ6, TAIR:At3g11130, clathrin heavy chain 2 UniProt: Q0WLB5,TAIR:At3g08530
Applications:
Immunolocalization (IL), Immunofluorescence (IF), Western blot (WB)
YFP (Yellow Fluorescent Protein) is a genetic mutant of green fluorescent protein (GFP), YFP has an excitation peak at 514 nm and emission peak at 527 nm.This antibody is directly conjugated to HRP.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
C-YFP tagged proteins from Arabidopsis thaliana
Expected Species:
C-YFP tagged proteins
Immunogen:
KLH-conjugated synthetic peptide derived from C-terminal of YFP protein. This peptide is conserved in pGWB541 Vector.
Cas9 (CRISPR-associated endonuclease 9) is an RNA-guided DNA endonuclease associated with the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) type II adaptive immunity system, CRISPR clusters are transcribed and processed into CRISPR RNA (crRNA), Cas9 protein serves as a genome engineering tool to induce site-directed double strand breaks in DNA.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
Staphylococcus aureus
Expected Species:
Staphylococcus pyogenes UniProt: Q99ZW2
Immunogen:
KLH-conjugated synthetic peptide derived from Streptococcus thermophilus Cas9/Csn1 protein sequence, UniProt: Q03JI6(peptide sequence is conserved in pYLCRISPR/Cas9Pubi-H vector)
Clathrin is a protein involved in intracellular trafficking and plays a major role in the formation of coated vesicles. It consists of three clathrin heavy chains and three light chains. Clathrin-coated vesicles (CCV) selectively sort cargo at the cell membrane, trans-Golgi network, and endosomal compartments for multiple membrane traffic pathways.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Amborella trichopoda, Brassica napus, Capsella rubella, Citrus aurantium var. sinensis, Eucalyptus grandis, Glycine max, Chlorella variabilis, Leucaena glauca, Lotus japonicus, Medicago tribuloides, Mimulus guttatus, Musa malaccensis, Oryza sativa, Panicum italicum, Physcomitrium patens, Phaseolus vulgaris, Pisum sativum, Populus balsamifera, Ricinus communis, Selaginella moellendorffii, Sisymbrium salsugineum, Solanum lycopersicum, Theobroma cacao, Triticum aestivum, Vitis vinifera Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from available plant clathrin heavy chain sequences including Arabidopsis thaliana clathrin heavy chain 1 UniProt: Q0WNJ6, TAIR:At3g11130, clathrin heavy chain 2 UniProt: Q0WLB5,TAIR:At3g08530
Applications:
Immunolocalization (IL), Immunofluorescence (IF), Western blot (WB)
Histone 3 (H3) located in nuclei, incorporated into chromatin, Present in nucleosome together with H2A, H2B and H4.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 650.
Molecular Weight:
15 | 17 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known.
Selected references:
To be added when available. Antibody released in May 2023.
Special application note:
Cellular [compartment marker] of nucleoplasm, loading control antibody for Chlamydomonas reinhardtii.DyLight 650 has Amax = 652 nm, Emax = 672 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
Histone 3 (H3) located in nuclei, incorporated into chromatin, Present in nucleosome together with H2A, H2B and H4.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 594.
Molecular Weight:
15 | 17 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known,
Selected references:
To be added when available. Antibody released in May 2023.
Special application note:
Cellular [compartment marker] of nucleoplasm, loading control antibody for Chlamydomonas reinhardtii.DyLight 594 has Amax = 593 nm, Emax = 618 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
Histone 3 (H3) located in nuclei, incorporated into chromatin, Present in nucleosome together with H2A, H2B and H4.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 488.
Molecular Weight:
15 | 17 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known.
Selected references:
To be added when available. Antibody released in May 2023.
Special application note:
Cellular [compartment marker] of nucleoplasm, loading control antibody for Chlamydomonas reinhardtii.DyLight 488 Amax = 493 nm, Emax = 519 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
Cas9 (CRISPR-associated endonuclease 9) is an RNA-guided DNA endonuclease associated with the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) type II adaptive immunity system, CRISPR clusters are transcribed and processed into CRISPR RNA (crRNA), Cas9 protein serves as a genome engineering tool to induce site-directed double strand breaks in DNA.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
Staphylococcus aureus
Expected Species:
Staphylococcus pyogenes UniProt: Q99ZW2
Immunogen:
KLH-conjugated synthetic peptide derived from Streptococcus thermophilus Cas9/Csn1 protein sequence, UniProt: Q03JI6(peptide sequence is conserved in pYLCRISPR/Cas9Pubi-H vector)
YFP (Yellow Fluorescent Protein) is a genetic mutant of green fluorescent protein (GFP), YFP has an excitation peak at 514 nm and emission peak at 527 nm. This antibody is directly conjugated to HRP.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
C-YFP tagged proteins from Arabidopsis thaliana
Expected Species:
C-YFP tagged proteins
Immunogen:
KLH-conjugated synthetic peptide derived from C-terminal of YFP protein. This peptide is conserved in pGWB541 Vector.
Cas9 (CRISPR-associated endonuclease 9) is an RNA-guided DNA endonuclease associated with the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) type II adaptive immunity system, CRISPR clusters are transcribed and processed into CRISPR RNA (crRNA), Cas9 protein serves as a genome engineering tool to induce site-directed double strand breaks in DNA.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
Staphylococcus aureus
Expected Species:
Staphylococcus pyogenes UniProt: Q99ZW2
Immunogen:
KLH-conjugated synthetic peptide derived from Streptococcus thermophilus Cas9/Csn1 protein sequence, UniProt: Q03JI6(peptide sequence is conserved in pYLCRISPR/Cas9Pubi-H vector)
YFP (Yellow Fluorescent Protein) is a genetic mutant of green fluorescent protein (GFP), YFP has an excitation peak at 514 nm and emission peak at 527 nm. This antibody is directly conjugated to HRP.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
C-YFP tagged proteins from Arabidopsis thaliana
Expected Species:
C-YFP tagged proteins
Immunogen:
KLH-conjugated synthetic peptide derived from C-terminal of YFP protein. This peptide is conserved in pGWB541 Vector.
LUC (Luciferase) from Photinus pyralis (Common eastern firefly) (Lampyris pyralis), light producing beetle is an enzyme in the light production.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
LUC
Immunogen:
KLH-conjugated synthetic peptide derived from N-terminal part of LUC protein sequence of Photinus pyralis, UniProt: Q27758
LUC (Luciferase) from Photinus pyralis (Common eastern firefly) (Lampyris pyralis), light producing beetle is an enzyme in the light production.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
LUC
Immunogen:
KLH-conjugated synthetic peptide derived from N-terminal part of LUC protein sequence of Photinus pyralis, UniProt: Q27758
LUC (Luciferase) from Photinus pyralis (Common eastern firefly) (Lampyris pyralis), light producing beetle is an enzyme in the light production.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
LUC
Immunogen:
KLH-conjugated synthetic peptide derived from N-terminal part of LUC protein sequence of Photinus pyralis, UniProt: Q27758
Green fluorescent protein (Venus) from Aequorea victoria (Jellyfish), can be mutated to emit at different wavelengths such as blue for BFP (when Tyr-66 is replaced by His), cyan for CFP (when Tyr-66 is replaced by Trp), and yellow for YFP (when THR-203 is replaced by Tyr), It is an energy-transfer acceptor, Its role is to transduce the blue chemiluminescence of the protein aequorin into green fluorescent light by energy transfer.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
VENUS
Immunogen:
Full length, recombinat VENUS protein, expressed in E.coli, UniProt: P42212
Green fluorescent protein (Venus) from Aequorea victoria (Jellyfish), can be mutated to emit at different wavelengths such as blue for BFP (when Tyr-66 is replaced by His), cyan for CFP (when Tyr-66 is replaced by Trp), and yellow for YFP (when THR-203 is replaced by Tyr), It is an energy-transfer acceptor, Its role is to transduce the blue chemiluminescence of the protein aequorin into green fluorescent light by energy transfer.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
VENUS
Immunogen:
Full length, recombinat VENUS protein, expressed in E.coli, UniProt: P42212
GFP (Green fluorescent protein) was originally identified in photo organs on jellyfish Aequorea victoria, It is a naturally fluorescent protein which emits green light at a maximum wavelength of 509 nm when excited by blue or UV light, It is extensively used in laboratory as a reporter molecule to label and study cellular and subcellular proteins in living cells using a wide range of applications, Antibodies to GFP protein are used in immunoblotting and ELISA, GFP protein has molecular weight of 27 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
GFP (Green fluorescent protein) was originally identified in photo organs on jellyfish Aequorea victoria, It is a naturally fluorescent protein which emits green light at a maximum wavelength of 509 nm when excited by blue or UV light, It is extensively used in laboratory as a reporter molecule to label and study cellular and subcellular proteins in living cells using a wide range of applications, Antibodies to GFP protein are used in immunoblotting and ELISA, GFP protein has molecular weight of 27 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Tagging a protein with TurboID allows studying protein interactions in different types of cells and organs and developmental stages, This is a suitable tool for proximity labelling experiments as described in Mair et al, (2019), Proximity labelling of protein complexes and cell-type-specific organellar proteomes in Arabidopsis enabled by TurboID, Elife , 2019 Sep 19;8:e47864, doi: 10,7554/eLife,47864, This tag has MW of 35 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
BirA (mutated/TurboID)
Immunogen:
Recombinant mutated BirA protein from E.coli produced using the following plasmid: TurboID-His6_pET21a, (Plasmid #107177). Expression was done in a vector that allowed for the generation of an untagged protein (without HIS6tag).
Tagging a protein with TurboID allows studying protein interactions in different types of cells and organs and developmental stages, This is a suitable tool for proximity labelling experiments as described in Mair et al, (2019), Proximity labelling of protein complexes and cell-type-specific organellar proteomes in Arabidopsis enabled by TurboID, Elife , 2019 Sep 19;8:e47864, doi: 10,7554/eLife,47864, This tag has MW of 35 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
BirA (mutated/TurboID)
Immunogen:
Recombinant mutated BirA protein from E.coli produced using the following plasmid: TurboID-His6_pET21a, (Plasmid #107177). Expression was done in a vector that allowed for the generation of an untagged protein (without HIS6tag).
GST-tag (glutathione S-transferase) is a tag added to a protein of interest as a fusion protein to unable purification and detection, The tag is 220 amino acid long, ca, 26 kDa which makes it quite large compare to Myc or FLAG tags.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
Native and denatured forms of purified GST or GST fusion proteins
GST-tag (glutathione S-transferase) is a tag added to a protein of interest as a fusion protein to unable purification and detection, The tag is 220 amino acid long, ca, 26 kDa which makes it quite large compare to Myc or FLAG tags.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
Native and denatured forms of purified GST or GST fusion proteins
GST-tag (glutathione S-transferase) is a tag added to a protein of interest as a fusion protein to unable purification and detection, The tag is 220 amino acid long, ca, 26 kDa which makes it quite large compare to Myc or FLAG tags.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
Native and denatured forms of purified GST or GST fusion proteins
His-Tag is a polyhistidine tag which consists of 3 or 6 histidine residues introduced on N- or C-terminus of the protein, The polyhistidine-tag can be used for recombinant protein detection using specific antibodies and it is not conjugated to any dye or enzyme.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
His-Tag is a polyhistidine tag which consists of 3 or 6 histidine residues introduced on N- or C-terminus of the protein, The polyhistidine-tag can be used for recombinant protein detection using specific antibodies and it is not conjugated to any dye or enzyme.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
His-Tag is a polyhistidine tag which consists of 3 or 6 histidine residues introduced on N- or C-terminus of the protein, The polyhistidine-tag can be used for recombinant protein detection using specific antibodies and it is not conjugated to any dye or enzyme.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Keyhole limpet hemocyanin (KLH) is a large cooper-containing protein consisting of subunits with MW of 400 kDa. It is found in the hemolymph of the sea mollusk Megathura crenulata. This extracellular respiratory protein has many immunostimulatory properties, including the ability to enhance the host’s immune response by interacting with T cells, monocytes, macrophages, and polymorphonuclear lymphocytes. Since its discovery, KLH has been used primarily as a carrier for vaccines and antigens and as adjuvant treatment in regimens such as antimicrobial therapy.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
Megathura crenulata - most commonly used carrier protein
Antibody can be used as a negative control to determine if observed signal is generated by anti-KLH or anti-peptide antibodies, Due to its large size KLH protein will be very difficult to separate on SDS-PAGE
Application Details:
1: 5 000 (ELISA), 1: 5 000 (WB), 1: 1000 (IL)
Purity:
Immunogen affinity purified serum in PBS, pH 7.4, conjugated to biotin.
Molecular Weight:
ca, 400 kDa/subunit
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Protein present in plant vascular tissue (xylem and vascular cambium) is detected by anti-KLH antibodies (H glund et al. 2002) which might lead to false results in IL when using anti-peptide antibodies generated to KLH-conjugated peptide.
Keyhole limpet hemocyanin (KLH) is a large cooper-containing protein consisting of subunits with MW of 400 kDa. It is found in the hemolymph of the sea mollusk Megathura crenulata. This extracellular respiratory protein has many immunostimulatory properties, including the ability to enhance the host’s immune response by interacting with T cells, monocytes, macrophages, and polymorphonuclear lymphocytes. Since its discovery, KLH has been used primarily as a carrier for vaccines and antigens and as adjuvant treatment in regimens such as antimicrobial therapy.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
Megathura crenulata - most commonly used carrier protein
Antibody can be used as a negative control to determine if observed signal is generated by anti-KLH or anti-peptide antibodies, Due to its large size KLH protein will be very difficult to separate on SDS-PAGE
Application Details:
1: 10 000 (ELISA), 1: 10 000 (WB), 1: 1000 (IL)
Purity:
Immunogen affinity purified serum in PBS pH 7.4, conjugated to HRP.
Molecular Weight:
ca, 400 kDa/subunit
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Protein present in plant vascular tissue (xylem and vascular cambium) is detected by anti-KLH antibodies (H glund et al. 2002) which might lead to false results in IL when using anti-peptide antibodies generated to KLH-conjugated peptide.
Keyhole limpet hemocyanin (KLH) is a large cooper-containing protein consisting of subunits with MW of 400 kDa, It is found in the hemolymph of the sea mollusk Megathura crenulata, This extracellular respiratory protein has many immunostimulatory properties, including the ability to enhance the host's immune response by interacting with T cells, monocytes, macrophages, and polymorphonuclear lymphocytes, Since its discovery, KLH has been used primarily as a carrier for vaccines and antigens and as adjuvant treatment in regimens such as antimicrobial therapy.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 650.
Molecular Weight:
ca, 400 kDa/subunit
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known.
Selected references:
To be added when available. Antibody released in May 2023.
Special application note:
Protein present in plant vascular tissue (xylem and vascular cambium) is detected by anti-KLH antibodies (H glund et al, 2002) which might lead to false results in IL when using anti-peptide antibodies generated to KLH-conjugated peptide.DyLight 650 has Amax = 652 nm, Emax = 672 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
Keyhole limpet hemocyanin (KLH) is a large cooper-containing protein consisting of subunits with MW of 400 kDa, It is found in the hemolymph of the sea mollusk Megathura crenulata, This extracellular respiratory protein has many immunostimulatory properties, including the ability to enhance the host's immune response by interacting with T cells, monocytes, macrophages, and polymorphonuclear lymphocytes, Since its discovery, KLH has been used primarily as a carrier for vaccines and antigens and as adjuvant treatment in regimens such as antimicrobial therapy.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 594.
Molecular Weight:
ca, 400 kDa/subunit
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known,
Selected references:
To be added when available. Antibody released in May 2023.
Special application note:
Protein present in plant vascular tissue (xylem and vascular cambium) is detected by anti-KLH antibodies (H glund et al, 2002) which might lead to false results in IL when using anti-peptide antibodies generated to KLH-conjugated peptide.DyLight 594 has Amax = 593 nm, Emax = 618 nm.DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
Keyhole limpet hemocyanin (KLH) is a large cooper-containing protein consisting of subunits with MW of 400 kDa, It is found in the hemolymph of the sea mollusk Megathura crenulata, This extracellular respiratory protein has many immunostimulatory properties, including the ability to enhance the host's immune response by interacting with T cells, monocytes, macrophages, and polymorphonuclear lymphocytes, Since its discovery, KLH has been used primarily as a carrier for vaccines and antigens and as adjuvant treatment in regimens such as antimicrobial therapy.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 488.
Molecular Weight:
ca, 400 kDa/subunit
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known.
Selected references:
To be added when available. Antibody released in May 2023.
Special application note:
Protein present in plant vascular tissue (xylem and vascular cambium) is detected by anti-KLH antibodies (H glund et al, 2002) which might lead to false results in IL when using anti-peptide antibodies generated to KLH-conjugated peptide.DyLight 488 Amax = 493 nm, Emax = 519 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
Keyhole limpet hemocyanin (KLH) is a large cooper-containing protein consisting of subunits with MW of 400 kDa. It is found in the hemolymph of the sea mollusk Megathura crenulata. This extracellular respiratory protein has many immunostimulatory properties, including the ability to enhance the host’s immune response by interacting with T cells, monocytes, macrophages, and polymorphonuclear lymphocytes. Since its discovery, KLH has been used primarily as a carrier for vaccines and antigens and as adjuvant treatment in regimens such as antimicrobial therapy.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 12-18 months. A preservative may be added for long time storage up to 2 years.
Host Animal:
Rabbit
Species Reactivity:
Megathura crenulata - most commonly used carrier protein
Antibody can be used as a negative control to determine if observed signal is generated by anti-KLH or anti-peptide antibodies. Due to its large size KLH protein will be very difficult to separate on SDS-PAGE.Optimal working dilution has to be determined by end user.
Application Details:
1 : 5 000 (ELISA), 1 : 1000 (IL), 1 : 5 000 (WB)
Purity:
Immunogen affinity purified serum in PBS pH 7.4, conjugated to ALP.
Molecular Weight:
ca, 400 kDa/subunit
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Special application note:
Protein present in plant vascular tissue (xylem and vascular cambium) is detected by anti-KLH antibodies (H glund et al. 2002) which might lead to false results in IL when using anti-peptide antibodies generated to KLH-conjugated peptide. Further information about it can be found here.
BC2 tag is a short and inert peptide-tag for protein studies.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
Protein of interest overexpressed wth BC2-tag
Immunogen:
KLH-conjugated BC2 tag PDRKAAVSHWQQ derived from beta catenin.
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 650.
Selected references:
To be added when available. Antibody released in May 2023.
Special application note:
This antibody is suitable for detection of recombinant proteins with BC2 tag.DyLight 650 has Amax = 652 nm, Emax = 672 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
BC2 tag is a short and inert peptide-tag for protein studies.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
Protein of interest overexpressed wth BC2-tag
Immunogen:
KLH-conjugated BC2 tag PDRKAAVSHWQQ derived from beta catenin.
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 594.
Selected references:
To be added when available. Antibody released in May 2023.
Special application note:
This antibody is suitable for detection of recombinant proteins with BC2 tag.DyLight 594 has Amax = 593 nm, Emax = 618 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
GFP (Green fluorescent protein) was originally identified in photo organs on jellyfish Aequorea victoria, It is a naturally fluorescent protein which emits green light at a maximum wavelength of 509 nm when excited by blue or UV light, It is extensively used in laboratory as a reporter molecule to label and study cellular and subcellular proteins in living cells using a wide range of applications, Antibodies to GFP protein are used in immunoblotting and ELISA, GFP protein has molecular weight of 27 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Tagging a protein with TurboID allows studying protein interactions in different types of cells and organs and developmental stages, This is a suitable tool for proximity labelling experiments as described in Mair et al, (2019), Proximity labelling of protein complexes and cell-type-specific organellar proteomes in Arabidopsis enabled by TurboID, Elife , 2019 Sep 19;8:e47864, doi: 10,7554/eLife,47864, This tag has MW of 35 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
BirA (mutated/TurboID)
Immunogen:
Recombinant mutated BirA protein from E.coli produced using the following plasmid: TurboID-His6_pET21a, (Plasmid #107177). Expression was done in a vector that allowed for the generation of an untagged protein (without HIS6tag).
BC2 tag is a short and inert peptide-tag for protein studies.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
Protein of interest overexpressed wth BC2-tag
Immunogen:
KLH-conjugated BC2 tag PDRKAAVSHWQQ derived from beta catenin.
Immunogen affinity purified serum, in PBS pH 7.4, conjugated to DyLight 488.
Selected references:
To be added when available. Antibody released in May 2023.
Special application note:
This antibody is suitable for detection of recombinant proteins with BC2 tag.DyLight 488 Amax = 493 nm, Emax = 519 nm. DyLight is a registered trademark of Thermofisher Inc., and its subsidiaries.
Green fluorescent protein (Venus) from Aequorea victoria (Jellyfish), can be mutated to emit at different wavelengths such as blue for BFP (when Tyr-66 is replaced by His), cyan for CFP (when Tyr-66 is replaced by Trp), and yellow for YFP (when THR-203 is replaced by Tyr), It is an energy-transfer acceptor, Its role is to transduce the blue chemiluminescence of the protein aequorin into green fluorescent light by energy transfer.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid in PBS pH 7,4.
Storage Temp:
Store at 4°C for 12-18 months. A preservative may be added for long time storage up to 2 years. Store in provided dark tube and avoid direct light exposure. Shortly spin the tube before use.
Host Animal:
Rabbit
Species Reactivity:
VENUS
Immunogen:
Full length, recombinant VENUS protein, expressed in E.coli, UniProt: P42212
HQ-O Ready-To-Dilute (RTD TM ) Stain Reagent is designed to label amyloid plaques in paraffin-embedded or freshly cut frozen tissue sections. As a fluorescent zinc chelator, HQ-O is unique as it takes advantage of the known presence of concentrated zinc in amyloid plaques. Studies with HQ-O revealed that fluorescent plaque-like structures are only seen when synthetic A?x-42 is aggregated in the presence of zinc. Under blue light excitation, plaque structures appear bright green fluorescent in the brain parenchyma, correlating closely with plaque structures observed following A? antibody staining. HQ-O RTD TM staining reagent is compatible with other fluorophores, such as DAPI, Hoechst and ethidium bromide, as well as fluorescent-labelled antibodies with emission spectra in the blue and/or red emission range of fluorescent microscopes. Due to its zinc-chelating characteristics, HQ-O RTD TM staining reagent may visualize globular structures within blood vessels and intravascular leucocytes. HQ-O RTD TM staining reagent has multiple advantages over older blue-light exciting stains such as Thioflavin S. Thioflavin S typically exhibits relatively low contrast and resolution and suffers from bleed-through when excited by wavelengths other than blue light. HQ-O RTD TM staining reagent suffers none of these setbacks and not only provides a higher contrast and longer lasting dye, but because it lacks excitation bleed-through, HQ-O can be readily adapted to multiple labelling studies very easily. To visualize the HQ-O tracer, it is recommended to use a filter cube designed for visualizing Fluorescein/FITC or a blue-light laser. Although it can be seen with both narrow and wide-band pass filters, there is no need to use a narrow band filter since the compound does not bleed through when excited with other filters. A recommended excitation range of a wide band filter is 447-503 nm, with a peak at 475.
Background Info:
A novel zinc chelator, HQ-O, was developed for localizing zinc within amyloid plaques. The histology involves incubating tissue sections in a dilute aqueous solution of HQ-O.
Detection and fluorescent-staining of amyloid plaques in paraffin-embedded or freshly cut frozen tissue sections, please see detailed protocol for specific use instructions.
Alternative Names:
HQ-O tracer
Biosensis Brand:
Biosensis® RTD
Detection Method:
Fluorescence
Excitation/Emission:
To visualize the HQ-O tracer, it is recommended to use a filter cube designed for visualizing Fluorescein/FITC or a blue-light laser. Although it can be seen with both narrow and wide-band pass filters, there is no need to use a narrow band filter since the compound does not bleed through when excited with other filters. A recommended excitation range of a wide band filter is 447 503 nm, with a peak at 475 nm.
Shelf Life:
6 months after date of receipt (10X stock solution)
Use:
For research use only.
Kit Components:
One bottle containing 40 mL of 10X HQ-O RTD TM solution This quantity will be sufficient for approximately 8 Coplin Jars or 2-4 staining dishes.
Specificity:
As a fluorescent zinc chelator, HQ-O is unique as it takes advantage of the known presence of concentrated zinc in amyloid plaques. Studies with HQ-O revealed that fluorescent plaque-like structures are only seen when synthetic A?x-42 is aggregated in the presence of zinc. Under blue light excitation, plaque structures appear bright green fluorescent in the brain parenchyma, correlating closely with plaque structures observed following A? antibody staining.
Storage:
Store 10X stock solution at 2-8°C protected from light, for up to 6 months. The diluted dye (1X) should be used within 24 hours.
Cytokeratin-AE1 is the acidic (Type 1) subfamilies of cytokeratins, and can be used to label tumors for squamous and adenocarcinoma of the lung, liver carcinoma, breast cancer and esophageal cancer.
Product Type:
Primary Antibody
Antibody Type:
Monoclonal
Format:
Concentrate
Storage Temp:
2-8 degrees Celsius
Host Animal:
Mouse
Species Reactivity:
Human
Immunogen:
Recombinant Protein
Applications:
IHC
Clone number:
IHC201
GMDN Code:
57079
UKCA Status:
RUO
CE-IVD Status:
RUO
Positive Control:
Stomach Cancer, Bladder Cancer
Purification:
Affinity Purification
Buffer:
Tris Buffer pH7.6 with BSA, and sodium azide as preservative
Cytokeratin-AE3 is the basic (Type II) subfamilies of cytokeratins. It stains broadly with most epithelia and their neoplasms. AE3 detection is used to observe the distribution of keratin-containing cells in normal epithelia and to identify neoplasms derived from such epithelium
Product Type:
Primary Antibody
Antibody Type:
Monoclonal
Format:
Concentrate
Storage Temp:
2-8 degrees Celsius
Host Animal:
Mouse
Species Reactivity:
Human
Immunogen:
Recombinant Protein
Applications:
IHC
Clone number:
IHC203
GMDN Code:
57079
UKCA Status:
RUO
CE-IVD Status:
RUO
Positive Control:
Colon Cancer, Esophagus
Purification:
Affinity Purification
Buffer:
Tris Buffer pH7.6 with BSA, and sodium azide as preservative
Cytokeratin-AE3 is the basic (Type II) subfamilies of cytokeratins. It stains broadly with most epithelia and their neoplasms. AE3 detection is used to observe the distribution of keratin-containing cells in normal epithelia and to identify neoplasms derived from such epithelium
Product Type:
Primary Antibody
Antibody Type:
Monoclonal
Format:
Concentrate
Storage Temp:
2-8 degrees Celsius
Host Animal:
Mouse
Species Reactivity:
Human
Immunogen:
Recombinant Protein
Applications:
IHC
Clone number:
IHC203
GMDN Code:
57079
UKCA Status:
UKCA
CE-IVD Status:
RUO
Positive Control:
Colon Cancer, Esophagus
Purification:
Affinity Purification
Buffer:
Tris Buffer pH7.6 with BSA, and sodium azide as preservative
Prostate-Specific Antigen (PSA) is a serine protease of the kallikrein family that is produced by the prostate epithelium and epithelial lining of the periurethral glands. Although considered prostate-specific, PSA has also been detected in breast tissue, breast tumours, endometrium, adrenal neoplasms, and renal cell carcinomas. Anti-PSA can be used for differentiating high-grade prostate adenocarcinoma from high-grade urothelial carcinoma, as well as for determining the prostatic origin of carcinomas in non-prostate tissues. Anti-PSA recognizes primary and metastatic prostatic neoplasms, but not tumours of nonprostatic origin, and can be useful as an aid to confirm prostatic acinar cell origin in primary and metastatic carcinomas.
Product Type:
Primary Antibody
Antibody Type:
Monoclonal
Format:
Concentrate
Storage Temp:
2-8 degrees Celsius
Host Animal:
Rabbit
Species Reactivity:
Human
Immunogen:
Recombinant Protein
Applications:
IHC
Clone number:
IHC720
GMDN Code:
57548
UKCA Status:
UKCA
CE-IVD Status:
RUO
Positive Control:
Prostate, Prostate Carcinoma
Purification:
Affinity Purification
Buffer:
Tris Buffer pH7.6 with BSA, and sodium azide as preservative
The antibody abels a 50kDa, multiple myeloma oncogen-1 (MUM1) protein. MUM1 is encoded by the MUM1/IRF-4 gene, which is mapped to 6q23-25 and identified as a myeloma-associated oncogene. It is a member of the interferon regulatory factor family of transcription factors and plays an important role in the regulation of gene expression in response to signaling by interferon and other cytokines. MUM1 positive cells express the protein in the nucleus in a diffuse and microgranular pattern. However, some positivity is also observed in the cytoplasm of MUM1-expressing cells. In normal/reactive lymphoid tissues, such as lymph node, this antibody stains plasma cells, some B-cells in the light zone of terminal centers, and a subset of T-cells (T-cells in germinal centers and interfollicular areas). Anti-MUM1 antibody can stain other B-cell lymphomas such as lymphoplasmacytic lymphoma, chronic lymphocytic leukemia, follicular lymphoma, marginal zone lymphoma, lymphoblastic lymphoma /leukemia, primary effusion lymphoma, DLBCL, Burkitt-like lymphoma, and classical Hodgkin lymphoma.
Antibody Isotype:
IgG
Monosan Range:
MONOSAN Ready To Use
Clone:
MRQ-43
Concentration:
n/a
Storage buffer:
Tris Buffer, pH 7.3-7.7, containing 1% BSA and <0.1% Sodium Azide
Storage:
2-8°C
References 1:
Grossman A, et al. Genomics. 1996; 37:229-33
References 2:
Neresh KN. Haematologica. 2007; 92:267-8
References 3:
Van Imhoff GW, et al. J Clin Oncol. 2006; 24:4135-42
References 4:
Gualco G, et al. Appl Immunohistochem Mol Morphol. 2010; 18:301-10
During each cell cycle cyclins undergo periodic accumulation and destruction. As key regulators of the cell cycle the cyclins control important transitions by acting as regulatory subunits of the Cdks. Early in the G1 phase of the cell cycle, cyclin D1 induction is followed by cyclin E induction. This sequential progression is marked early on in G1 by the activation of Cdk4 and in mid to late G1 by the activation of Cdk2 and the hyperphosphorylation of pRB. The final transition into S phase is thought to be dependent on the increased expression and association of cyclin E and Cdk2. In a recent study, Cyclin D1 regulates cellular metabolism, fat cell differentiation and cellular migration. Cyclin D1 is also involved in development and cancer. Cyclin D1 has also been linked to the development and progression of several cancers including breast, bladder, esophagus, and lung.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
4°C -20°C for long term storage
Host Animal:
mouse
Immunogen:
Purified recombinant fragment of human CCND1 expressed in E. Coli.
USP7 or HAUSP is a ubiquitin specific protease or a deubiquitylating enzyme that cleaves ubiquitin from its substrates. Since ubiquitylation (polyubiquitination) is most commonly associated with the stability and degradation of cellular proteins, HAUSP acitivity generally stabilizes its substrate proteins. HAUSP is most popularly known as a direct antagonist of Mdm2, the E3 ubiquitin ligase for the tumor suppressor protein, p53.Normally, p53 levels are kept low in part due to Mdm2-mediated ubiquitylation and degradation of p53. Interestingly, in response to oncogenic insults, HAUSP can deubiquitinate p53 and protect p53 from Mdm2-mediated degradation, indicating that it may possess a tumor suppressor function for the immediate stabilization of p53 in response to stress. Another important role of HAUSP function involves the oncogenic stabilization of p53. Oncogenes such as Myc and E1A are thought to activate p53 through a p19 alternative reading frame (p19ARF, also called ARF)-dependent pathway, although some evidence suggests ARF is not essential in this process. An intriguing possibility is that HAUSP provides an alternative pathway for safeguarding the cell against oncogenic insults.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
4°C -20°C for long term storage
Host Animal:
mouse
Immunogen:
Purified recombinant fragment of human HAUSP expressed in E. Coli.
Involved in lymphocyte proliferation and functions as a signal transmitting receptor in lymphocytes, natural killer (NK) cells, andplatelets Subcellular location: Membrane, Single-pass type II membrane protein Tissue specificity: Expressed on the surface of activated T-cells, B-cells, natural killer cells, neutrophils, eosinophils, epidermal Langerhanscells and platelets Sequence similarities: Contains 1 C-type lectin domain.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
4°C -20°C for long term storage
Host Animal:
mouse
Immunogen:
Purified recombinant fragment of human CD69 expressed in E. Coli.
Hyaluronan or hyaluronic acid (HA) is a high molecular weight unbranched polysaccharide synthesized by a wide variety of organisms from bacteria to mammals, and is a constituent of the extracellular matrix. It consists of alternating glucuronic acid and N-acetylglucosamine residues that are linked by beta-1-3 and beta-1-4 glycosidic bonds. HA is synthesized by membrane-bound synthase at the inner surface of the plasma membrane, and the chains are extruded through pore-like structures into the extracellular space. It serves a variety of functions, including space filling, lubrication of joints, and provision of a matrix through which cells can migrate. HA is actively produced during wound healing and tissue repair to provide a framework for ingrowth of blood vessels and fibroblasts. Changes in the serum concentration of HA are associated with inflammatory and degenerative arthropathies such as rheumatoid arthritis. In addition, the interaction of HA with the leukocyte receptor CD44 is important in tissue-specific homing by leukocytes, and overexpression of HA receptors has been correlated with tumor metastasis. HAS1 is a member of the newly identified vertebrate gene family encoding putative hyaluronan synthases, and its amino acid sequence shows significant homology to the hasA gene product of Streptococcus pyogenes, a glycosaminoglycan synthetase (DG42) from Xenopus laevis, and a recently described murine hyaluronan synthase.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
4°C -20°C for long term storage
Host Animal:
mouse
Immunogen:
Purified recombinant fragment of human HAS1 expressed in E. Coli.
Epitope tagging offers an easy and universal strategy for the identification and purification of proteins derived by recombinant DNA technology. The insertion of a Maltose Binding Protein (MBP) tag creates a stable fusion product that does not interfere with the bioactivity of the protein or with the biodistribution of the MBP tagged product. Cleavage by factor Xa separates MBP from its partner protein.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
4°C -20°C for long term storage
Host Animal:
mouse
Immunogen:
Recombinant fusion protein with Maltose binding protein tag.
DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
4°C -20°C for long term storage
Host Animal:
mouse
Immunogen:
Purified recombinant fragment of human DDX4 expressed in E. Coli.
HAND1: heart and neural crest derivatives expressed 1. The protein encoded by this gene belongs to the basic helix-loop-helix family of transcription factors. This gene product is one of two closely related family members, the HAND proteins, which are asymmetrically expressed in the developing ventricular chambers and play an essential role in cardiac morphogenesis. Working in a complementary fashion, they function in the formation of the right ventricle and aortic arch arteries, implicating them as mediators of congenital heart disease. In addition, it has been suggested that this transcription factor may be required for early trophoblast differentiation.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
4°C -20°C for long term storage
Host Animal:
mouse
Immunogen:
Purified recombinant fragment of HAND1 (aa90-190) expressed in E. Coli.
MDM4, encodes a 490-amino acid protein containing a RING finger domain and a putative nuclear localization signal. The MDM4 putative nuclear localization signal, which all Mdm proteins contain, is located in the C-terminal region of the protein. The mRNA is expressed at a high level in thymus and at lower levels in all other tissues tested. MDM4 protein produced by in vitro translation interacts with p53 via a binding domain located in the N-terminal region of the MDM4 protein. MDM4 shows significant structural similarity to p53-binding protein MDM2.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
4°C -20°C for long term storage
Host Animal:
mouse
Immunogen:
Purified recombinant fragment of human MDM4 expressed in E. Coli.
Dkk-3 (Dickkopf-3) is a member of the dickkopf family. It is a 350 amino acid secreted glycoprotein that is composed of an N-terminal signal peptide and two conserved cysteine-rich domains, which are separated by a 12 amino acid linker region. This secreted protein is involved in embryonic development through its interactions with the Wnt signaling pathway. The expression of this gene is decreased in a variety of cancer cell lines and it may function as a tumor suppressor gene.
Product Type:
Antibodies Primary
Antibody Type:
monoclonal
Storage Temp:
4°C -20°C for long term storage
Host Animal:
mouse
Immunogen:
Purified recombinant fragment of human DKK3 expressed in E. Coli.
X
We use cookies to help personalise and improve your web experience.
By using our website you consent to our use of cookies, some of which may have already been set on your device.
View our Cookie Policy to learn more.
